ID: 1106242082

View in Genome Browser
Species Human (GRCh38)
Location 13:27920512-27920534
Sequence GCCTTTCCACGCGTGAGCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106242082_1106242090 22 Left 1106242082 13:27920512-27920534 CCAAAGCTCACGCGTGGAAAGGC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1106242090 13:27920557-27920579 CCCCACCCCTTTCTCCTTTCCGG 0: 1
1: 0
2: 8
3: 47
4: 448
1106242082_1106242086 -3 Left 1106242082 13:27920512-27920534 CCAAAGCTCACGCGTGGAAAGGC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1106242086 13:27920532-27920554 GGCCAGTGGGCAGGTAAGCCTGG 0: 1
1: 0
2: 4
3: 17
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106242082 Original CRISPR GCCTTTCCACGCGTGAGCTT TGG (reversed) Exonic
903813751 1:26049655-26049677 GCCTTTCCTGGCGTGAGTCTGGG + Intergenic
904575654 1:31503553-31503575 CCCTTCCCACCCTTGAGCTTCGG - Intergenic
920076578 1:203341679-203341701 GGCTTTCCAGGGGTGAGGTTAGG + Exonic
1078015535 11:7610444-7610466 GCCTTCCCAGGTCTGAGCTTAGG - Intronic
1093452761 12:19334487-19334509 GCATTTCCACAAGGGAGCTTAGG + Intronic
1102981993 12:117249237-117249259 GCCCTTCCACAGATGAGCTTGGG - Intronic
1104719964 12:131039740-131039762 CCCTTTCCCAGCGTGAGCCTGGG - Intronic
1105935180 13:25091796-25091818 GGCTTTCCAAGATTGAGCTTAGG - Intergenic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1113752502 13:112785986-112786008 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752519 13:112786109-112786131 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752535 13:112786232-112786254 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752551 13:112786355-112786377 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752568 13:112786478-112786500 GCCCGTCCACGCGTGTGCCTGGG - Intronic
1113752585 13:112786601-112786623 GCCCGTCCACGCGTGTGCCTGGG - Intronic
1113752601 13:112786724-112786746 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1118725042 14:68623038-68623060 CCCTTGCCTCCCGTGAGCTTGGG - Intronic
1119776300 14:77250952-77250974 CCCTTTCCAGGCATGCGCTTTGG + Intronic
1121624046 14:95371740-95371762 GTCCTCCCACGAGTGAGCTTGGG - Intergenic
1121857495 14:97283528-97283550 GCTTATCCACGGGTGAGATTTGG - Intergenic
1124721278 15:32113023-32113045 GCCTTTCCATGCCTGGACTTTGG + Intronic
1128294187 15:66503916-66503938 GTCTTTCCACTGGTGAGCTTTGG - Intronic
1130918228 15:88322782-88322804 GCCCTCCCAGGCCTGAGCTTTGG - Intergenic
1138938253 16:61757700-61757722 GCCTTTCCAAGGGAGAGTTTGGG - Intronic
1143775838 17:9198231-9198253 GCCTGATCACGCGGGAGCTTGGG + Intronic
1152582668 17:81173503-81173525 GGCTTTCCAGCTGTGAGCTTGGG - Intergenic
1168327055 19:55543881-55543903 GCCTTTCCACGATTGTGTTTGGG + Intronic
947267866 2:228302745-228302767 GCCCTTCCCAGCTTGAGCTTAGG + Intergenic
947982527 2:234422577-234422599 GCCTTTGCAGGAGTGAGCTCAGG - Intergenic
1174272797 20:49381716-49381738 GCCTGTCCAGGCCTGAGCTGGGG - Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1176384695 21:6133527-6133549 GCCTTGCCACGCGTGACGTCTGG + Intergenic
1179738777 21:43404725-43404747 GCCTTGCCACGCGTGACGTCTGG - Intergenic
1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG + Intronic
954654432 3:52185440-52185462 GCCTATCCCAGGGTGAGCTTAGG + Intergenic
963441853 3:145350072-145350094 GACTTTCCATGTGTGAGATTAGG - Intergenic
983412889 4:167421310-167421332 GCCCTTCCCAGCTTGAGCTTAGG - Intergenic
989541532 5:42624262-42624284 GCATTTCCAGGCCAGAGCTTTGG + Intronic
998879633 5:146633015-146633037 CCCTTTCCACGCATGAGTATCGG - Intronic
1001754841 5:174160161-174160183 GCATTTCAGAGCGTGAGCTTTGG + Intronic
1014046809 6:116898216-116898238 GCCTTTCCAGTGGTGAGCTGGGG + Intronic
1021299835 7:18958910-18958932 CCATTTCCACGGGTAAGCTTGGG + Intronic
1022824532 7:33995529-33995551 GCCTTTCCATTTCTGAGCTTAGG - Intronic
1024031170 7:45461026-45461048 CCCTTTCCCAGCGTGAGCCTTGG + Intergenic
1038079922 8:24122641-24122663 GCCTTTCCCTGTGTGAGTTTGGG - Intergenic
1042156245 8:65847305-65847327 CCCTCTCCACTTGTGAGCTTGGG - Intergenic
1045286556 8:100796647-100796669 GCCTTTCCTCGAGGGAGCTTTGG + Intergenic
1060862051 9:126962482-126962504 GCCATGCCAGGCGTGAGATTTGG + Intronic
1062511390 9:136908104-136908126 GCCTTTGCACGCGGGACATTCGG - Exonic
1191699086 X:64020292-64020314 GCCATTTCACGGGTGTGCTTAGG + Intergenic
1194573895 X:95587438-95587460 ACCTTTCCAAGCGTCAGCTCAGG - Intergenic
1195137342 X:101922367-101922389 GCCTTTCTAAGAGTGAGCTCAGG - Intronic
1195928462 X:110049758-110049780 GCTTTTCCATGTGTAAGCTTGGG + Intronic