ID: 1106238000

View in Genome Browser
Species Human (GRCh38)
Location 13:27881615-27881637
Sequence CAAGCTGTAAAGATGGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106237995_1106238000 30 Left 1106237995 13:27881562-27881584 CCAGGGACTTTTCTGCTAGAGGT 0: 1
1: 0
2: 4
3: 22
4: 201
Right 1106238000 13:27881615-27881637 CAAGCTGTAAAGATGGCACTGGG 0: 1
1: 0
2: 2
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106238000 Original CRISPR CAAGCTGTAAAGATGGCACT GGG Intergenic
901348634 1:8570741-8570763 CAAGCTGCACAGATGGCTCCAGG + Intronic
901833240 1:11906880-11906902 GAGGCTGGAAAGATGGCCCTGGG + Intergenic
906341048 1:44981137-44981159 CAAGCAGTAGTGATGGCAGTAGG - Exonic
918993253 1:191726134-191726156 CAAGCTGTAAAGATTCCTCTGGG + Intergenic
921525956 1:216218533-216218555 CACACTGTAAAAATGGCAGTGGG - Intronic
922653116 1:227357980-227358002 CAGGCTGCAACCATGGCACTTGG + Intergenic
924258372 1:242204651-242204673 CATGCTGCAGTGATGGCACTAGG + Intronic
924453285 1:244198436-244198458 CCAGCTGGCAAGAAGGCACTTGG - Intergenic
1063413787 10:5856962-5856984 CAATCTGTGAAGATGGCATTCGG - Intergenic
1064065901 10:12181368-12181390 CAACCTGTACAGCTGTCACTTGG - Intronic
1064577817 10:16763654-16763676 CAAGCTGGGAAGATGGTTCTGGG - Intronic
1065776755 10:29127720-29127742 GAAGCGGTAAAGAGGGCACAAGG - Intergenic
1071256182 10:83873835-83873857 CATGCAGTCTAGATGGCACTGGG - Intergenic
1072770770 10:98135227-98135249 CAAACTTTAAAGATCGGACTTGG - Intronic
1074862319 10:117519912-117519934 AAAGCTGTCAAGATCACACTTGG - Intergenic
1075107571 10:119551686-119551708 CAAGCGGTAAAGATTCCTCTGGG - Intergenic
1085324966 11:75599611-75599633 CAAGATTTAAAGAGGGTACTAGG + Intronic
1087445390 11:98244461-98244483 TAAGTTTTAAAGATGGTACTGGG - Intergenic
1087861999 11:103170168-103170190 CAAGCCATGAAGATGGGACTTGG + Exonic
1088117770 11:106332311-106332333 AAAGCTGTAAAGCTGGCAAGAGG - Intergenic
1088742392 11:112777667-112777689 GAAGCTGTCATGATGTCACTAGG + Intergenic
1089138585 11:116269001-116269023 CATGTTTTAAAGATGGCACAAGG + Intergenic
1091128599 11:133124393-133124415 CAAGCCATAAAGATGGGTCTAGG - Intronic
1093270912 12:17060170-17060192 CAAGCACTATAGATGGCATTGGG + Intergenic
1094381539 12:29848703-29848725 GAAGCTGGACAGATGGCACCTGG + Intergenic
1097032084 12:56097104-56097126 CAAGCTGCAGAGATGACCCTGGG - Exonic
1098054840 12:66493964-66493986 GAATCTGTAAAGATGCCTCTGGG + Intronic
1098602323 12:72346642-72346664 CAGGCTCTAAGGTTGGCACTCGG - Intronic
1101652216 12:106687692-106687714 AAAGTTGTAAAGATAGTACTGGG - Intronic
1102579453 12:113877027-113877049 CAAGCCACAGAGATGGCACTTGG + Intronic
1106238000 13:27881615-27881637 CAAGCTGTAAAGATGGCACTGGG + Intergenic
1106415720 13:29544148-29544170 CACGCTGTAAAGATCGCACTGGG - Intronic
1106788895 13:33134539-33134561 TAAACTGTAAAGATGGTATTAGG + Intronic
1110021443 13:70478515-70478537 CAAGCTGTAAAGATTGAGCCAGG + Intergenic
1117561516 14:56944597-56944619 CATGCTGTATATCTGGCACTAGG - Intergenic
1120297070 14:82655494-82655516 CAAGCCGTAAAGATTTCTCTGGG - Intergenic
1124174407 15:27408811-27408833 GAAGCTGAAAAGAAGGCAATGGG - Intronic
1127303912 15:57683528-57683550 CAACCTGTAAAGGTTGTACTAGG - Intronic
1131335664 15:91546299-91546321 CAAACTGGAAAGATGGGATTGGG + Intergenic
1132501764 16:287671-287693 CAAGCTGTGTTGAAGGCACTCGG + Exonic
1135190078 16:20347697-20347719 CCAATTGTAAAGTTGGCACTTGG + Intronic
1136023203 16:27453133-27453155 TAAGCTGTAAGGAGGGTACTGGG + Intergenic
1137335949 16:47549342-47549364 CACGCTGAAAATATGGCAATGGG - Intronic
1137749949 16:50853671-50853693 CAAGCTGACAACATGGCACATGG - Intergenic
1140749192 16:78007997-78008019 GAAGCTCTAATGCTGGCACTTGG + Intergenic
1141003500 16:80330618-80330640 CCAGCTGTAGGCATGGCACTTGG - Intergenic
1142126322 16:88412300-88412322 CAGGCTGTGGAGAGGGCACTGGG - Intergenic
1146569405 17:33939853-33939875 CAAGTTGTAAATAGGGCATTTGG + Intronic
1151457227 17:74233217-74233239 CCAGGTGGAAAGGTGGCACTGGG + Intronic
1152377167 17:79924806-79924828 CCACCTGGAAAGATGACACTGGG + Intergenic
1158790490 18:60774743-60774765 CAAGCTGTTAGGGTGGCAGTTGG - Intergenic
1158991097 18:62869651-62869673 CAAGCTGATAATATGTCACTTGG - Intronic
1159707394 18:71708151-71708173 GCAGCTGTAATGATGGGACTAGG + Intergenic
1162013958 19:7833724-7833746 CCAAGTGTACAGATGGCACTGGG - Intronic
1166336573 19:42111862-42111884 CAAGCTCTAAAGATGGGAGTAGG + Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167556607 19:50200265-50200287 CAAACAGGAAAGAAGGCACTGGG - Intronic
928157437 2:28889393-28889415 CAAGCTGGAAAGATAGGAGTTGG + Intergenic
931237950 2:60427653-60427675 CAATGGGTAAAGATGGCAATGGG + Intergenic
933687827 2:85157545-85157567 CAAGCTGTCAGCATGGCCCTGGG - Intronic
933942716 2:87258424-87258446 CAAGCTATAACAGTGGCACTTGG + Intergenic
936276360 2:111101275-111101297 TAAGCTGGAAAGATGGTGCTGGG + Intronic
937383642 2:121405511-121405533 CAAACTTTAAACATGGGACTTGG - Intronic
940227455 2:151414639-151414661 CAAGCTGTACACATGGCCTTTGG + Intronic
941750780 2:169133677-169133699 CAAGCAGTAAAAGTGGCGCTGGG + Intronic
942120042 2:172767788-172767810 AAAGCTTAAAAGATGACACTAGG + Intronic
943753262 2:191532021-191532043 CATGTTGTAAAGATGTCCCTGGG - Intergenic
945423162 2:209664045-209664067 CAAGATATAAACATGGTACTTGG - Intronic
948516956 2:238510099-238510121 CAAGCTGCAAAGCGGGCACCAGG - Intergenic
1168985417 20:2044158-2044180 AGATCTGTAAAGATGGGACTTGG + Intergenic
1173504287 20:43574834-43574856 CCAGCTGTAAATAAGGCACTTGG - Intronic
1174453787 20:50635935-50635957 CAAGCTAGAAAGATAGCCCTGGG + Intronic
1177906248 21:26974320-26974342 CCAGATGTAAAGATGGTAGTGGG + Intergenic
1178711879 21:34924362-34924384 CAAGGTGTAGAGGTGGCACAGGG + Intronic
1180791563 22:18577939-18577961 CAAGCTTCCAAGATGGCGCTGGG - Intergenic
1181230177 22:21417372-21417394 CAAGCTTCCAAGATGGCGCTGGG + Intergenic
1181248472 22:21517491-21517513 CAAGCTTCCAAGATGGCGCTGGG - Intergenic
1181821884 22:25482758-25482780 CAAGCTGTAAGGATGAAGCTTGG + Intergenic
1182970187 22:34566517-34566539 CAAGTTGAGAAGATGCCACTGGG - Intergenic
950199905 3:11035491-11035513 CAGGCTGAAAAGATGCCACGGGG + Intronic
953441517 3:42922617-42922639 CAAGCTGTAAAGCAGGCAAGTGG + Intronic
955050691 3:55407818-55407840 CATGCTCTAAAGATGGCTCCAGG - Intergenic
955113825 3:55976418-55976440 GAAGCTGTAAAAAAGGCATTCGG - Intronic
960405201 3:117251563-117251585 CAAGCTTGAAAGATGGGTCTGGG - Intergenic
961397979 3:126610678-126610700 CAAGCTATCAAGATGGCCCTGGG + Intronic
961398077 3:126611699-126611721 CAAGCTGGAGAGAGGGCACATGG - Intronic
962503821 3:136025681-136025703 CAAACTTTAGAGATGGCATTAGG + Intronic
963764056 3:149315586-149315608 AAAGATGTAAAGATGGAAGTAGG - Intergenic
967525370 3:190486659-190486681 CTAGCAGCACAGATGGCACTGGG + Intergenic
969393464 4:6906262-6906284 CAAGCTGCCAAGCTGGCACCTGG - Intergenic
969869914 4:10098164-10098186 GAAGCTGTAAAGATAGCCCTGGG - Intronic
970421899 4:15912768-15912790 CAAGCTGTAAAAATCCCACAAGG - Intergenic
971692589 4:29856638-29856660 CAAACTGTACAGCAGGCACTGGG + Intergenic
971893980 4:32565693-32565715 CAGTCTGCAAAGATGGCACTAGG - Intergenic
972995423 4:44873037-44873059 CAACCAGTAAAGATCTCACTGGG - Intergenic
974100399 4:57410181-57410203 GAAGCTGTAAAGAGGGCCCATGG - Intergenic
974869686 4:67625223-67625245 CAAGCAGTAAAGATTTTACTAGG + Intronic
975163845 4:71154318-71154340 CAAGCTGTGATGAAGGAACTTGG + Intergenic
977211405 4:94222487-94222509 CAGGCTGTGAGGATGCCACTTGG + Intronic
980345959 4:131620026-131620048 CAAACTGTAATGGTGGCAGTAGG - Intergenic
983312128 4:166077972-166077994 CAAGCAGGAAAGAATGCACTTGG + Exonic
984210861 4:176845995-176846017 CAATCAGTAAAGATAGCTCTGGG - Intergenic
986030869 5:3891337-3891359 CAAGCTGTGAAGCTGCCCCTGGG + Intergenic
986606805 5:9530954-9530976 CAAGATGTGAAGAGGGTACTTGG - Intronic
992175682 5:74146692-74146714 CAGGCTGTGATGCTGGCACTGGG + Intergenic
993523950 5:88941487-88941509 CAAGCTCTTCAGATGCCACTTGG - Intergenic
994092058 5:95818278-95818300 CAGGCTGTACAGACGGCACGGGG + Intronic
994675128 5:102811384-102811406 CAAGCTGTAAAGATGGAAGGAGG - Intronic
996435016 5:123424281-123424303 AAAGCTGCAGAGATAGCACTAGG + Intergenic
997664785 5:135621158-135621180 TAAGTAGTAAAGCTGGCACTTGG - Intergenic
998338547 5:141395814-141395836 CAAACTTTAAAGATGGATCTTGG + Intronic
999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG + Intronic
1000144005 5:158435276-158435298 TAAGGTGTGCAGATGGCACTGGG - Intergenic
1000826314 5:166048784-166048806 CAAGTTGCAAAGGTGGCAATAGG - Intergenic
1002650899 5:180692860-180692882 AAAGTTGTAAAGAGGGCAATTGG - Intergenic
1003268619 6:4588380-4588402 CAAAAAGGAAAGATGGCACTGGG + Intergenic
1003491848 6:6629158-6629180 CAAGCTGAGAAGCTGGCATTGGG + Intronic
1003654766 6:7996238-7996260 CAAGCTGGAAACATGTCATTGGG + Intronic
1003849416 6:10206585-10206607 CAAGCCCTAAAGAGGGCTCTAGG + Intronic
1004089435 6:12485787-12485809 CAATCTGTAAAGATGAAAATTGG - Intergenic
1004704851 6:18115215-18115237 CATGCTGTATAGATGGCTCCTGG + Intergenic
1004764724 6:18713316-18713338 CAAAATGAAAAGATGGCACTAGG - Intergenic
1006100610 6:31683924-31683946 CTAGCAGAAAAGATGGCGCTGGG - Intronic
1007014580 6:38451657-38451679 CCAGTAGTAAACATGGCACTTGG - Intronic
1007208933 6:40175926-40175948 CAAGCTGTAAAGATTTCTCTGGG - Intergenic
1007452690 6:41952198-41952220 CTAGCTGTATGGCTGGCACTGGG - Intronic
1008265949 6:49426516-49426538 AAAACTTTAAAAATGGCACTAGG + Intergenic
1011401088 6:86962455-86962477 CATGATGTTAGGATGGCACTAGG - Intronic
1011724365 6:90194203-90194225 CAATCTGAAAAGAAGTCACTAGG + Intronic
1013832907 6:114295816-114295838 CAAGCTGTGAAGAAGCCACTTGG - Intronic
1016512711 6:144861474-144861496 AAAGCTATAAAGATGGGACGTGG - Intergenic
1016925533 6:149342770-149342792 TAAGCTGCAAAAATGGCAATGGG + Exonic
1017633996 6:156425762-156425784 CAAGCAATAATGATGGCATTAGG - Intergenic
1023019974 7:36003028-36003050 CAAGCTATAAAGATTCCTCTGGG + Intergenic
1024556893 7:50611578-50611600 CATCCTATAAAAATGGCACTAGG + Intronic
1024607952 7:51038335-51038357 CAAGCAGTGAAGATGCCACTGGG + Intronic
1025141069 7:56465662-56465684 CAAGCTGTAAAGCAGAAACTTGG - Intergenic
1028605904 7:92655352-92655374 CAATCTGTAAAAAAGGTACTAGG + Intronic
1029156685 7:98522226-98522248 CCAGCTGCACAGAGGGCACTAGG - Intergenic
1029799954 7:102936049-102936071 CCAGCTGTAAAGATGGCACCTGG + Intronic
1029895794 7:103982466-103982488 AAAGGTGTAGAGATGGCAATGGG + Intronic
1032629022 7:133626478-133626500 AATGCAGTATAGATGGCACTTGG + Intronic
1033399501 7:141008514-141008536 CAGGCACTTAAGATGGCACTAGG - Intronic
1037625387 8:20601854-20601876 CAAGCTGCCAAGAGGGCTCTGGG - Intergenic
1038657333 8:29465790-29465812 CAAGCAGTAATGCTGGCAGTGGG - Intergenic
1038801592 8:30754293-30754315 GAAATTCTAAAGATGGCACTTGG + Intronic
1039246097 8:35610219-35610241 CGAGCTTTAAAGTTGGCTCTTGG - Intronic
1045868979 8:106903882-106903904 CAAGCTGGAAAGAAGGCTATAGG - Intergenic
1045970782 8:108077503-108077525 CAAGATGAAAAGATGGGAGTGGG - Intronic
1046610925 8:116424794-116424816 CAAAATATAAAGATGGCAGTTGG - Intergenic
1047026100 8:120826314-120826336 AAAGCTTTAAAAATGGCACTTGG + Intergenic
1047664802 8:127079886-127079908 CAAACTGTAAATATGGGAGTGGG - Intergenic
1048022015 8:130548039-130548061 CAAGCTTTGAAGATGCCACCAGG - Intergenic
1049184960 8:141245482-141245504 CAAGCAGTAAAGGGGGCTCTGGG - Intronic
1050400188 9:5244815-5244837 CAATCTGTAAAGATGGGAGGAGG + Intergenic
1051842664 9:21415976-21415998 CATCCTGTACTGATGGCACTAGG + Intronic
1057188239 9:93070955-93070977 CAAGCGCTAAATAGGGCACTGGG + Intronic
1058849699 9:108999159-108999181 CAAGCTGTCAACTTGGCAGTTGG - Exonic
1059423832 9:114208750-114208772 CGAGGTGCAAAAATGGCACTGGG + Intronic
1061113379 9:128591620-128591642 CAATCAGTAAGGATGACACTGGG + Exonic
1187486182 X:19706544-19706566 CATGCTCTAAAGATGGATCTGGG + Intronic
1188597685 X:31921511-31921533 AAAGTTGTAAATATGGCTCTTGG - Intronic
1190016593 X:46832736-46832758 CAAGCTCCAGAGATGGCTCTGGG - Intergenic
1192769289 X:74170142-74170164 CAAGCTGTCAAGTAGCCACTGGG - Intergenic
1193255426 X:79342855-79342877 CAAGCAGTGAAGTTGTCACTTGG - Intergenic
1195588804 X:106600112-106600134 CAAACTGTAGGGAAGGCACTTGG - Intergenic
1199207127 X:145161678-145161700 CAATCAGTAATGATGACACTCGG + Intergenic
1201266399 Y:12211229-12211251 CAAGCTATAAAGATTCCTCTGGG - Intergenic