ID: 1106242082

View in Genome Browser
Species Human (GRCh38)
Location 13:27920512-27920534
Sequence GCCTTTCCACGCGTGAGCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106242082_1106242090 22 Left 1106242082 13:27920512-27920534 CCAAAGCTCACGCGTGGAAAGGC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1106242090 13:27920557-27920579 CCCCACCCCTTTCTCCTTTCCGG 0: 1
1: 0
2: 8
3: 47
4: 448
1106242082_1106242086 -3 Left 1106242082 13:27920512-27920534 CCAAAGCTCACGCGTGGAAAGGC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1106242086 13:27920532-27920554 GGCCAGTGGGCAGGTAAGCCTGG 0: 1
1: 0
2: 4
3: 17
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106242082 Original CRISPR GCCTTTCCACGCGTGAGCTT TGG (reversed) Exonic