ID: 1106242090

View in Genome Browser
Species Human (GRCh38)
Location 13:27920557-27920579
Sequence CCCCACCCCTTTCTCCTTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 8, 3: 47, 4: 448}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106242087_1106242090 0 Left 1106242087 13:27920534-27920556 CCAGTGGGCAGGTAAGCCTGGCT 0: 1
1: 0
2: 2
3: 22
4: 192
Right 1106242090 13:27920557-27920579 CCCCACCCCTTTCTCCTTTCCGG 0: 1
1: 0
2: 8
3: 47
4: 448
1106242082_1106242090 22 Left 1106242082 13:27920512-27920534 CCAAAGCTCACGCGTGGAAAGGC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1106242090 13:27920557-27920579 CCCCACCCCTTTCTCCTTTCCGG 0: 1
1: 0
2: 8
3: 47
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106242090 Original CRISPR CCCCACCCCTTTCTCCTTTC CGG Intronic
900086799 1:902452-902474 ACGCACCCCTCTCTCCTGTCTGG - Intergenic
900350638 1:2232921-2232943 CCACCCCTCTTTCTTCTTTCCGG + Intronic
900552606 1:3264327-3264349 CCCCTCCCCTGCCTCCCTTCTGG - Intronic
900685892 1:3947448-3947470 CCCCACTCCCTTCCCCTTCCCGG + Intergenic
900816449 1:4850626-4850648 CCCACCTCCTTTCTCATTTCAGG + Intergenic
901829116 1:11881367-11881389 CCCCACCCCATTCTACTCTATGG + Intergenic
901963077 1:12842818-12842840 CCACACCCATGTCTCCATTCGGG + Intergenic
901985159 1:13069652-13069674 CCACACCCATGTCTCCATTCAGG - Intronic
901996650 1:13157118-13157140 CCACACCCATGTCTCCATTCAGG + Intergenic
901998247 1:13171279-13171301 CCACACCCATGTCTCCATTCGGG - Intergenic
902029665 1:13412766-13412788 CCGCACCCATGTCTCCATTCGGG - Intronic
902660213 1:17895719-17895741 CACCATCCCCTTCTCCTTTGGGG - Intergenic
902776217 1:18676553-18676575 CCCCACCCCCTTCTCCTAAGAGG + Intronic
902960668 1:19960970-19960992 CCCCACCCCGTTCTCTGTACAGG + Intergenic
903420034 1:23212295-23212317 CCCCACCCCTGTCTCCTTGCTGG + Intergenic
903510110 1:23868366-23868388 TCCCACCCCTTTTTCCTTCCGGG - Intergenic
903875641 1:26471729-26471751 CCCCACCCCCAACTCCTCTCGGG - Intergenic
904002924 1:27349058-27349080 CTCTACCCCTTTCTTCCTTCAGG + Exonic
904038563 1:27571564-27571586 CCCCACCCCCTGCTCCCCTCAGG + Intronic
904169005 1:28578100-28578122 CCCCACCACATTCTACCTTCTGG - Exonic
904837932 1:33350714-33350736 CCCCACCCCTTTCCACTCTCAGG + Intronic
905091431 1:35434028-35434050 CCCCACTCCCTTCTCCCATCCGG - Exonic
905720613 1:40197481-40197503 CCCCACCCTTTTTTCCTCTTGGG - Intronic
906040630 1:42785510-42785532 CCCCACCCCCGTCTCCTGGCCGG + Intronic
906784720 1:48604780-48604802 CCTCACTCCTTGCTGCTTTCTGG - Intronic
907145070 1:52224104-52224126 CCCCAACCCTTTTTCCCTTAAGG - Intronic
907303728 1:53502800-53502822 CCCCTCCCCTCTCTCCTCTCTGG - Intergenic
908510599 1:64847485-64847507 CCCCTCCCCTCTCCCGTTTCTGG - Intronic
910338246 1:86156791-86156813 CCCCACCCCTTTCTCCTCCCAGG - Intronic
910618867 1:89230721-89230743 CCCTAACCCCTTGTCCTTTCTGG + Intergenic
911882232 1:103254560-103254582 CCCCCCACCTCTCTCCTGTCAGG - Intergenic
912150448 1:106853131-106853153 CCCCAACCCTTTGTGCTTCCTGG - Intergenic
912413925 1:109495420-109495442 CTCTCCCCCCTTCTCCTTTCCGG - Intronic
912646138 1:111393942-111393964 CCCCAACCCCTTGTGCTTTCCGG - Intergenic
913391393 1:118316871-118316893 CCATACTTCTTTCTCCTTTCTGG + Intergenic
914965143 1:152250121-152250143 CCCCACCTCTTTTTCCATCCAGG + Intergenic
915061431 1:153188911-153188933 CCCCACCCCTTTGCACTTCCCGG + Intergenic
915098274 1:153479491-153479513 CTCCCCCCCATTCTCCTTTTTGG + Intergenic
915489077 1:156241598-156241620 GCCCGACCCTTTCTCCTGTCCGG + Intronic
917608788 1:176665081-176665103 CCACACCCATTTCTCCTCCCTGG - Intronic
917680580 1:177362156-177362178 GCCCAAGCCTGTCTCCTTTCTGG - Intergenic
917728544 1:177851061-177851083 CCCCACCCCTTTCTCTGGTGTGG - Intergenic
918309605 1:183276188-183276210 CCCCAACCCTCTTCCCTTTCTGG - Intronic
918380031 1:183944669-183944691 CCCCACCCCGTACTGCCTTCTGG - Intronic
919173688 1:193991510-193991532 GCCCAGCTCTTTCTACTTTCTGG - Intergenic
919847190 1:201649506-201649528 CCCCTCCCCTTGCGCCTTCCCGG + Intronic
920119925 1:203648749-203648771 CCCTCCACCTTCCTCCTTTCTGG + Intronic
920379820 1:205528977-205528999 CCCTACCCCTTGCTCCTCGCAGG + Exonic
920683688 1:208092809-208092831 CCCCACCACCTGCTCCTTCCAGG - Exonic
920937100 1:210445786-210445808 CCCCACCCTTCTCTATTTTCTGG + Intronic
922180305 1:223228078-223228100 CCCCACCCCTTGGTCCATTTCGG - Intronic
922745225 1:228039469-228039491 CCCAACCCCCTTCTCCTGGCAGG + Intronic
922858437 1:228795100-228795122 CCCCACCTCCGTTTCCTTTCTGG - Intergenic
923109685 1:230880585-230880607 CCCCATCCCCTTCTCCCTTTGGG + Intergenic
923436153 1:233969887-233969909 CCCCAGCCATTTCTCCTGCCTGG - Intronic
924277321 1:242401622-242401644 CCCCACACTTTTCTTCTATCTGG + Intronic
924441525 1:244089508-244089530 CCCCAGCCCTTTCTCCTTGGTGG + Intergenic
1063195390 10:3736657-3736679 CCTCACCCCTTCCGCCTTGCGGG - Intergenic
1064369781 10:14741266-14741288 CTCCAAGCCTTACTCCTTTCTGG - Intronic
1065088578 10:22206030-22206052 CCCCTCCCCTATCCCCTGTCTGG + Intergenic
1065427343 10:25619364-25619386 CCCCAACCCCTTGTGCTTTCCGG - Intergenic
1065543359 10:26793172-26793194 CCCCTCTCCTTTCTCTATTCAGG - Intronic
1066961219 10:42230203-42230225 CCCCTTCCCTGTCCCCTTTCTGG - Intergenic
1067911518 10:50351045-50351067 CCCCACCCCTTTGGCTTTGCAGG - Intronic
1068302386 10:55161136-55161158 TCCCACCCCTATCACCTTTGTGG - Intronic
1068693986 10:59946370-59946392 CCCCACCCCACTCTCCTTTGGGG + Intergenic
1068943013 10:62699359-62699381 CCCAGCCCCTATCTTCTTTCAGG - Intergenic
1070354795 10:75629355-75629377 CCTCCTCCCCTTCTCCTTTCTGG + Intronic
1070481381 10:76886195-76886217 CCCCAGCCCTTCCTCCTACCTGG + Exonic
1072222163 10:93335694-93335716 CCCCTCCCCCTTTTCCTTTCTGG + Intronic
1072787067 10:98291055-98291077 CCCCGGACCTTTCACCTTTCAGG + Intergenic
1073178347 10:101569846-101569868 CCCCATCTCTTTCTTCTCTCAGG + Intergenic
1073248811 10:102109283-102109305 CCCCACCCCTTCCTTGTTCCCGG - Intronic
1073426799 10:103459842-103459864 CCCCACCCCTTTCCCCAGACAGG - Intergenic
1073479690 10:103778721-103778743 CTCCAGCCCTTTCTGCTTTCAGG + Intronic
1074185009 10:111093565-111093587 TCTGACCCCTTTCTCCTTTCTGG - Intergenic
1075207293 10:120458050-120458072 CACCACCCCTTCTTCTTTTCGGG - Intronic
1075620769 10:123926674-123926696 CTCCTCCCCTTTCTCCTGCCTGG + Intronic
1075824048 10:125338336-125338358 TCCCACTCCTTTCTCCTTTTTGG + Intergenic
1077027927 11:449994-450016 CCCAGCCCCGTTCTCCTTTTGGG - Intronic
1077173523 11:1178744-1178766 CCCCATTCCCTTCTCCCTTCTGG - Intronic
1077324706 11:1958714-1958736 CCCAGCCCCTTTCTCCTCCCTGG - Intronic
1077811870 11:5646316-5646338 CCCCTCCTCTTTCTCTGTTCTGG - Intergenic
1078365571 11:10703687-10703709 CCCCACCCCTACCTCCTCCCTGG - Intergenic
1079163525 11:18015126-18015148 ACCCACTCCTTTCTCAGTTCTGG + Intergenic
1079414229 11:20218138-20218160 CCCACCCCTTATCTCCTTTCTGG + Intergenic
1081198726 11:40192349-40192371 CCCCAACCCTTTGTGCTTCCTGG - Intronic
1081968744 11:47184870-47184892 CCCCACCCCTTCCCTCTCTCTGG + Intronic
1082652331 11:55808631-55808653 CCCCACCCCTTTCTGGTATTTGG + Intergenic
1082653527 11:55824392-55824414 CCCCACCCCTTTCTGGTATTTGG + Intergenic
1082850713 11:57761926-57761948 CGCCACCTCTTCCTCCTTTCGGG - Exonic
1082968186 11:58989875-58989897 CCCCAACCCCTTCTGCTTCCTGG + Intronic
1083321201 11:61848137-61848159 CCCCACCCCTCTCTCCCCACAGG + Exonic
1083411899 11:62499642-62499664 CCACACCCCTTTCCCCTTTGTGG - Intronic
1084089626 11:66871197-66871219 CCCCACACCTTTCTCCCAACAGG - Exonic
1084099028 11:66933333-66933355 TACCAGCCCTTTCTCCTCTCTGG + Intronic
1084184961 11:67466685-67466707 CCCCAACCCTGGATCCTTTCTGG + Intronic
1085022306 11:73217499-73217521 CCCCGCCTCTCTCTCATTTCTGG - Intergenic
1085344331 11:75757996-75758018 CTCCACCCCTTCTTCCATTCAGG + Intergenic
1088818267 11:113435776-113435798 ACCCAGCCCTTCCTCCTCTCTGG - Intronic
1089281653 11:117379088-117379110 CCCCACCTCTTTCCCCTTCGAGG - Intronic
1089889859 11:121870151-121870173 CCCCACTCCTTTCTCCCTGCAGG + Intergenic
1090106167 11:123855167-123855189 CCCGACCCACTTCTCCTTACTGG + Intergenic
1090832515 11:130428913-130428935 CCCAACCGCTTTCTCCTCTGCGG + Exonic
1091084894 11:132712107-132712129 ACCAACCCCTTCCTCCTCTCTGG - Intronic
1202807685 11_KI270721v1_random:13891-13913 CCCAGCCCCTTTCTCCTCCCTGG - Intergenic
1091603827 12:1934104-1934126 CCAGCCCCCTATCTCCTTTCAGG - Intergenic
1091837843 12:3598253-3598275 CCCCACCCCATTCCCCTGGCCGG - Intergenic
1092192762 12:6532959-6532981 CCCCACCCCTTTCACCATTAGGG + Intergenic
1093248772 12:16773369-16773391 CCCCACCCCTTACTCTCTTCTGG + Intergenic
1094057638 12:26283008-26283030 TCCCTCCCCTTGCTCCTCTCAGG - Intronic
1094489497 12:30950099-30950121 CCCCACCCCCTTCTCTTTCTTGG + Intronic
1094789207 12:33891248-33891270 TCACACCCCTTTCTCCTTATGGG - Intergenic
1095381941 12:41605362-41605384 CCACACCACTTTTTCTTTTCTGG + Intergenic
1095985031 12:47993778-47993800 CCCCATCCCATTGTACTTTCTGG + Intronic
1096491109 12:52013596-52013618 ACCCACCCTTCTCCCCTTTCTGG + Intronic
1097029829 12:56082337-56082359 CCCCACCCCAATCCCCTTCCTGG - Intronic
1097145175 12:56935018-56935040 CCCCAGGTCTTTCTGCTTTCTGG - Intergenic
1097774959 12:63634494-63634516 CCCCAACCCTTTGTGCTTCCCGG - Intronic
1098833400 12:75391001-75391023 CCTCCTCCCTTTCTCCTTCCGGG + Intergenic
1098966243 12:76792061-76792083 CAGCACCTCATTCTCCTTTCTGG + Intronic
1099428309 12:82551147-82551169 CCCCACCCTTTTGTGCTTCCTGG + Intergenic
1099579385 12:84423541-84423563 CCTCACCCCTATCTACTTGCGGG + Intergenic
1099935720 12:89122802-89122824 TCCCATCCCCTTCTTCTTTCAGG + Intergenic
1101839367 12:108316782-108316804 CCCCACCCATTTCTGCTATGGGG - Intronic
1102812103 12:115833079-115833101 CTCCATCCCATTCCCCTTTCTGG - Intergenic
1103033855 12:117640680-117640702 TCCCACCCCTTCCTCCTCCCTGG + Intronic
1104017189 12:124969072-124969094 CCCCACCCTCTGCCCCTTTCTGG + Intronic
1105068031 12:133216985-133217007 TCCTTCCCCTGTCTCCTTTCTGG - Intergenic
1106242090 13:27920557-27920579 CCCCACCCCTTTCTCCTTTCCGG + Intronic
1106481985 13:30143571-30143593 CCCCTCCCCTTTCTTCTGCCTGG + Intergenic
1106546875 13:30738483-30738505 CCCAACTCCTGTCTCCTTGCTGG - Intronic
1106692584 13:32134142-32134164 GCCCACCTCTCTCTCCTTCCTGG - Intronic
1107335536 13:39350843-39350865 CCCCACCCCTATCTCTACTCTGG - Intronic
1107404289 13:40098349-40098371 ACCCAGCCCTCTCCCCTTTCCGG - Intergenic
1108708344 13:53010262-53010284 CCCCAGTCTCTTCTCCTTTCTGG - Intergenic
1109363217 13:61323758-61323780 CCCCAACCCCTTGTGCTTTCTGG - Intergenic
1109764585 13:66877894-66877916 CACCAGCCCTTTCACCTTACTGG + Intronic
1109816195 13:67588524-67588546 CCCCAACCCCTTCTGCTTCCTGG - Intergenic
1110044464 13:70810886-70810908 CCCCACTCTTGTCTACTTTCAGG - Intergenic
1111097454 13:83534240-83534262 CCAGGCCCCTTTCTCCTTACAGG + Intergenic
1111430683 13:88145306-88145328 CGCCACCCCTGGCTCTTTTCAGG + Intergenic
1113376291 13:109767324-109767346 CCACACCTCCTTCTCCTTGCTGG - Intronic
1113938085 13:114005727-114005749 CCCCATCCCTTTCTCCCCTCCGG + Intronic
1114487241 14:23070178-23070200 CCCCACCATTTTCTCCATGCTGG - Intronic
1114535182 14:23418055-23418077 CCCCACCTCCTTCTCCTCTCAGG - Intronic
1115196407 14:30805165-30805187 TCCCACTCCTGTCTCCTTGCTGG - Intergenic
1115713747 14:36079065-36079087 TCCCATCCATTTCTTCTTTCAGG - Intergenic
1115970705 14:38941755-38941777 CCCCACCCCTTTCTCTCATTCGG + Intergenic
1117458926 14:55925766-55925788 CTCCACCCCTTTATTCTTTCTGG + Intergenic
1118734274 14:68690807-68690829 ACCCAGCCCTTCCTCCCTTCTGG + Intronic
1118849641 14:69573813-69573835 CCCCACCCCCATCCCCGTTCTGG - Intronic
1119732438 14:76959338-76959360 CCACAGCCATTTCTGCTTTCGGG + Intergenic
1121605956 14:95240275-95240297 CCCTACTTCCTTCTCCTTTCTGG + Intronic
1121609574 14:95268009-95268031 CCTCTCCCCTCTCTCCTTCCTGG - Intronic
1121911575 14:97796783-97796805 ACCAACCCCATTCTCCTGTCTGG - Intergenic
1121939817 14:98059422-98059444 CCTCTCCCCTTTATCCTTCCTGG - Intergenic
1121996347 14:98606468-98606490 CACCTCCCCTTTCTCCCTGCTGG + Intergenic
1122634612 14:103124095-103124117 CTCCTCCCCTTCTTCCTTTCTGG + Intronic
1122743825 14:103886757-103886779 GCCCACTCCTTCCTCCTCTCTGG + Intergenic
1122806598 14:104263047-104263069 CCCCATCACTGTCTCCTTTGGGG + Intergenic
1124033419 15:26031796-26031818 CCCCAGCCCCTCTTCCTTTCTGG - Intergenic
1125533239 15:40427744-40427766 CACTACCCTTTTCTCATTTCAGG - Intronic
1126167862 15:45668749-45668771 CACCACCTGTTTCTTCTTTCTGG + Intronic
1127071225 15:55289834-55289856 CCCCACCTCGCTCTCCTTTACGG - Intronic
1127860512 15:62989940-62989962 CTACACCCCTCTCTCCCTTCAGG + Intergenic
1128086775 15:64892030-64892052 CCCTAACCCTTTCTCCTTTTTGG - Intronic
1128154366 15:65383546-65383568 TCCCAGCCCATTCTCCTGTCTGG - Exonic
1128254136 15:66184788-66184810 CCCAACCCCCTTCTCTTGTCTGG + Intronic
1128479180 15:68022739-68022761 CCTCATCCCTCTCTCCTTACAGG - Intergenic
1129085465 15:73085186-73085208 CACCATCCCTTTCCCTTTTCCGG + Intronic
1129413908 15:75364284-75364306 CCCCAACCCTTTTTCCCTGCTGG + Intronic
1130223661 15:82043042-82043064 CCCCTCTCCCTTCTCCTTCCCGG - Exonic
1130629782 15:85555189-85555211 CCCCACCCCCTACCCCTTTCTGG + Intronic
1130661584 15:85835091-85835113 GCCCACCCCTTTTTCCTTTCTGG + Intergenic
1130675202 15:85946275-85946297 CCCCTCCCCTTCCTCCCTCCTGG - Intergenic
1131511071 15:93049824-93049846 CCACTCCCCTTTCCCCTCTCAGG - Intronic
1131832257 15:96361357-96361379 CCTCCCCCCTTTCTCCTCTGGGG + Intergenic
1132032616 15:98450811-98450833 CCCCTCCTCTTTCTTGTTTCAGG - Intronic
1132065177 15:98725115-98725137 CCACTCCCCTTTCTACTCTCAGG + Intronic
1132069522 15:98763534-98763556 CCCCACCCATCTCTCCTTATTGG + Intronic
1133486810 16:6227570-6227592 CCACACGCCCTTCTCCTTTCAGG + Intronic
1133749484 16:8713312-8713334 TCCCTCCCCTTTTTCCTTCCAGG - Exonic
1133750341 16:8720487-8720509 CCCCAGCCCTCTCTCCCTGCAGG - Intronic
1136580140 16:31146629-31146651 CCCCACCCCCTACTCCTTTCTGG - Intronic
1136722419 16:32336753-32336775 CCCTTGCCCTTTCCCCTTTCTGG - Intergenic
1136778641 16:32884383-32884405 CACTACCCCCTTCTCCTCTCTGG + Intergenic
1136840733 16:33542725-33542747 CCCTTGCCCTTTCCCCTTTCTGG - Intergenic
1136891979 16:33977131-33977153 CACTACCCCCTTCTCCTCTCTGG - Intergenic
1137575629 16:49598153-49598175 CACCACTCCTGTCTTCTTTCTGG - Intronic
1137905642 16:52319360-52319382 CCCCATCCCTTCCTTCTTTTGGG + Intergenic
1138770695 16:59660284-59660306 CCTTACTCCTTTCTCATTTCAGG - Intergenic
1139680130 16:68554968-68554990 TCCAACCCCTTTATCCTTGCTGG + Intronic
1139689856 16:68633955-68633977 CCCCACCACTTTCTCGTTCAAGG - Intergenic
1140068072 16:71626689-71626711 CCCGGCCCCTCTCACCTTTCGGG - Exonic
1140540098 16:75749129-75749151 CCCTTCCTCTTTCTCCTTTTTGG - Intronic
1141878497 16:86842414-86842436 CCTCACCCCTGTCTTCTCTCAGG - Intergenic
1142232468 16:88906261-88906283 TCCCACCCCATTCCCCTTTGAGG + Intronic
1203004012 16_KI270728v1_random:181011-181033 CCCTTGCCCTTTCCCCTTTCTGG + Intergenic
1203081057 16_KI270728v1_random:1146477-1146499 CACTACCCCCTTCTCCTCTCTGG + Intergenic
1203135620 16_KI270728v1_random:1717418-1717440 CCCTTGCCCTTTCCCCTTTCTGG + Intergenic
1203150898 16_KI270728v1_random:1843022-1843044 CCCTTGCCCTTTCCCCTTTCTGG - Intergenic
1142882513 17:2892875-2892897 CCCCTCCCCTTTCTCTTTCTGGG + Intronic
1143107972 17:4538788-4538810 CCCCACCCCATCCTCTTGTCAGG - Exonic
1143141503 17:4744105-4744127 CCCCACTCCGCTCTCCTTACAGG - Exonic
1143520093 17:7439911-7439933 GCCCACCCCCTTCCACTTTCGGG - Intronic
1144348307 17:14369664-14369686 CCCCACCCCCATCTTCTTTATGG - Intergenic
1144728759 17:17514870-17514892 CCCAACCCCTGTCTGTTTTCTGG - Intronic
1144840535 17:18183293-18183315 AACCACCCATTTCTCCTTTAGGG + Intronic
1146095895 17:29930071-29930093 CCGCACCCCTTTCCCCATCCCGG - Exonic
1146634895 17:34496586-34496608 CACTGCCCCTTTCTCCCTTCTGG - Intergenic
1147316889 17:39625315-39625337 CCATACCCCTTCTTCCTTTCAGG + Intergenic
1147460204 17:40563548-40563570 ACCCACCTCTTGCTCCTTGCTGG + Intronic
1148395525 17:47305047-47305069 ACCCACCCCAAACTCCTTTCAGG + Intronic
1148441447 17:47713632-47713654 TCCCACCCCCTTCCCCTTTCCGG - Intergenic
1148568576 17:48648039-48648061 CCCCCACCCCTTCTCCTTTTAGG + Intergenic
1148731365 17:49838774-49838796 CCTAACCCCTCTCTCCTTTCTGG + Intronic
1149330494 17:55576346-55576368 CCCCACCCCTAACTCCACTCTGG + Intergenic
1150224801 17:63518431-63518453 CTTCACCCCTTTCTGGTTTCAGG - Intronic
1151155080 17:72118373-72118395 CCACTCCCCTTTCCCCATTCAGG - Intergenic
1151196958 17:72438507-72438529 CCCCACCCCTCCCACCATTCTGG - Intergenic
1151718169 17:75842149-75842171 ACCCATCCCTGCCTCCTTTCAGG + Intronic
1151814234 17:76463278-76463300 CTCCACCCATTTCTCCCTTCTGG + Intronic
1152633216 17:81419983-81420005 CCCCACCCCACTCTCCTGCCAGG - Intronic
1152639579 17:81444053-81444075 CCCCACCCCTAGAGCCTTTCTGG + Intronic
1155451590 18:25969314-25969336 CACCACCTCTTTCTCTTTTGTGG + Intergenic
1155519551 18:26655926-26655948 CCCCACCCCGTTCTTTTTCCAGG + Intronic
1156975311 18:43214654-43214676 TCCCACCCCTTCCTGCTATCAGG - Intergenic
1157401011 18:47387594-47387616 TGCCACCATTTTCTCCTTTCTGG + Intergenic
1157543598 18:48531488-48531510 CCCCACCTCTTTTTCCGTTTTGG - Intergenic
1157844669 18:50992202-50992224 CCCCACCCCCTTGACCCTTCTGG - Intronic
1158847265 18:61457822-61457844 CCCCACCCCGTTTTCCATCCAGG + Intronic
1159375803 18:67591336-67591358 CCACACACCTTACTCCTATCAGG - Intergenic
1160762722 19:793734-793756 CCCCCCCCGTTTCTCCTGCCAGG + Intergenic
1161153011 19:2719548-2719570 CCCCTCCCCTTCCTCCTTCCAGG + Intronic
1161496906 19:4591452-4591474 CCCTACCCCCTCCTCCTTCCTGG - Intergenic
1161627587 19:5336251-5336273 CCCCCCCCCCTTTTCCTTTAAGG - Intronic
1162907334 19:13831586-13831608 CCTCACCCCCTTATCCTATCCGG + Exonic
1164466866 19:28494551-28494573 GCCCACCACTGTCTCCTCTCTGG + Intergenic
1165317810 19:35067202-35067224 CCCAACCCCTTTCTCCATCTGGG + Intergenic
1166790667 19:45396722-45396744 CCCCACGCCTTTCGACTTCCTGG - Exonic
1166966232 19:46530823-46530845 CCCCTCCCCACTCTCCTTCCAGG + Intronic
1167751869 19:51385696-51385718 CCACACATCCTTCTCCTTTCTGG - Intronic
1168093409 19:54100556-54100578 CCCCACCTCCTTCCTCTTTCGGG + Intronic
1168143965 19:54408709-54408731 CCCTACCCCTTCCTGCCTTCTGG - Intergenic
926242586 2:11099986-11100008 CTCCACATCTTTCTCCTTCCAGG + Intergenic
926242745 2:11101002-11101024 CTCCACATCTTTCTCCTTTCAGG - Intergenic
926696291 2:15771867-15771889 AGCCAACCCTTTCACCTTTCTGG + Intergenic
927030340 2:19114856-19114878 CCCCACCCTTTCTTCCTTTCTGG - Intergenic
927210150 2:20634222-20634244 CTCCACACCTGTTTCCTTTCTGG + Intronic
928904881 2:36357276-36357298 CCCCACCCCCCTTTCCTTTCAGG - Intronic
929574071 2:43041357-43041379 CCCCAGCCCCATCTCCATTCAGG + Intergenic
929929873 2:46245548-46245570 CCCCACCCCTTTGCCCTTAGTGG + Intergenic
930493338 2:52105769-52105791 CCCCACCTCTGTCTTCTTCCAGG + Intergenic
930744167 2:54863589-54863611 GCCCACCCTTCACTCCTTTCAGG - Intronic
931249742 2:60519458-60519480 CCACACCCATCTCTCCTTACAGG - Intronic
931285371 2:60827686-60827708 GCCCACCCACTCCTCCTTTCTGG + Intergenic
931463443 2:62467366-62467388 CGCAAGTCCTTTCTCCTTTCTGG - Intergenic
931796092 2:65711630-65711652 ACCCACCCATTTCTCCTCACGGG + Intergenic
933044716 2:77521125-77521147 TTCCCCCCCTTTCTCCTGTCTGG - Intronic
933809245 2:86022229-86022251 CATCATCCCTTTCTTCTTTCAGG + Exonic
934557945 2:95297276-95297298 GCCCACCCCTTCCTCCCTGCCGG - Intergenic
934665204 2:96164721-96164743 CCCCTTCCCTTCCTCCTTCCCGG + Intergenic
935081265 2:99797473-99797495 ACCCTCCCCTTTCTCCTGTAGGG - Intronic
935081357 2:99799397-99799419 ACCCTCCCCCTTCTCCTTTAGGG - Intronic
935259150 2:101339924-101339946 CCCCATCCCTGTCTCCTAGCAGG + Intergenic
936876104 2:117191278-117191300 TCCCACCCCTGTGTGCTTTCTGG - Intergenic
938370919 2:130767945-130767967 CCTCAGCCCTTCCTGCTTTCAGG + Exonic
939147154 2:138429514-138429536 CTCCACCCCTTTCCCTTTACAGG + Intergenic
939354254 2:141080938-141080960 GCCCACCCCTTAGTCCTCTCAGG + Intronic
939681964 2:145147455-145147477 CCCTACCCATGTCTCCCTTCAGG + Intergenic
939839396 2:147169047-147169069 CCCTAAGCCTTTCTCATTTCAGG + Intergenic
940180216 2:150923708-150923730 CCCTACTCCTTACTCCTATCTGG + Intergenic
941052128 2:160746887-160746909 CCCAAGCCCTTTCTCCCTGCTGG + Intergenic
941475608 2:165948111-165948133 GCCCATCCATTTCTCCTCTCTGG + Intronic
942810694 2:179996639-179996661 CCACACCCCACTCCCCTTTCTGG - Intronic
943537338 2:189168935-189168957 CCACACCAGTTTCTGCTTTCTGG + Intronic
943706831 2:191044581-191044603 TCCCACCCCCTTCTCCTGGCTGG - Intronic
944482064 2:200167687-200167709 CTCCACCCACTTCTCCTTTGGGG - Intergenic
944931860 2:204528109-204528131 CTCCTTCACTTTCTCCTTTCTGG - Intergenic
947074352 2:226325805-226325827 CCCCAAGGCTTTGTCCTTTCTGG - Intergenic
947092432 2:226527389-226527411 CCCCACCTCCTTCTCCTCCCTGG + Intergenic
947790150 2:232861556-232861578 CCCCACTCCTTCCTCCTGCCTGG - Intronic
948097878 2:235350804-235350826 CCCCTCCCCATTCCTCTTTCTGG - Intergenic
948185103 2:236014776-236014798 CCTCTCCCCTTTCTGCTCTCGGG + Intronic
948409142 2:237745659-237745681 CCCAAGCCCTTTTTTCTTTCTGG - Intronic
948595177 2:239075362-239075384 GCCCACCCCTCTCTCCCCTCAGG - Intronic
948625438 2:239265477-239265499 CACCACCCCTCTGTGCTTTCTGG + Intronic
948836144 2:240626856-240626878 CCCCAGCCCTTCCCCCTGTCTGG - Intronic
1169454608 20:5741232-5741254 CCCCACCCAATCCTGCTTTCTGG + Intergenic
1169910560 20:10644586-10644608 CCCCACCCCTATCCCCTACCAGG - Intronic
1169947289 20:11002849-11002871 CCCCACCTCTTCCACCCTTCAGG - Intergenic
1170974670 20:21150845-21150867 CCACCCCTCTTCCTCCTTTCAGG - Intronic
1172670860 20:36633629-36633651 CCCCACTCCTTTCTCTCTCCAGG - Exonic
1173647598 20:44643139-44643161 CCGCTCTCCTGTCTCCTTTCAGG + Intronic
1175644664 20:60660613-60660635 CCCCACACCGTCTTCCTTTCTGG + Intergenic
1176165969 20:63673865-63673887 CCCACCCCATTTCTGCTTTCTGG + Intronic
1176309309 21:5141369-5141391 CCCCACCCAGTTCTCCTGTGTGG - Exonic
1176998657 21:15585021-15585043 CCTCCACCCTTTTTCCTTTCAGG + Intergenic
1178026875 21:28478282-28478304 CCCCTCCCCATTCTCTGTTCAGG + Intergenic
1179352499 21:40625870-40625892 CCTCACCTCTTCCTCCTCTCGGG + Intronic
1179847753 21:44120664-44120686 CCCCACCCAGTTCTCCTGTGTGG + Exonic
1180155332 21:45974680-45974702 CCCCTCCCCTCCCTCCTTTGTGG - Intergenic
1180189977 21:46158274-46158296 CCCCAACCCTCTCTCCTGACAGG - Intergenic
1181532419 22:23524286-23524308 CCCCATCTCTTTCCCCTTTCTGG - Intergenic
1181654656 22:24287027-24287049 CCCCATCCCTCTTACCTTTCTGG - Intronic
1181748167 22:24970327-24970349 CCCCAGCCCTTTCCTCTCTCTGG - Intronic
1181767990 22:25105678-25105700 CTGCACCCCTCTCCCCTTTCTGG + Intronic
1182767013 22:32764982-32765004 CCCCACCCTCTTGTCCTTCCAGG + Intronic
1184643585 22:45884696-45884718 CCCCACCCTTATCTCATTGCAGG + Intergenic
1184994641 22:48196584-48196606 CGCCATCCCTTTCCCCTCTCTGG - Intergenic
949648426 3:6126325-6126347 CCCCTTCCCTTTCCCCTTTCCGG - Intergenic
950198462 3:11026213-11026235 CCCCACCCCTCCCTCTCTTCAGG + Exonic
951550976 3:23874836-23874858 CCCCAACCCCTGCTTCTTTCAGG + Intronic
953744198 3:45560672-45560694 CCCCACTCCTCTCCCCTTCCTGG - Intronic
953806931 3:46078522-46078544 CCCCTACCCTTTTTCTTTTCTGG - Intergenic
953907235 3:46874505-46874527 CCCCACCACCTCCTCCTTCCTGG + Intronic
954107009 3:48414882-48414904 CCCCACACCTTTCTCCTATGAGG - Exonic
954150737 3:48655922-48655944 CCCCAGCCCCTTCTCCTCGCAGG - Intronic
954424038 3:50434029-50434051 CCCTACCCCTCCCTCCTTCCGGG - Intronic
954510567 3:51121251-51121273 CCCCAACCCCTTGTGCTTTCGGG + Intronic
954803123 3:53198890-53198912 GCCCAACCCCTTCTCCTCTCTGG - Intergenic
955070839 3:55571407-55571429 CCCAACCACTTCCTCCCTTCTGG + Intronic
956610853 3:71121366-71121388 CCCCCCCCCTTTTTTTTTTCTGG - Intronic
957141242 3:76360804-76360826 CCTCTCCCCTTTCTCCTGTGTGG + Intronic
958906475 3:99947460-99947482 CCCCACCCCCTTCACCTTAGTGG + Intronic
960026874 3:113019732-113019754 CCCCACCCCCTGCTCCCTTCCGG - Exonic
961269037 3:125673742-125673764 CCCCACACCTGTCTCTTCTCTGG - Intergenic
962162448 3:133013434-133013456 CTCCACCCCTCTCTCTTTGCAGG - Intergenic
963920365 3:150899489-150899511 CCCCAGGACTCTCTCCTTTCTGG - Intronic
966049893 3:175603468-175603490 CCCCACTCCCTTCTCCCTCCAGG + Intronic
967866244 3:194192403-194192425 CCCCACCCCAGTCTCCTGCCAGG + Intergenic
969083499 4:4638295-4638317 CACCACTCATTTCTCCTTCCTGG - Intergenic
969111795 4:4849061-4849083 CCCCACCCCTTTCAGCTTTGTGG - Intergenic
969230342 4:5826345-5826367 CCCCACTCCTTCCCCCTTTCTGG - Intronic
969313844 4:6369907-6369929 CCCCACGCCTTTCTACTCCCAGG - Intronic
969353728 4:6613202-6613224 CCTCAGCCCCTACTCCTTTCAGG - Intronic
969482931 4:7456466-7456488 CCCCCCCCCTCTCACCCTTCAGG - Intronic
970222052 4:13821503-13821525 CCACATCCCTCTCTCCCTTCAGG - Intergenic
971444658 4:26730686-26730708 CCCCACCCACTTCTCATTTACGG + Intronic
971531543 4:27695024-27695046 TCCCTCCTGTTTCTCCTTTCTGG + Intergenic
971922200 4:32955554-32955576 CCCTTCCTCTTTGTCCTTTCTGG + Intergenic
972250409 4:37294055-37294077 CCCACCCCCCTACTCCTTTCTGG + Intronic
974068533 4:57102955-57102977 TACCACCACTTGCTCCTTTCAGG - Intronic
975149494 4:71005225-71005247 CCCCACCCCTTTCACCTTCCAGG + Intronic
975312076 4:72913936-72913958 CCCCACCCCTGTCGCTTTGCAGG - Intergenic
975725907 4:77291395-77291417 CAGCACCCATTTCCCCTTTCAGG - Intronic
978165009 4:105596481-105596503 CCTCCTCCCTGTCTCCTTTCAGG - Intronic
978888910 4:113798486-113798508 CCCCTCCCCTTTCTGGCTTCTGG - Intergenic
979705291 4:123713459-123713481 CCCCACCCCCTTGTACTTCCTGG - Intergenic
980157707 4:129126780-129126802 CCCCAACCCCTTGTCCTTCCGGG + Intergenic
980440979 4:132844838-132844860 CCCCACCCCTGTAGCTTTTCAGG + Intergenic
981011874 4:139933418-139933440 CCCCACCCCTTGCTCCTATTTGG - Intronic
982289342 4:153764209-153764231 CCCCTCCCCAAACTCCTTTCTGG + Intergenic
982292223 4:153791343-153791365 CCCCACTCCCTTCTGCTTTTGGG + Intergenic
984172823 4:176381169-176381191 CCTCACCACTGTCTCATTTCAGG + Intergenic
985200123 4:187476071-187476093 CACCTCCCCTTTCTCCTGCCTGG - Intergenic
985958356 5:3281374-3281396 TCTCACCCCTCTCTCCTCTCGGG - Intergenic
986321683 5:6636907-6636929 CCCCAGCCCTGTCCCCTTCCAGG - Intronic
986773551 5:10994455-10994477 CCGCCCCCCTTCCTCCTTCCCGG - Intronic
987160305 5:15134643-15134665 CCCCAACCCTCTGTACTTTCTGG + Intergenic
987572723 5:19685977-19685999 CCAAACCACTTTCTTCTTTCTGG - Intronic
987845964 5:23286541-23286563 CCTCAGCTCTTTCTACTTTCAGG + Intergenic
988199876 5:28054421-28054443 GCCCACTCCTGGCTCCTTTCAGG + Intergenic
990007717 5:50963361-50963383 CCCCCCGACTTTCTCCTTGCGGG - Intergenic
990205707 5:53426673-53426695 CCCACCCCGTATCTCCTTTCTGG + Intergenic
990222766 5:53611786-53611808 CTCCACCTCAGTCTCCTTTCAGG + Intronic
991567925 5:68023981-68024003 TGCTACCCCTTACTCCTTTCAGG - Intergenic
992325509 5:75655808-75655830 CCCACCCCCTTTGTTCTTTCTGG - Intronic
993025716 5:82643564-82643586 TTCCTTCCCTTTCTCCTTTCTGG - Intergenic
993029912 5:82694247-82694269 CCCCAGCCCTGTCACCTTCCTGG - Intergenic
993083906 5:83339467-83339489 CCCCACCCCCATCTCCTGACAGG - Intronic
993948044 5:94138384-94138406 CCCCAACCCCTTGTGCTTTCTGG + Intergenic
994258906 5:97633976-97633998 CCCTACCCATGTCTCCCTTCAGG + Intergenic
996887512 5:128375321-128375343 CCTCACCAGTTTCTGCTTTCTGG - Intronic
998845242 5:146302329-146302351 CCCCACCCCTGACTTTTTTCTGG + Intronic
999289561 5:150414844-150414866 TCCAACCCCTCTCTCCTCTCTGG - Intergenic
999468586 5:151831029-151831051 CCCCAACCCCTTGTGCTTTCTGG - Intronic
999828358 5:155295831-155295853 TCCAACCCCTGTTTCCTTTCAGG + Intergenic
1000376195 5:160584291-160584313 CCCCAACCCCTTGTGCTTTCCGG + Intronic
1000608504 5:163350093-163350115 CCCAAATCCTTTCTCCTTCCTGG + Intergenic
1001144474 5:169171780-169171802 CCCCACCCCATTTTCCTCTAGGG - Intronic
1001854079 5:174995622-174995644 CCTCACCCCTCTCTCCTCCCTGG - Intergenic
1002070934 5:176678636-176678658 GCCCACATCTTTCTCCTTCCTGG + Intergenic
1002766974 6:249630-249652 CCCCAGCCCTTACTACCTTCTGG + Intergenic
1002882253 6:1263384-1263406 CCCCAGCCCTTTCTCATCTTCGG + Intergenic
1003218935 6:4139337-4139359 TTCAACCCCTTTCTCATTTCTGG + Intergenic
1003245292 6:4377754-4377776 CTCCACCCCTTTGACCTTCCTGG + Intergenic
1004924232 6:20402985-20403007 CCCCACCCCCTTCTCCATCCGGG - Intronic
1004952381 6:20688133-20688155 CCCCACCTCTGGCTTCTTTCAGG + Intronic
1005187671 6:23181052-23181074 CCCCACCCCCTTCCCCAGTCTGG - Intergenic
1005375036 6:25173294-25173316 CCCCAGCCCTCTCTCCATTCTGG + Intergenic
1005419855 6:25637824-25637846 GACCATCCCTTACTCCTTTCTGG - Intergenic
1006321457 6:33321940-33321962 CCCCACCACTTCCTCCCTCCGGG - Exonic
1006652816 6:35565641-35565663 CCCCAACCCTTTTTCCCTTAAGG - Intergenic
1006814358 6:36840236-36840258 CACCACCCCTATCTCCCATCAGG + Intergenic
1007765579 6:44157931-44157953 CCCTCCCCCTTTCTCCTTTCTGG - Intergenic
1008109128 6:47473608-47473630 CCCCAATCCTTTCTCTTTTAAGG + Intergenic
1008124485 6:47653421-47653443 TCCCACCCCTTTTTCTCTTCTGG - Intergenic
1010152327 6:72748092-72748114 CCTCTTCCCTTTCCCCTTTCTGG - Intronic
1010631103 6:78199377-78199399 CCCCACCCTTGTTTCCTCTCTGG + Intergenic
1011557996 6:88588921-88588943 CCCCTCCCCATTGTCCCTTCAGG + Intergenic
1011564972 6:88664567-88664589 CCCCATTCCCTTGTCCTTTCAGG - Intronic
1013158866 6:107522185-107522207 CCTCACACCTGTCTGCTTTCTGG - Intronic
1013695654 6:112699862-112699884 CCCCACCCACTTCTTCTCTCAGG - Intergenic
1014156437 6:118115367-118115389 CACCTCACCTTTCTCCTTGCTGG - Intronic
1018400479 6:163415124-163415146 CCCCGCCCCTCCCTCCTCTCCGG + Exonic
1019003968 6:168780789-168780811 CCCCCCCCCTTTTTTTTTTCTGG + Intergenic
1019139090 6:169932374-169932396 CTACACCCCTGTCTCCCTTCCGG + Intergenic
1020028374 7:4915859-4915881 CGCCACCCTTTTTTCCTTCCTGG - Intronic
1020431894 7:8123651-8123673 CCACACCCATTCCTCCTTTATGG + Intronic
1021451775 7:20788925-20788947 CCCCACCCCTTCCTCCTTCTGGG - Intergenic
1022405913 7:30089658-30089680 CTCCACCCCCATCCCCTTTCTGG - Intronic
1024202486 7:47121212-47121234 TCCCACCCCCTTCTACTTTCTGG - Intergenic
1024709876 7:52003464-52003486 CCCTACCTCTTTCTCTTCTCTGG - Intergenic
1024763826 7:52632273-52632295 CCCCACCTTTTTCTTCTGTCTGG - Intergenic
1025258365 7:57400207-57400229 CTGCGCCCCTTTTTCCTTTCTGG - Intergenic
1027120240 7:75513158-75513180 CTGCCCCCCTTTCTCCTTACTGG - Intergenic
1028630076 7:92925162-92925184 CCCGACCCCTTTCTCTTCCCAGG + Intergenic
1029237858 7:99137370-99137392 CCCCTCCCCTTTCTTCATTGTGG + Intronic
1029465290 7:100721114-100721136 CCCCACCCCCCTCCCCCTTCCGG - Intronic
1029717267 7:102336815-102336837 CTGCCCCCCTTTCTCCTTACTGG + Intergenic
1030023216 7:105295994-105296016 CCCCACACTTTTCTCCTTTTGGG - Intronic
1030071751 7:105703846-105703868 GCCCAGCCCTCTCTCCTTTGAGG - Intronic
1031328220 7:120429477-120429499 CTCCACCTCTTCCTCCTTCCTGG - Intronic
1031565122 7:123286805-123286827 CCCCACCCATTTGCCCTTCCTGG + Intergenic
1032159814 7:129502041-129502063 CCCCACCCCTTTAGTCTCTCGGG + Intergenic
1032305677 7:130731406-130731428 CCCCATCTCTTCCTCCTCTCTGG - Exonic
1032321042 7:130887106-130887128 CCCCACCACTTTCCCCTGTGAGG + Intergenic
1032496566 7:132367476-132367498 CACCCCCCCTTTCTTCTTCCAGG - Intronic
1032539054 7:132688242-132688264 CCCCACTTCCTTCTCCATTCAGG + Intronic
1033121375 7:138669501-138669523 CCCCAGCCTCTTCTCTTTTCTGG - Intronic
1033300682 7:140182292-140182314 CCCTCTCCCTTTCTCCTTTGTGG + Intergenic
1033592276 7:142819716-142819738 ACCCACCGCTTTCTCCTCCCTGG - Intergenic
1035079688 7:156205495-156205517 TCCCAGCCCTTTCTCCTATGGGG + Intergenic
1035874180 8:3169807-3169829 ACCCCCCACTTTCTTCTTTCTGG + Intronic
1037886269 8:22598080-22598102 CCCTTCCCTTTGCTCCTTTCTGG - Intronic
1038158205 8:25011118-25011140 CCCCACCCCTTTTTCTTTTGAGG - Intergenic
1038225636 8:25654654-25654676 CAGCTCCCCTTTCCCCTTTCTGG + Intergenic
1040606282 8:48935145-48935167 CCCAGCCCTTTCCTCCTTTCAGG - Intergenic
1040914903 8:52558990-52559012 CCCTGCCCCTTGCTCCTGTCAGG - Intronic
1041023610 8:53661450-53661472 ACCCACCCCTTTCTCCTGCCGGG - Intergenic
1042020544 8:64369299-64369321 CCCCTCCCCTTTCTCCCTAGAGG - Intergenic
1042295079 8:67209761-67209783 CCACACCCCTGTCTCCATACAGG - Intronic
1043144140 8:76630638-76630660 CCTCACCCTATTCCCCTTTCTGG - Intergenic
1043729064 8:83651440-83651462 TCCCACCCCTCACTCCTTCCAGG + Intergenic
1044440994 8:92223294-92223316 CCCCACCCCCTTGTGCTTCCTGG + Intergenic
1044849681 8:96416550-96416572 CCTCCCACCTTTGTCCTTTCTGG - Intergenic
1045417645 8:101983247-101983269 CCCCACCCCTGGCTCATCTCAGG + Intronic
1046525992 8:115382894-115382916 CACCACCCCTTTCCCCTCTGGGG - Intergenic
1046745411 8:117870715-117870737 CCCAATCCCTTTATCCTTTGTGG - Intronic
1047683830 8:127283438-127283460 GCCCAGCCCTCTCTCCTCTCTGG + Intergenic
1047714750 8:127585250-127585272 CTCCAGGCCTTTGTCCTTTCTGG + Intergenic
1048294800 8:133206320-133206342 CCCCACCCTTTCCTGCTGTCTGG - Intronic
1049196969 8:141320996-141321018 CCCCAGCCCTTCCTGCTTTGGGG - Intergenic
1049256842 8:141618738-141618760 CCTCACCCCTCTCTCCTCTGCGG + Intergenic
1049261171 8:141640065-141640087 CCCCTCTCCTTTCTCCTCGCCGG + Intergenic
1051906141 9:22096883-22096905 CCCCACCCCGCTCACCTTGCTGG + Intergenic
1052831512 9:33219951-33219973 CCCAGCCTCTTTTTCCTTTCCGG + Intronic
1053073006 9:35111909-35111931 CCCCCGCCCTTCCTCCTTCCAGG + Intronic
1055404500 9:75960415-75960437 CCCAGCCCCTATTTCCTTTCAGG - Intronic
1055479747 9:76697751-76697773 CCTCACCACTTTCTCATTTCTGG + Intronic
1055702889 9:78965541-78965563 CTCTTCCCCTTTCTCATTTCTGG - Intergenic
1056584519 9:87919663-87919685 CCCCAGTCCTTTCTCCTCACAGG + Intergenic
1056612347 9:88133257-88133279 CCCCAGTCCTTTCTCCTCACAGG - Intergenic
1056754478 9:89373274-89373296 ACCCACCCCGATCCCCTTTCAGG + Intronic
1056922141 9:90800887-90800909 CCCCAGCCTTTTCTGCTTCCAGG - Intergenic
1057534890 9:95891453-95891475 TCCCACCTCTTTCTAGTTTCTGG + Intronic
1057954683 9:99398165-99398187 CCCCAGCCCTGTCACCTCTCAGG + Intergenic
1058327399 9:103715715-103715737 CCCCTCCCCTTGGACCTTTCTGG - Intergenic
1059099863 9:111459884-111459906 CCCCACCTTTTTCTCTTCTCTGG - Intronic
1059107016 9:111520790-111520812 TCCCACCCGTATCTCCCTTCTGG + Intergenic
1059450555 9:114368785-114368807 CCCCACCCTGTCTTCCTTTCAGG - Intronic
1059518143 9:114914738-114914760 CCCCACACCCTTCTCCTTTCTGG - Intronic
1059989739 9:119853885-119853907 TCCCACACCTTTCCCCTTCCTGG - Intergenic
1060979462 9:127784368-127784390 CCCCAAGCCTTTCTGCGTTCAGG - Intergenic
1061920172 9:133778355-133778377 CCCCACCCCTACCTCAGTTCAGG - Intronic
1062243874 9:135553372-135553394 CCCCAACCCTCTCTCCCATCTGG + Intergenic
1062372452 9:136247119-136247141 CCTCACCTCCTTCTCCATTCGGG - Intergenic
1062436012 9:136546819-136546841 CCCGACCCGTTTGTGCTTTCTGG - Intergenic
1186459922 X:9739937-9739959 CCCCACTCCCCTCTGCTTTCAGG - Intronic
1187260363 X:17679846-17679868 CCCCCCCCCTTTCTTCATTCTGG - Intronic
1189195409 X:39148223-39148245 CTCCACCCCTTCCCACTTTCAGG - Intergenic
1189348333 X:40259127-40259149 CCCCACCCCTTTTGCCTTCCTGG + Intergenic
1189364283 X:40376418-40376440 CCCAACACCTTGCTCATTTCAGG + Intergenic
1189756289 X:44274943-44274965 CCCCAGCTCTTTCTCCTTTTAGG - Intronic
1190509734 X:51162938-51162960 CCCCACCCCTTTCTGAGTTCAGG + Intergenic
1191793709 X:64999323-64999345 CCCCAACCCTTTGTGCTTCCTGG - Intronic
1192491501 X:71579857-71579879 CCCAACTCCTTCCTCCTATCAGG - Intronic
1192656336 X:72998850-72998872 CCCATCTCCTTTTTCCTTTCAGG - Intergenic
1192665784 X:73084151-73084173 CCCATCTCCTTTTTCCTTTCAGG + Intergenic
1192897600 X:75460197-75460219 CCCAACCCATTTCTCCTCACTGG + Intronic
1195278961 X:103310866-103310888 CCCCTCCGCTTCCTACTTTCGGG + Exonic
1195422123 X:104687353-104687375 CCCCACTCCTTTCTCCTCTCTGG - Intronic
1195794949 X:108635971-108635993 CCCCACTCCTTACCCCTTTTGGG - Intronic
1196030128 X:111087871-111087893 CCCCACCCCATTCCACTTCCTGG + Intronic
1197874477 X:131088808-131088830 CCCCACCCTTTTCCCCTGTCTGG - Exonic
1198840108 X:140847298-140847320 CCCCACCTCTTACTCATTACTGG + Intergenic
1199592820 X:149483583-149483605 CCCCACACATTACTCCCTTCTGG + Intronic
1199955059 X:152735677-152735699 GCCCTCACCTTTCTCCTTGCAGG - Intronic
1200091606 X:153638657-153638679 CCCCACCCCGTCCCCCTTCCAGG - Intergenic
1200101183 X:153689666-153689688 CACTACCCCCTTCTCCTCTCTGG - Intronic
1200176593 X:154121471-154121493 CACCTTCCCTTTCTCTTTTCAGG + Intergenic
1201938671 Y:19435089-19435111 CCCCAACCCTTTGTGCTTCCTGG - Intergenic