ID: 1106239742

View in Genome Browser
Species Human (GRCh38)
Location 13:27901547-27901569
Sequence CCCCCACACATTTTATCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106239742 Original CRISPR CCCCCACACATTTTATCCCC TGG (reversed) Intergenic
900470534 1:2852252-2852274 CACCCACACATCTTATCCACTGG + Intergenic
900470565 1:2852460-2852482 CACCCACACATCTTATCCACTGG + Intergenic
900470598 1:2852668-2852690 CACCCACACATCTTATCCACTGG + Intergenic
900470607 1:2852720-2852742 CACCCACACATCTTATCCACTGG + Intergenic
900470616 1:2852772-2852794 CACCCACACATCTTATCCACTGG + Intergenic
900470625 1:2852824-2852846 CACCCACACATCTTATCCACTGG + Intergenic
900470634 1:2852876-2852898 CACCCACACATCTTATCCACTGG + Intergenic
901242027 1:7700656-7700678 GCCCAACACATTCTTTCCCCCGG - Intronic
901690742 1:10971606-10971628 CCCCCACCCATTCTCTACCCTGG + Intronic
903772861 1:25775046-25775068 CTCCCACACATTATTTCCACTGG - Intronic
908000078 1:59671205-59671227 CACCGACACATTTTGTCCTCTGG - Intronic
909683591 1:78320524-78320546 CAGCCACACATTTTATTCCAAGG - Intronic
912087431 1:106026854-106026876 CACACACACATTTTATGCCATGG - Intergenic
913137533 1:115907111-115907133 CACCCACAAATTTTATCACTGGG - Intergenic
917266246 1:173223853-173223875 CCACCACCCATTCTTTCCCCTGG - Intergenic
917623021 1:176817427-176817449 GCCTGACACATTTTATCACCAGG + Intronic
919452674 1:197789094-197789116 CCCTCACAAATTTAATCTCCAGG + Intergenic
1062821477 10:537522-537544 CCCCCACACATTTGTCCCCAGGG + Intronic
1064376522 10:14801482-14801504 CCCCCAAACTTTTTCTCCTCAGG + Intergenic
1064384051 10:14875491-14875513 CCCTCAAACATTTTAGTCCCAGG + Intergenic
1067966890 10:50923327-50923349 CCCCCACACAGTGTACCCACTGG - Intergenic
1069876416 10:71566035-71566057 CCCCTTCACATTTTATTTCCTGG - Intronic
1071539591 10:86468578-86468600 CCTTAACACATTTTTTCCCCTGG + Intronic
1074899147 10:117801746-117801768 CCACCACACCTTTTACCCACAGG - Intergenic
1076263533 10:129091135-129091157 CTCCCACACCCTTTGTCCCCAGG + Intergenic
1076265426 10:129106017-129106039 CCGCTACAAATTTTAACCCCAGG + Intergenic
1078730742 11:13971712-13971734 CTCCCACACACTTTAGCACCTGG + Intronic
1084346461 11:68553171-68553193 CCCAAACACATTTTATTCTCTGG - Intronic
1085051962 11:73384600-73384622 ACCCCATACTTTGTATCCCCAGG + Intronic
1086538371 11:87877664-87877686 CCACCTTACATTTCATCCCCAGG + Intergenic
1086943836 11:92825550-92825572 CCCCCACACATCTCCTTCCCTGG - Intronic
1087479567 11:98681466-98681488 CCCTCACACATCTCTTCCCCAGG + Intergenic
1087497361 11:98908196-98908218 CCCCCACACAGTGTACCCACTGG + Intergenic
1091488003 12:908414-908436 GCGCCACACATTTTATACCATGG + Intronic
1091617022 12:2057438-2057460 CCCCTACACCTTTCATCACCAGG - Intronic
1091663035 12:2398713-2398735 ACCCCACACATCCTCTCCCCTGG - Intronic
1094206289 12:27844148-27844170 CTCCCACCCATTTGATCCTCTGG + Intergenic
1094761777 12:33541391-33541413 CTGCCTCACATTTTATTCCCTGG - Intergenic
1098218432 12:68243666-68243688 CCCGTTCACATTTAATCCCCGGG - Intergenic
1099914340 12:88873312-88873334 CCTCCATCCATTTTAGCCCCAGG + Intergenic
1103008759 12:117441684-117441706 CCCCAACACATTGGATGCCCTGG + Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106239742 13:27901547-27901569 CCCCCACACATTTTATCCCCTGG - Intergenic
1108286539 13:48914777-48914799 CTTCCACACATTTCTTCCCCAGG - Intergenic
1115415313 14:33125706-33125728 CCCACAAATATTTTATACCCTGG - Intronic
1119190763 14:72680297-72680319 GCCCCACACTTTTTATTCCTGGG - Intronic
1124784939 15:32671055-32671077 CCCACAAGCATGTTATCCCCGGG + Intronic
1125764174 15:42122024-42122046 CACACACACATATTATCCCTGGG + Intergenic
1127723903 15:61728682-61728704 CCCCCACTGATTTTAGCCCTAGG + Intergenic
1127899782 15:63332539-63332561 CCACCACCCATTCTTTCCCCAGG - Intronic
1130402938 15:83574123-83574145 CCCCTACACACCCTATCCCCTGG - Intronic
1133463771 16:6010123-6010145 GCCCCACACCTCGTATCCCCAGG + Intergenic
1138425844 16:56931721-56931743 CCCCCACCCTTTTTCACCCCAGG - Intergenic
1140683491 16:77410094-77410116 CCCACACACATTTTATAACATGG + Intronic
1141899772 16:86983658-86983680 ACCCCCCAAATTTTACCCCCAGG - Intergenic
1141997382 16:87644236-87644258 CCCTCTCTCATTTTCTCCCCAGG + Exonic
1144242229 17:13323798-13323820 CCTCTAGACATTTTATTCCCTGG + Intergenic
1145043454 17:19593997-19594019 CACCCACACATTCTACTCCCGGG - Intergenic
1148732874 17:49848282-49848304 CCCCCTAACATTTGATCCCAGGG + Intergenic
1152037624 17:77883186-77883208 TCCCCACACATTTCATGTCCAGG - Intergenic
1152249618 17:79204919-79204941 CACCCATCCATTTCATCCCCAGG - Intronic
1157937861 18:51893002-51893024 CCCAGACCCATTTTATTCCCTGG - Intergenic
1160295201 18:77631082-77631104 CCCCCACACAGAGTCTCCCCTGG - Intergenic
1160857539 19:1224191-1224213 CCCCCAGACACTGTACCCCCCGG - Intronic
1161709874 19:5841887-5841909 TCCCCACACCTCTTACCCCCTGG + Intergenic
1161716083 19:5877039-5877061 TCCCCACACCTCTTACCCCCTGG + Intronic
1162780504 19:13004480-13004502 CCCCCACACATATTCGCACCTGG + Intronic
1165118974 19:33546949-33546971 CCCCCAAACCTTCTATGCCCAGG + Intergenic
926202755 2:10813134-10813156 CCCCCACCCTCTTTATCCCGGGG + Intronic
927021738 2:19024332-19024354 ACAGCACATATTTTATCCCCTGG + Intergenic
927272569 2:21228753-21228775 CCCCCACACTTTTCATCCTATGG - Intergenic
933065052 2:77781938-77781960 CCCCCACACATTGTCTCTACCGG + Intergenic
937849995 2:126623437-126623459 CCCCCATACCCTTTATGCCCAGG - Intergenic
943162285 2:184269804-184269826 CCCCCAAACATTTTGGCACCAGG + Intergenic
945443546 2:209909469-209909491 TGCACAGACATTTTATCCCCTGG + Intronic
947498596 2:230656710-230656732 CCCCAAACCTTTTTATCCCCCGG - Intergenic
1172398321 20:34626232-34626254 ACTACAAACATTTTATCCCCAGG + Intronic
1172557757 20:35857204-35857226 GCCCCACCCATTTTTGCCCCAGG - Intronic
1173970354 20:47147734-47147756 ACCCCACAGATTCTTTCCCCTGG - Intronic
1174343184 20:49910745-49910767 CCTCCACAGATTTTGTCCCCAGG + Intronic
1174656764 20:52178142-52178164 CCCCCTAATATATTATCCCCAGG + Intronic
1176105159 20:63382432-63382454 TCCCCACCCATTTTACCCCCAGG + Intergenic
1179049554 21:37877220-37877242 CCCTCTCACCTTTTCTCCCCAGG + Intronic
1180034320 21:45235908-45235930 CCCCCACCTATTTTTTCCCTCGG - Intergenic
1184362270 22:44025505-44025527 TCCCCAGACATTTTCTCCCAGGG + Intronic
953784141 3:45897674-45897696 CCCCCTCTCATTTGTTCCCCAGG + Intronic
954225511 3:49178327-49178349 CCCCCACAAACTTTCTCCTCTGG - Intronic
956213404 3:66824906-66824928 CCCCCACACAATTTCTCTCTGGG + Intergenic
956603287 3:71046250-71046272 CCCACTGACATTTTATCCCAAGG - Intronic
958702200 3:97606940-97606962 TCACCACACATTTTATTGCCTGG + Intronic
961145500 3:124589623-124589645 GCCCCAAGGATTTTATCCCCTGG - Intronic
961768100 3:129227999-129228021 CCCCCACCCATTTCTCCCCCTGG - Intergenic
968326514 3:197822199-197822221 CCTTCACACTTTTTATCCTCAGG + Intronic
969613592 4:8240086-8240108 CCCCCACCCAGCTTCTCCCCAGG - Intronic
970465341 4:16316646-16316668 CCCCCGCAGATTTATTCCCCAGG - Intergenic
973829822 4:54747515-54747537 TCCCCAAACATTTTAGCACCAGG + Intergenic
981312696 4:143312616-143312638 CCCCAACACATTTCATTTCCAGG - Intergenic
982506047 4:156219037-156219059 CCCCCACACAGAGTATCCACTGG + Intergenic
982810972 4:159825540-159825562 CCTCCAGACATTTCATTCCCAGG - Intergenic
983109733 4:163734661-163734683 TCCCCACTGCTTTTATCCCCAGG - Intronic
985728859 5:1533310-1533332 CCCCTACACATTTCATCCTCAGG + Intergenic
987288116 5:16480152-16480174 CCCCCACCCACCTCATCCCCAGG + Intronic
993161516 5:84297903-84297925 CCACTACAGATTTTATGCCCTGG + Intronic
993211677 5:84960904-84960926 TCCCCAAACATTTTGTCACCAGG + Intergenic
996397805 5:123031326-123031348 CCCCCAAACACTGTATGCCCAGG + Intronic
997594023 5:135094532-135094554 TCCTCAGACATCTTATCCCCTGG - Intronic
998908413 5:146931673-146931695 CACCCACCCAACTTATCCCCAGG - Intronic
1000344566 5:160304027-160304049 CCCACACCCATTTTCTCCCTGGG + Intronic
1013459239 6:110358894-110358916 CCCCCACACATTTCATAACACGG - Intergenic
1015815966 6:137211102-137211124 CCCCCACACACTTCTTCTCCAGG - Intronic
1023418947 7:39958778-39958800 GCCTCAAAAATTTTATCCCCAGG - Intronic
1024307559 7:47941124-47941146 CCCCCACCCCTCTCATCCCCAGG + Intronic
1024396342 7:48872747-48872769 CCCTGACACATTTTTTCCGCTGG - Intergenic
1030436348 7:109526139-109526161 CACACACACATTTTTTCCCCAGG - Intergenic
1032364722 7:131288132-131288154 ACCCCACAGATTTCGTCCCCTGG + Intronic
1033089586 7:138372853-138372875 CCCCTGCACATTTTTTCACCAGG - Intergenic
1037589314 8:20300051-20300073 CCCCCACCCACTCTATCTCCAGG - Intronic
1041556834 8:59167101-59167123 TCCCCACACCCTTTAGCCCCTGG + Intergenic
1042831765 8:73037380-73037402 CCCCCAAATATTTTATTCCAAGG - Intronic
1044619909 8:94179296-94179318 ACCACACACAATTTTTCCCCTGG + Intronic
1047996964 8:130346169-130346191 CCCCCTCACTTTTTAACCCTAGG - Intronic
1049855955 8:144862015-144862037 TCCTCACACATATTATCCCCCGG - Intergenic
1052208286 9:25869984-25870006 CCCCCACACAAATTTTCCACTGG - Intergenic
1052497354 9:29244416-29244438 CCCCAACACACTTTATGTCCAGG + Intergenic
1053139830 9:35675682-35675704 CCCCCTCACCTTTTCTACCCGGG + Intronic
1056567292 9:87785403-87785425 CACCGAGACATTCTATCCCCAGG + Intergenic
1058107410 9:100988508-100988530 CCCACCCACCTTTTACCCCCAGG - Intergenic
1060252827 9:121999851-121999873 CAATCACACATTTTATACCCTGG + Intronic
1061032215 9:128092145-128092167 CCCACACTCGTTTTTTCCCCAGG - Intronic
1185536190 X:863249-863271 GACCCACACATTTTAAGCCCCGG + Intergenic
1188943140 X:36264379-36264401 ACCCAACACAGTTTATCCCTTGG + Intronic
1190856812 X:54304126-54304148 CCCCCACACATATTGTATCCTGG + Intronic
1193492065 X:82162410-82162432 CCCCCACACATATTCCCCACTGG + Intergenic
1194409817 X:93543814-93543836 CCCCCACACAGTGTCTCCACTGG - Intergenic
1194537128 X:95119293-95119315 CCCCCAGACACTTTGTCCCAGGG + Intergenic
1195497237 X:105550771-105550793 CTCCCAGACATTTTGTCCCATGG - Intronic
1199170723 X:144731939-144731961 CTCCCACACATATTTGCCCCTGG - Intergenic
1200086950 X:153611639-153611661 CCCCCACACCTTGTGCCCCCAGG + Intergenic