ID: 1106242086

View in Genome Browser
Species Human (GRCh38)
Location 13:27920532-27920554
Sequence GGCCAGTGGGCAGGTAAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 307}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106242078_1106242086 14 Left 1106242078 13:27920495-27920517 CCCATGGATGAAGTCTACCAAAG 0: 1
1: 0
2: 1
3: 13
4: 95
Right 1106242086 13:27920532-27920554 GGCCAGTGGGCAGGTAAGCCTGG 0: 1
1: 0
2: 4
3: 17
4: 307
1106242077_1106242086 19 Left 1106242077 13:27920490-27920512 CCTTTCCCATGGATGAAGTCTAC 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1106242086 13:27920532-27920554 GGCCAGTGGGCAGGTAAGCCTGG 0: 1
1: 0
2: 4
3: 17
4: 307
1106242076_1106242086 26 Left 1106242076 13:27920483-27920505 CCAGCTGCCTTTCCCATGGATGA 0: 1
1: 0
2: 1
3: 20
4: 195
Right 1106242086 13:27920532-27920554 GGCCAGTGGGCAGGTAAGCCTGG 0: 1
1: 0
2: 4
3: 17
4: 307
1106242082_1106242086 -3 Left 1106242082 13:27920512-27920534 CCAAAGCTCACGCGTGGAAAGGC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1106242086 13:27920532-27920554 GGCCAGTGGGCAGGTAAGCCTGG 0: 1
1: 0
2: 4
3: 17
4: 307
1106242079_1106242086 13 Left 1106242079 13:27920496-27920518 CCATGGATGAAGTCTACCAAAGC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1106242086 13:27920532-27920554 GGCCAGTGGGCAGGTAAGCCTGG 0: 1
1: 0
2: 4
3: 17
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106242086 Original CRISPR GGCCAGTGGGCAGGTAAGCC TGG Exonic
900186920 1:1337008-1337030 GGACCTTGGGCCGGTAAGCCAGG - Intronic
900414353 1:2528238-2528260 GGCCAGCGGGCAGGTGTCCCCGG + Intergenic
900555308 1:3277361-3277383 GGCCAGGAGGCACGTCAGCCGGG + Intronic
900867245 1:5277211-5277233 GGCCCGTGGGCAGGGAATGCAGG + Intergenic
901459279 1:9382116-9382138 GGCCAGGGGGCAGGTTAGGATGG + Intergenic
902151037 1:14443550-14443572 GGAGAGTGGGCAGGAAGGCCAGG - Intergenic
902923334 1:19680233-19680255 GGCCAGGGGGCTGGATAGCCGGG - Intergenic
902935357 1:19761141-19761163 GGCCAGTGGCCAGGTTCACCTGG + Intronic
903740223 1:25554365-25554387 GGCCATTGGGCAGGTAGTCAAGG - Intronic
904842116 1:33379386-33379408 GGACAGTGGGCAGGGGAGACCGG - Intronic
904900609 1:33854423-33854445 AGGCAGTGAGCAGGTGAGCCAGG + Intronic
905199929 1:36308352-36308374 CGCCAGTGGGGAGGTGAGCCAGG - Intronic
905286447 1:36883572-36883594 GGCAAGTGGGCAGGAAATTCAGG + Intronic
905417883 1:37816879-37816901 GGCCAGTGGGCAGGAGAACAGGG + Intronic
906693409 1:47808224-47808246 GGCCAGCGGGCTGGAAATCCAGG - Intronic
908251364 1:62268533-62268555 GGGCACTGGGCAGGAAAGACAGG - Intronic
912384770 1:109265828-109265850 GGCCAGTGTCCATGCAAGCCAGG + Exonic
913241734 1:116835742-116835764 GGCCAGTGGGCAGGGTATTCAGG + Intergenic
913983833 1:143547413-143547435 GGCCAGTGGGCCTGAAAGGCAGG - Intergenic
914460469 1:147878676-147878698 GGACAGTGGGCAGGAAGGTCAGG - Intergenic
914937677 1:151994370-151994392 GGCCGGTGGGGCGGGAAGCCCGG - Exonic
916715455 1:167443354-167443376 GGCCAGAGGGCAGGCACACCTGG - Intronic
918263432 1:182817963-182817985 GGCCTCTGGGGAGGAAAGCCGGG - Intronic
919929345 1:202211091-202211113 GGCCAATGGCCAGTTAACCCTGG + Intronic
920530466 1:206698198-206698220 GGCCAGTCAGCAGGGAAGACAGG - Intronic
921101240 1:211931204-211931226 GGCCAGCAGGCAGATCAGCCAGG + Intergenic
921265258 1:213416532-213416554 GGGCACTGGGGTGGTAAGCCGGG + Intergenic
1064030867 10:11881802-11881824 GGGCAGTGGTCAGGGAAGGCTGG + Intergenic
1064370562 10:14748923-14748945 GGCCAGTGGGCGCTTAAGCAAGG - Intronic
1065210295 10:23396274-23396296 GGCCATTTGGCAGGGAAGTCAGG - Intergenic
1067946819 10:50694825-50694847 TCCCAGTGGGCAGGTAAGTAGGG - Intergenic
1068522388 10:58092315-58092337 GGCCAGTAGGCAGGAGACCCAGG + Intergenic
1069257950 10:66358236-66358258 GGCCAGAGGACAGATAAGCAGGG - Intronic
1069879890 10:71585406-71585428 TGCCAGAGGGCAGGTAAGAAAGG - Intronic
1069885280 10:71619725-71619747 GTGCAGTGGGGAGGTAGGCCGGG + Intronic
1069909475 10:71750724-71750746 GGCCAGTGGGCAGGCAGGCCTGG + Exonic
1070783403 10:79150068-79150090 GGCCAGTGGGACAGGAAGCCAGG + Intronic
1070882125 10:79859818-79859840 TCCCAGTGGGCAGGTAAGTAGGG - Intergenic
1071301214 10:84257373-84257395 GGCCTGAGGGCAGCTCAGCCTGG + Intronic
1071648701 10:87376129-87376151 TCCCAGTGGGCAGGTAAGTAGGG - Intergenic
1072306593 10:94113752-94113774 TGGCAGTGGGCAGGGAAGCTTGG + Intronic
1072727537 10:97823846-97823868 GGCCACTGGGCAGAGAAGGCAGG + Intergenic
1073206042 10:101769955-101769977 GGCCAGTTGGCTGGGCAGCCAGG - Intergenic
1073283369 10:102370879-102370901 GGAGAGTGGGCAGGTATGCAAGG + Intronic
1074954256 10:118372290-118372312 GGTGAGTGGGCAGGTAGACCAGG - Intergenic
1075483257 10:122800067-122800089 GGCCTGGGGGCAGGAGAGCCTGG + Intergenic
1075483350 10:122800290-122800312 GGCCTGGGGGCAGGAGAGCCTGG + Intergenic
1075483377 10:122800354-122800376 GGCCTGGGGGCAGGAAGGCCTGG + Intergenic
1075589029 10:123678246-123678268 GGCCTGTGGTCAGGGAAGTCAGG + Intronic
1075724007 10:124602639-124602661 AGCCAGAGGACAGGTCAGCCGGG + Intronic
1075872909 10:125783574-125783596 GGGCTGTGGGCAGTCAAGCCAGG + Intergenic
1076417253 10:130300760-130300782 GGACAGCGGGCAGCTCAGCCTGG - Intergenic
1076570152 10:131427069-131427091 GGGCAATGGCCAGGTAACCCCGG - Intergenic
1077195218 11:1276450-1276472 GGACAGTGGCCAGGTGAGCCAGG + Exonic
1077456532 11:2684772-2684794 GACCAGTGGGGAGGGAAGGCTGG - Intronic
1077523247 11:3048812-3048834 GGCCAGGGGCCAGGTGAGGCTGG - Intronic
1077674541 11:4184620-4184642 GGCCAGTGGCCAGCAGAGCCAGG - Intergenic
1078062269 11:8055847-8055869 GGCTAGTGGGAAGGTGAGCAGGG - Intronic
1080824129 11:35833581-35833603 GGTCAGTGGGCAGGTTGGCTGGG - Intergenic
1083710664 11:64546395-64546417 GGCCGGTTTGCAGGTCAGCCTGG + Intergenic
1084090963 11:66879175-66879197 GGCCTGTGGGGAGGTCAGCATGG - Intronic
1084235681 11:67786559-67786581 GGCCACTGGGCGGGGAAGCCTGG + Intergenic
1085618077 11:78017072-78017094 GCCCAGTGCGCAGGTAGTCCAGG + Exonic
1087381596 11:97409999-97410021 GGTTAGTGGGTGGGTAAGCCTGG - Intergenic
1087671875 11:101116380-101116402 GGCCAGTGTGGAGGAAAGTCAGG + Intronic
1088360395 11:108983129-108983151 GGTCACTGTGCAGGTAAGGCAGG + Intergenic
1089115324 11:116090196-116090218 GGGCAGTGGGCAGGGGACCCAGG - Intergenic
1089633474 11:119797554-119797576 GGGCAGTGCTCAGGTCAGCCTGG - Intergenic
1089736008 11:120550633-120550655 GGCCAGGGAGGAGGCAAGCCAGG + Intronic
1090024930 11:123159431-123159453 CTCCTGTGGGCAGGCAAGCCTGG + Intronic
1090375151 11:126283141-126283163 GGCCCGCGCGCAGGTGAGCCCGG + Exonic
1091396152 12:155317-155339 GGACAGTGGGCAGGTGAGGGTGG - Intronic
1093524980 12:20095034-20095056 GGTCAGTGGGCAGGTGGGCCTGG + Intergenic
1093899403 12:24612802-24612824 GGTCAATGGGCAGGTGGGCCTGG - Intergenic
1096676261 12:53227654-53227676 GCCCAGTGGGCAGGCCAGGCAGG - Exonic
1096806786 12:54145753-54145775 GGGCATGGGGCAGGTCAGCCTGG + Intergenic
1096997441 12:55847660-55847682 AGGCAGTGGGCAGGGAAGCTGGG + Intergenic
1097173440 12:57129507-57129529 GGGCAGAGGGCAGGCAGGCCCGG + Intronic
1099956793 12:89358960-89358982 GGCCAGAAAGTAGGTAAGCCAGG - Intergenic
1100388061 12:94121857-94121879 GGCCAGTGTGTAGGAAAGTCAGG - Intergenic
1102483636 12:113241391-113241413 GGCCAGTGTTCATGGAAGCCGGG + Intronic
1102508319 12:113397835-113397857 GGGGAGTGGGGAAGTAAGCCAGG - Intronic
1102870222 12:116408402-116408424 AGCCAGTGGGATGGCAAGCCAGG - Intergenic
1103229776 12:119319757-119319779 AGCCAGGGGGCATGTGAGCCTGG - Intergenic
1103434622 12:120915218-120915240 GGCCAGTGGACAGGGAATCCTGG + Intergenic
1105440427 13:20410856-20410878 AGCCAGTAGGCTGGAAAGCCAGG + Intronic
1105546158 13:21352462-21352484 AGCCAATGGGCAGGGAAGCAGGG + Intergenic
1106242086 13:27920532-27920554 GGCCAGTGGGCAGGTAAGCCTGG + Exonic
1107409073 13:40141722-40141744 GGCCAGTGCCCAGGGAAGCTTGG + Intergenic
1110190965 13:72728075-72728097 GGCGAGCGGGCAGGCAAGTCAGG - Intronic
1113545482 13:111145739-111145761 AGCCAGAGAGCAGGGAAGCCTGG + Intronic
1114499027 14:23154403-23154425 AGCCGCTGGGCAGGGAAGCCGGG + Intronic
1115348293 14:32365942-32365964 GACCAGTGGGCAAGGAACCCAGG - Intronic
1118925482 14:70187533-70187555 GTCCTCTGGGCAGGTCAGCCAGG + Intronic
1121657905 14:95611539-95611561 GGCCATTGGGCAGGTCACCTGGG + Intergenic
1122274009 14:100581891-100581913 GCCGAGTGGGCAGGCATGCCGGG + Intronic
1124028368 15:25987677-25987699 GGTCACTGGGCAGGTGAGCAGGG + Intergenic
1124215711 15:27805874-27805896 GGCCACAGGGCAGGGGAGCCTGG + Intronic
1125353453 15:38791563-38791585 AGCCACTGGGCAGGGGAGCCTGG - Intergenic
1125796981 15:42410331-42410353 GGGCAGTGGGTAGGACAGCCCGG + Intronic
1125833834 15:42734195-42734217 GGCTAGTGGGCAACTAAGCTGGG + Intronic
1129454601 15:75670040-75670062 GGCCTGGGGTCAGGTCAGCCTGG + Intergenic
1129889946 15:79065400-79065422 TGCCAGTGGGCAGGTGGGCAGGG + Intronic
1130228251 15:82076488-82076510 GGCCAGTGGGCAGGGACTTCTGG - Intergenic
1131815527 15:96217495-96217517 GGCCAGTGGGAAGGTGAGAGTGG - Intergenic
1132326612 15:100975232-100975254 GGCCACTTGGCAGGGATGCCAGG - Intronic
1133161924 16:3917582-3917604 GGCCAGGGGAAAGGCAAGCCTGG - Intergenic
1134084701 16:11348462-11348484 GGCCAGTGGGTATGTCAGACAGG - Intronic
1134825673 16:17282266-17282288 GGCCAGGGGGTAGGGAAGTCGGG - Intronic
1135571407 16:23552139-23552161 CTGGAGTGGGCAGGTAAGCCTGG - Exonic
1135764272 16:25164006-25164028 GGACAGTGGGCAGGCCAGCTAGG + Intronic
1136557355 16:31015379-31015401 GGGCAGTGAGCAGCTGAGCCTGG - Intergenic
1137754327 16:50889443-50889465 GCCCAGTGGGCCGGTAAGGCTGG + Intergenic
1141571874 16:84939075-84939097 GCCCAGTGGGCAGCAATGCCTGG + Intergenic
1141615342 16:85206822-85206844 GGGCGGTGGGCAGGGAAGCTGGG - Intergenic
1141819401 16:86434707-86434729 GGCCAGTGGTCAGGGACTCCTGG - Intergenic
1142344428 16:89544993-89545015 AGCCATTGGGCAGGTCTGCCAGG - Intronic
1143983266 17:10889197-10889219 GGGAAGTGGGCTGGTAAGCCTGG + Intergenic
1147324559 17:39663999-39664021 GGCAAGGGGGCAGGCCAGCCGGG - Intergenic
1147744510 17:42687046-42687068 GGCCAGTGGGCAGGGGGGTCTGG + Exonic
1147969351 17:44211249-44211271 GGGCAGTGGGCAGAGAAGACTGG - Intronic
1148130952 17:45262331-45262353 AGGCAGGCGGCAGGTAAGCCTGG + Intergenic
1148737129 17:49871191-49871213 GGCCACAGGGCAGGGAAGGCAGG - Intergenic
1148750370 17:49942047-49942069 GGGCACTGGGCAGGCAAGTCTGG + Intergenic
1148813764 17:50312301-50312323 GACCAGGGGACAGGTCAGCCTGG - Intergenic
1148857443 17:50586458-50586480 GGCCAGTGGGGAGGACAGCCTGG - Intronic
1149990836 17:61382809-61382831 CTCCAGTGGGAAGGGAAGCCGGG + Intronic
1150139707 17:62717519-62717541 AGCCAGAGGGCAAGGAAGCCCGG - Intronic
1150471155 17:65438662-65438684 GGGCAGTGGGCAGTGAGGCCAGG - Intergenic
1150500137 17:65643043-65643065 GGCCAGTGGGCAGGGAATCCTGG - Intronic
1150654993 17:67033540-67033562 GCCCAGGGGGCAGGGAGGCCAGG + Intergenic
1150712258 17:67541839-67541861 GACCAGTGGGTAGGAATGCCAGG + Intronic
1150809228 17:68343646-68343668 GGCCGGTGAGCAAGGAAGCCCGG - Exonic
1150942380 17:69706906-69706928 GGACAGTGGGGAGGTGAGACAGG + Intergenic
1151628761 17:75295480-75295502 GGCCAATCAGCAGATAAGCCAGG + Intergenic
1152239818 17:79155389-79155411 AGCCAGTGGGCAGGGAGGTCCGG + Intronic
1152421112 17:80193692-80193714 GGCCAGGGGGCAGGTGAGCCTGG - Intronic
1152549916 17:81024091-81024113 GGCCAGGGGGCTGGGATGCCAGG + Intergenic
1153799539 18:8657312-8657334 GGCCAGTCGGCAGGTGCTCCTGG - Intergenic
1154338120 18:13482070-13482092 GGACAGTGGGGAGGCAAGCAGGG + Intronic
1155546795 18:26924115-26924137 GGGCAGTGGGGAGGTGTGCCTGG + Intronic
1159384601 18:67707373-67707395 GGCCAGTGGACAACTCAGCCTGG - Intergenic
1160620966 18:80170371-80170393 GGATCGTGGCCAGGTAAGCCTGG - Exonic
1160820700 19:1056398-1056420 GGCCTGGGGGCAGGTGAGCACGG - Exonic
1161270178 19:3385281-3385303 AGCCAGTGGGCAGCTGAGCTGGG - Intronic
1161289543 19:3485733-3485755 AGCCAGGGGCCAGGGAAGCCAGG + Intergenic
1161725949 19:5929064-5929086 GTCCAGCGGGCAGGGAAGCCTGG + Intronic
1162721059 19:12663307-12663329 GGCCACTGCCCAGGTAACCCTGG - Exonic
1163360470 19:16842865-16842887 AACCAGTAGGCAGGTTAGCCTGG + Intronic
1164308919 19:24029622-24029644 GGCCTGAGGGCAGGAAGGCCAGG + Intergenic
1164669214 19:30063338-30063360 CGCCTGTGGGCAGGTGAGGCTGG - Intergenic
1164941332 19:32253872-32253894 AGTCAGTGGGCAGGTAACGCAGG - Intergenic
1165538764 19:36472901-36472923 GGCCAGTGGCCAGGTAAGTGAGG - Exonic
1166104418 19:40590334-40590356 GGCCAGTGAGCAGGTAGCGCCGG - Exonic
1166155377 19:40907892-40907914 GGCAAGTGTGCAGTGAAGCCAGG + Intergenic
1166336916 19:42113868-42113890 GAGCAGTGGGTAGGTAAGTCAGG + Intronic
1167647285 19:50712560-50712582 AGCCAGGGGACAGGTAAGCTTGG + Intronic
1168428208 19:56256734-56256756 GACCAGTGGGCAGGTCACCCAGG + Intronic
924981648 2:228191-228213 TGCCGGTGGACAGGTTAGCCTGG - Intronic
925595136 2:5548104-5548126 TCCCAGTGGGCAGGCAAGCCTGG + Intergenic
925752751 2:7104577-7104599 ACCCAGTGGGCAGGGAAGCAAGG + Intergenic
926249589 2:11146762-11146784 GGTCAGTGGCCAGGACAGCCAGG + Intronic
927132004 2:20068445-20068467 GGCCAGTGGGCTGGAAATGCAGG + Intergenic
927522473 2:23707687-23707709 GGCCAGTGGGAAGGGAAGGAGGG + Exonic
927717416 2:25361592-25361614 GGCCACTGAGCAGGGGAGCCAGG + Intergenic
931456738 2:62415417-62415439 GGCCTGTGTGCAGGTAAGGAAGG + Intergenic
932081614 2:68720824-68720846 GGCCACTGGGCAGGCAAGGAGGG + Intronic
932763732 2:74457534-74457556 GACCAGTGGGCGGGGAGGCCGGG + Exonic
933990947 2:87633420-87633442 GGCCGGTGAGCAGCTGAGCCAGG + Intergenic
934650615 2:96089471-96089493 TGCCAGTGCCCAGGTAAGTCTGG - Intergenic
935575194 2:104701863-104701885 GGCCAGAGAGCAGGCCAGCCTGG - Intergenic
935738058 2:106122076-106122098 GCCCAGTCTGCAGGTGAGCCTGG - Intronic
936302893 2:111317403-111317425 GGCCGGTGAGCAGCTGAGCCAGG - Intergenic
938731299 2:134150030-134150052 AGCCAGCAGGCAGGGAAGCCAGG + Intronic
938972979 2:136449098-136449120 GGCAAGTGGGCAGCTAGGCATGG + Intergenic
940322628 2:152392821-152392843 AGCCAGAGGGCAAGGAAGCCTGG - Intronic
945306842 2:208266624-208266646 GGCGAGTGGGGACGGAAGCCGGG + Intronic
946009700 2:216554796-216554818 GGCCAGTGTGCAGCTCTGCCAGG - Intronic
946165952 2:217863938-217863960 GCCCAGTGGACAGGGAAGACAGG + Intronic
946192772 2:218016167-218016189 GGCCAGTGGGCTGGTTTCCCAGG - Intergenic
946382087 2:219355619-219355641 GGCCAGTTGGAAGAGAAGCCAGG + Intergenic
948106429 2:235417803-235417825 AGCCAGCAGGCAGGAAAGCCGGG - Intergenic
948493046 2:238326268-238326290 AGCCAGAGGGCATGGAAGCCTGG - Intronic
948669695 2:239559887-239559909 GGACAGTGGCCTGGTCAGCCAGG + Intergenic
948794403 2:240394814-240394836 GGGCACTGGCCAGGTAACCCAGG + Intergenic
1169221150 20:3823844-3823866 GGAGAGTGGGCAGGTCAGGCTGG - Intronic
1171103371 20:22407808-22407830 GGCAGGTGAGCAGGTAAGCTGGG + Intergenic
1171795364 20:29561930-29561952 GCCCAGATGGCAGGCAAGCCTGG - Intergenic
1171853088 20:30322335-30322357 GCCCAGATGGCAGGCAAGCCTGG + Intergenic
1173398116 20:42700059-42700081 GGCCACTGGGCAGTGAATCCAGG + Intronic
1173617904 20:44414694-44414716 GGGCAGTGGGCGGGGCAGCCAGG + Intronic
1173728526 20:45313149-45313171 GGCCTGTGGGCACATTAGCCAGG + Intronic
1174485651 20:50859571-50859593 GGCCAGTGGGAGGCTCAGCCTGG + Intronic
1175388190 20:58610593-58610615 GGCCAGTGGGCTGATGAGCAGGG - Intergenic
1175700440 20:61132987-61133009 GCCCAGTGTGCTGGGAAGCCAGG + Intergenic
1175781219 20:61683471-61683493 GGCCCGTGGGCAGGTGCCCCGGG + Intronic
1176037291 20:63045819-63045841 GGCTAGGGAGCAGGTGAGCCAGG - Intergenic
1176189911 20:63803606-63803628 GGCCAGTGGGCAGGGAGGGGCGG - Intronic
1178582139 21:33846246-33846268 GGCAGGTGGGCAGGAAAGGCAGG - Intronic
1178874464 21:36402961-36402983 TTCCAATGGGCAGGTAAGTCGGG - Intronic
1180600522 22:17012424-17012446 GGCCAGCGTGCAGCTGAGCCAGG + Intergenic
1180605736 22:17057698-17057720 GGCCACTGGCCAGGTCAGCTTGG - Intergenic
1181178067 22:21048906-21048928 GGCCAGTGGGATGCAAAGCCAGG - Intronic
1182469850 22:30542054-30542076 GGCCGGTGGGCGGGGACGCCCGG + Intronic
1183423773 22:37726491-37726513 GGCAAGAGCGCAGGTGAGCCCGG + Exonic
1183464953 22:37974990-37975012 TGCCAGTGGGCTGGGAAGCAGGG - Intronic
1183508498 22:38222079-38222101 GGCCAGAGGGCCTGGAAGCCAGG + Intronic
1183541435 22:38431419-38431441 GGCCAGTGGGCTGGTGGGCCTGG - Intronic
1183707783 22:39485225-39485247 GGCAGGTGGGCAGGCGAGCCAGG - Intronic
1184142261 22:42584808-42584830 GGACAGTGGTCAGGGATGCCTGG - Exonic
1184391824 22:44207359-44207381 GGCTAGTGGGCGGGTGAGGCTGG + Exonic
1184481831 22:44752615-44752637 GGTCCGTGGCCAGGTAAGGCGGG + Exonic
1185241991 22:49751684-49751706 GCCGAGTGGGCAGGTGACCCTGG + Intergenic
949281134 3:2348451-2348473 GGCCTGAGGGCTGGTGAGCCAGG - Intronic
950134671 3:10572168-10572190 GGCCAGCGGGCAGCTGATCCAGG - Intronic
951049283 3:18076491-18076513 CTCCAGTAGGCAGGTGAGCCAGG - Intronic
951057550 3:18164917-18164939 TGCCAGTAGGCAGGTAATACAGG - Intronic
952788053 3:37175921-37175943 GGCCAGTCCCCAGGGAAGCCCGG + Intronic
953183143 3:40615265-40615287 GGCCAGTGGGAAAGGAGGCCAGG - Intergenic
954201501 3:49025949-49025971 GGGCAGTGGGCAGCTGGGCCGGG + Intronic
954443015 3:50531929-50531951 AACCAGTGGGCAGGGAGGCCAGG - Intergenic
955222031 3:57030964-57030986 GGCCTGTGGGCAGGGATTCCAGG + Intronic
955924826 3:63994656-63994678 GGGTAGTGGCCAGGTCAGCCAGG + Intronic
956026442 3:64987680-64987702 AGGCAGTGGGCATTTAAGCCTGG + Intergenic
961752768 3:129107031-129107053 GGCCAGAGGCCATGAAAGCCAGG + Intronic
963204092 3:142614930-142614952 GGGCAGTGGTGAGGCAAGCCTGG + Intronic
967448083 3:189590473-189590495 GGTCAGTTGGCAGGCAAACCTGG - Intergenic
968585927 4:1416091-1416113 AGCCAGTGGGCACGTCAGGCAGG + Intergenic
968890740 4:3367206-3367228 GGCAAGTGGGCATGTGAGCCTGG - Intronic
973637451 4:52873335-52873357 GCCCACTGGGCAGGTCTGCCAGG - Exonic
973788574 4:54357885-54357907 GGCCAGGTGGCAGGTGTGCCTGG + Intergenic
973874531 4:55203581-55203603 GGCCAGTGGGCTGGAGACCCAGG + Intergenic
974471910 4:62329740-62329762 GGACAGTGGGCAATGAAGCCAGG - Intergenic
975725756 4:77290362-77290384 TGTTAGTGAGCAGGTAAGCCTGG + Intronic
977465383 4:97378038-97378060 AGCCAGAGGGCTGGGAAGCCAGG + Intronic
977713998 4:100160289-100160311 AGCCTGTGGACAGGTAAGGCTGG - Intergenic
979693101 4:123581445-123581467 GGCAAGTGGCCAGCTAAGTCTGG + Intergenic
981290166 4:143065790-143065812 GGCCTGTTGGCAGGTACGGCAGG - Intergenic
986052972 5:4107582-4107604 GGCCAGTGGTCAGTTATTCCAGG + Intergenic
991647794 5:68818708-68818730 GGCCAGGGGGCAAGTGATCCAGG + Intergenic
992156408 5:73959214-73959236 GGCCAGAGGGCAGCAAAGACAGG + Intergenic
993509488 5:88754103-88754125 AGCCAGAGGGCAGGAGAGCCTGG - Intronic
994237189 5:97376430-97376452 GGGCAGTGGGAAAATAAGCCTGG + Intergenic
997716788 5:136048572-136048594 GTCAAGTGGGCAGGTAAATCGGG + Intronic
997741269 5:136257024-136257046 GGCCTGTGAGCAAGTCAGCCAGG - Intronic
998153079 5:139768307-139768329 GGCCAGTGGGCTGGTCACCCTGG + Intergenic
999091706 5:148941835-148941857 AGCCAGTGGGCAAGGAATCCTGG - Intronic
999242850 5:150137568-150137590 GGGCTGTGGGAAGGGAAGCCGGG + Intronic
999303745 5:150506962-150506984 GGCCAGTGAGGACGGAAGCCAGG - Intronic
1000718387 5:164676130-164676152 TGCCAGTGGGTGGGTATGCCAGG + Intergenic
1001564341 5:172689856-172689878 GGGCAGTGAGCAGATGAGCCTGG - Exonic
1001924015 5:175623035-175623057 GGGCAGTGGCCAGGTGAGACAGG - Intergenic
1003405469 6:5823976-5823998 AGCCAATGGGCAGGGAAGCAGGG - Intergenic
1006108580 6:31730728-31730750 GGCCAGTGGGCAGGGAATCCTGG - Exonic
1007216907 6:40247597-40247619 GGCCACTGCGCAGAGAAGCCAGG - Intergenic
1007357814 6:41333757-41333779 GACCTGGGGGCAGGGAAGCCTGG - Intergenic
1007750347 6:44067348-44067370 GGGGAGTGGGCAGACAAGCCTGG + Intergenic
1008547235 6:52593947-52593969 GGCCAGTGGTCTAGTATGCCTGG - Intergenic
1011520011 6:88194716-88194738 GGGCAGTGGGCAAGTGAGACTGG - Intergenic
1013195683 6:107843601-107843623 GGCCAGTGGGCAGAGCAGGCAGG - Intergenic
1013441765 6:110179110-110179132 CGCGGGTGGGCAGGGAAGCCCGG + Intronic
1018376421 6:163217606-163217628 GAGCAGTGGGCAGGTGAGCAAGG + Intronic
1018702284 6:166436670-166436692 GGCCAGGAGGCAAGGAAGCCAGG - Intronic
1019161224 6:170068110-170068132 AGCCAGTGGGCAGACAAGACAGG - Intergenic
1019433468 7:1010368-1010390 GGCCTCTGGGCAGTTAATCCTGG - Intronic
1019494347 7:1330728-1330750 GGCCAGTGGTCAGACAAGCAGGG - Intergenic
1022845903 7:34209552-34209574 GGCCAGTGAGCAGCTGAGACTGG + Intergenic
1022949264 7:35320116-35320138 GACCAGTGGGCAGGTGCTCCAGG - Intergenic
1023273984 7:38498227-38498249 GGGCAGTGGGCAGGGAAGGAAGG - Intronic
1024729504 7:52238799-52238821 GGACAGAGGGCAGATAAGACAGG - Intergenic
1026228562 7:68463548-68463570 GCTCAGTGGGCAGGTAATGCTGG + Intergenic
1027126962 7:75563334-75563356 GGGGAGGGGGCAGGAAAGCCAGG - Intronic
1028800273 7:94955967-94955989 GGCAAGTAGGCAGGCAAACCTGG - Intronic
1030293161 7:107891702-107891724 ATGCAGTGGGCAGGTAACCCTGG + Intronic
1030366412 7:108652216-108652238 GGCCAGTGTGCATGTATGTCAGG + Intergenic
1030756728 7:113294969-113294991 GGCCTGAGGGCAGGTCTGCCTGG + Intergenic
1031485491 7:122318201-122318223 GGCCAATGGGCAGGTTAAACAGG + Intergenic
1032314974 7:130829266-130829288 GACCAGTGGGTGGGTGAGCCTGG + Intergenic
1032872595 7:136002227-136002249 GGCCACTGCCCAGGTCAGCCTGG - Intergenic
1034474685 7:151275609-151275631 GGCCAGAGGGCAGGTCAGGATGG + Intronic
1035222364 7:157413832-157413854 GGCCACTGGGGAGGTGAGGCAGG - Intronic
1035240652 7:157527058-157527080 GGCCAGTGCTCAGGGGAGCCGGG - Intergenic
1035413979 7:158667924-158667946 GGCCAGAGGGTAGGTAAGGAGGG - Intronic
1035414048 7:158668126-158668148 GGCCAGAGGGTAGGTAAGGAGGG - Intronic
1035717315 8:1764019-1764041 GGCGAGGGGGCTGGGAAGCCCGG + Intronic
1037522449 8:19693135-19693157 AGCCAGTTGGCAAATAAGCCTGG - Intronic
1038468693 8:27791616-27791638 GACCAGTGGGCAGGTAGGGGAGG - Intronic
1041391356 8:57349993-57350015 GGACAGATGGCAGGTCAGCCAGG + Intergenic
1042102975 8:65294307-65294329 TGCCAGTGGTCAGATAAGCCGGG - Intergenic
1042216881 8:66436626-66436648 GCCAAGTGGGCAGGTGAACCTGG + Intronic
1042484943 8:69338462-69338484 TGAGAGTGGGCAGGTAAGCCTGG - Intergenic
1044129691 8:88506050-88506072 GGCCATTGAGCAGGCAGGCCTGG - Intergenic
1044870444 8:96614693-96614715 GGCCAGTTGGCAAGGAAGCTTGG - Intergenic
1046236934 8:111436468-111436490 GGCCAGGGGCCAAGTAATCCAGG - Intergenic
1047202465 8:122779297-122779319 GGCCAGGTGGGAGGGAAGCCAGG - Intergenic
1047498818 8:125427295-125427317 AGCCAATGGGCAAGTGAGCCTGG + Intergenic
1048315372 8:133357964-133357986 GGGCGCTGGGCAGGTATGCCAGG - Intergenic
1048974974 8:139666200-139666222 GGCCAGTGCACTGGAAAGCCAGG - Intronic
1049213986 8:141399354-141399376 GGCCAGAGGGAAGCAAAGCCCGG - Intronic
1049219476 8:141422396-141422418 GGCCTGAGGGCAGCTCAGCCGGG - Intronic
1049386331 8:142344805-142344827 GGCCTGAGGGCAGGAAACCCTGG - Intronic
1049408850 8:142463617-142463639 AGCGAGTGGGCAGGCAGGCCAGG + Intronic
1049410256 8:142470826-142470848 GGTCACTGGGCAGGTGGGCCTGG - Intronic
1049447880 8:142639843-142639865 GTGCAGTGGGCTGGTGAGCCTGG - Intergenic
1049687749 8:143945750-143945772 GGCCACTGGGCAGGCCACCCAGG + Intronic
1049690688 8:143957652-143957674 GGCCTGTGGCCAGGGCAGCCAGG - Intronic
1053503655 9:38621831-38621853 GGACAGCGGGCTGGGAAGCCAGG + Intergenic
1053544644 9:39009918-39009940 GGTCAGTGGGCATGTGGGCCTGG - Intergenic
1053790886 9:41685634-41685656 GCCCAGATGGCAGGCAAGCCTGG + Intergenic
1053809081 9:41833400-41833422 GGTCAGTGGGCATGTGGGCCTGG - Intergenic
1054154268 9:61629138-61629160 GCCCAGATGGCAGGCAAGCCTGG - Intergenic
1054179233 9:61897328-61897350 GCCCAGATGGCAGGCAAGCCTGG + Intergenic
1054474053 9:65560258-65560280 GCCCAGATGGCAGGCAAGCCTGG - Intergenic
1054621511 9:67354028-67354050 GGTCAGTGGGCATGTGGGCCTGG + Intergenic
1054658305 9:67683493-67683515 GCCCAGATGGCAGGCAAGCCTGG - Intergenic
1056925925 9:90834496-90834518 GGCCAGAGAGCAGGAAACCCAGG - Intronic
1056929412 9:90861892-90861914 GGGCAGTGGTCAGGAGAGCCTGG - Intronic
1057010930 9:91600669-91600691 GCCCAGAGAGAAGGTAAGCCAGG - Intronic
1057421633 9:94917641-94917663 GGGCAGTGGGCAGCTACGTCAGG - Intronic
1057752236 9:97802476-97802498 GGCCAGTGGGCCTGTCAGCAAGG - Intergenic
1059535298 9:115075121-115075143 TGCCTGTGGGGAGGTAAGCTGGG + Intronic
1060447153 9:123700463-123700485 GGCCAGTGGGCTGGAAACTCAGG + Intronic
1061020541 9:128011455-128011477 GGGCAGTGGGCAAGTGGGCCTGG - Intergenic
1061277683 9:129578866-129578888 GGCCACTGGGCTGGTGACCCTGG + Intergenic
1061868309 9:133506651-133506673 GGCCGGTGTGCAGGTCAGCGGGG + Intergenic
1062466780 9:136685114-136685136 GGCCAGAGGGCAGGGCAGTCTGG - Intronic
1185835546 X:3343677-3343699 TGCCAGCGGGCACGGAAGCCAGG + Exonic
1187194842 X:17072912-17072934 TGCCAGAGTGCAGGAAAGCCTGG - Intronic
1201062353 Y:10058893-10058915 GGCCTGTGGGAAGCTAGGCCTGG + Intergenic