ID: 1106242082 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:27920512-27920534 |
Sequence | GCCTTTCCACGCGTGAGCTT TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 59 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 56} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1106242082_1106242090 | 22 | Left | 1106242082 | 13:27920512-27920534 | CCAAAGCTCACGCGTGGAAAGGC | 0: 1 1: 0 2: 0 3: 2 4: 56 |
||
Right | 1106242090 | 13:27920557-27920579 | CCCCACCCCTTTCTCCTTTCCGG | 0: 1 1: 0 2: 8 3: 47 4: 448 |
||||
1106242082_1106242086 | -3 | Left | 1106242082 | 13:27920512-27920534 | CCAAAGCTCACGCGTGGAAAGGC | 0: 1 1: 0 2: 0 3: 2 4: 56 |
||
Right | 1106242086 | 13:27920532-27920554 | GGCCAGTGGGCAGGTAAGCCTGG | 0: 1 1: 0 2: 4 3: 17 4: 307 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1106242082 | Original CRISPR | GCCTTTCCACGCGTGAGCTT TGG (reversed) | Exonic | ||