ID: 1106243348

View in Genome Browser
Species Human (GRCh38)
Location 13:27927178-27927200
Sequence AAGTTCCCCTTTCTGATCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106243348_1106243353 27 Left 1106243348 13:27927178-27927200 CCTTGGATCAGAAAGGGGAACTT 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1106243353 13:27927228-27927250 GCGGTTCTCCACACCCGCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 101
1106243348_1106243352 26 Left 1106243348 13:27927178-27927200 CCTTGGATCAGAAAGGGGAACTT 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1106243352 13:27927227-27927249 TGCGGTTCTCCACACCCGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 115
1106243348_1106243350 8 Left 1106243348 13:27927178-27927200 CCTTGGATCAGAAAGGGGAACTT 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1106243350 13:27927209-27927231 TTGAGAGTGCTCTTTCCTTGCGG 0: 1
1: 0
2: 0
3: 17
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106243348 Original CRISPR AAGTTCCCCTTTCTGATCCA AGG (reversed) Intergenic
902244157 1:15108438-15108460 AATTTACCCTCTCTGAGCCACGG + Intronic
904661822 1:32091227-32091249 TACTTCACCTTTCTGAGCCAAGG + Intronic
904817986 1:33219990-33220012 CAGTTTCCCCTTCTGAGCCAGGG - Intergenic
905678543 1:39848498-39848520 AAGTTCCATGTTCTTATCCAAGG - Intronic
907681805 1:56571201-56571223 TAGTTCCCATTTGTGAACCAAGG + Intronic
908531738 1:65040563-65040585 AAGGTCCACATTCTGATCCCTGG - Intergenic
909096297 1:71292525-71292547 TAGGTCCTGTTTCTGATCCATGG - Intergenic
910494227 1:87808552-87808574 AAGTTTCCCTTCATGATCCAGGG - Intergenic
912595738 1:110874139-110874161 ACTTTCTCCTTTCTGCTCCAGGG - Intronic
912821695 1:112872824-112872846 AAGTTCCCTTATCTGACCAAGGG + Intergenic
912875427 1:113353415-113353437 AATATCCTCTTTCTGATTCAGGG + Intergenic
913088661 1:115461057-115461079 AGGATCCCCTCTCTGAGCCAAGG - Intergenic
913749796 1:121950427-121950449 AATTTCCCTTTTCAGATCTACGG + Intergenic
919801168 1:201355460-201355482 AAGTTCCCCTATCTAAACAATGG - Intergenic
920861176 1:209708385-209708407 GAGTTCTCCTTTCTGGCCCAGGG + Intronic
921214954 1:212928820-212928842 AAGTTCCCCTTTGGGCTCCCTGG - Intergenic
922987355 1:229876162-229876184 AAGTTCCAATTTCTTCTCCAGGG + Intergenic
924076695 1:240346458-240346480 AAGTTGCCCTCCCTTATCCATGG - Intronic
1067200148 10:44162023-44162045 TAGTTCCTCTTTCTGATAAAGGG - Intergenic
1069928537 10:71867689-71867711 TAGTCCCCCTTGCTTATCCAAGG + Intergenic
1070625802 10:78050191-78050213 TTGTTCCCCTTTCTGCCCCATGG + Intronic
1070820389 10:79350803-79350825 CAGTTCCCCTCTCTTACCCACGG + Intronic
1070932729 10:80272536-80272558 GAGTGGCCCTTTCGGATCCAGGG - Exonic
1071832850 10:89389578-89389600 AATTTCCCCTGTCTTTTCCAGGG - Intronic
1072620712 10:97077355-97077377 AAGTTCCCCTTCCTAATCCTGGG + Intronic
1074696677 10:116056060-116056082 AAGTTCCTCTTGCTGTTTCAGGG + Intergenic
1075386900 10:122061559-122061581 GAGTTCTCCTTTCTGCTTCAGGG + Intronic
1081169880 11:39854152-39854174 CAGTTCCCCTTTCTAATGCGTGG + Intergenic
1081571194 11:44292181-44292203 TACTTTCCCTTTCTCATCCAAGG - Intronic
1084184984 11:67466791-67466813 AAGTTCCCCCATCTGAGCAATGG + Intronic
1087965020 11:104402162-104402184 AAGTTCCCATTTTTAAACCAGGG + Intergenic
1088547705 11:110977075-110977097 ATGTTCTCTTTTCTGTTCCATGG - Intergenic
1089384065 11:118056567-118056589 AAATTCAGCTTTCTGGTCCAGGG - Intergenic
1090172477 11:124617035-124617057 TGGTTCACTTTTCTGATCCAGGG - Intronic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1094553480 12:31474402-31474424 AAGTGCCCATTTCTGATCTGGGG + Intronic
1094697845 12:32839298-32839320 ATGTGCCCCTTTCTGAATCAAGG + Intronic
1095117379 12:38370918-38370940 AAGTTCCCTTTACAGATACATGG + Intergenic
1095129306 12:38519832-38519854 GAATTCTCCTTTCTAATCCAAGG - Intergenic
1095541637 12:43315691-43315713 AAGTTCCCCATTCTGATGATAGG - Intergenic
1102539565 12:113608867-113608889 CAATTCCCCTTTCTGACCTAGGG + Intergenic
1102595202 12:113986952-113986974 TACTTCCCCTTTCTGAGCCTTGG - Intergenic
1103028433 12:117592874-117592896 ACACTCCCCTCTCTGATCCATGG - Intronic
1105959335 13:25315289-25315311 AATTTCCCCTTACTGATCAAAGG - Intronic
1106126905 13:26908127-26908149 AAGCCCCCCTCTATGATCCACGG + Intergenic
1106243348 13:27927178-27927200 AAGTTCCCCTTTCTGATCCAAGG - Intergenic
1107339867 13:39394602-39394624 AAGTTCTCCATTCTACTCCATGG + Intronic
1110162028 13:72389809-72389831 ATTATCCCCTTTCTGATTCAAGG - Intergenic
1111580178 13:90212158-90212180 AAATTCTCCTCTCTGATCCTTGG - Intergenic
1113415358 13:110124691-110124713 AAGTTCACCCATCTTATCCAGGG + Intergenic
1114129372 14:19772083-19772105 AAGTTCCCCTTTCTCTGCAAGGG + Intronic
1117921964 14:60734608-60734630 AAGTTCCCCTGTCAAATTCAAGG + Intergenic
1118645321 14:67833069-67833091 AAATTCTCCTTTCTTATCCTTGG - Intronic
1120059101 14:79960813-79960835 ATGTTCTCCTTTCTGTTTCATGG + Intergenic
1121387071 14:93537603-93537625 ATGTTGCACTCTCTGATCCATGG + Intronic
1124040834 15:26101781-26101803 AAGTTCCCCTTTGTGCTATAAGG + Intergenic
1124765251 15:32482855-32482877 CAGTTTCCCTATCTGTTCCATGG + Intergenic
1125979358 15:43985843-43985865 AAGTTTCTCTTTCTCCTCCAGGG - Intronic
1127693806 15:61424135-61424157 AAGTTGCCCCTTCTTACCCACGG + Intergenic
1128764461 15:70242653-70242675 AAATTTGCCTTTCTGATCTATGG + Intergenic
1129357235 15:74999397-74999419 CAGTTCCCCTTTCTATTCCATGG + Intronic
1133334219 16:4996326-4996348 AAGCTCCCCCTTCTCCTCCAAGG + Exonic
1135294837 16:21270203-21270225 AAGTTCACCTTTCTGTTACCAGG - Intronic
1137618405 16:49859627-49859649 AAATGACCCTTTCTGGTCCAAGG - Intergenic
1138248668 16:55485645-55485667 AAGTTCCCCTTCTTGTTCAATGG + Exonic
1140425324 16:74856417-74856439 AATGTCCCTTTTCTGTTCCAGGG + Intergenic
1143459615 17:7093661-7093683 AAGTTCCCCAATCTGATAAAGGG + Intergenic
1146491528 17:33286723-33286745 AAGATCCCCAGTCTGATCCTTGG + Intronic
1147727888 17:42577921-42577943 AACTTCCTCTTTCTGCTCCCGGG + Intergenic
1148241869 17:46004444-46004466 AAGCTCCCAATTTTGATCCAGGG - Intronic
1148392527 17:47283175-47283197 AATTTCCCCTTTCTGTACAACGG + Intronic
1149520295 17:57313641-57313663 AAGTTCCCCTGCCTGTGCCAGGG - Intronic
1151742260 17:75991638-75991660 CAGATCCCCTTTCTCATCCTGGG + Intronic
1153794697 18:8610639-8610661 CAGTTTCCATTTCAGATCCACGG - Intronic
1156610906 18:38722977-38722999 AAGGTCCTCTTTCTGAACTATGG - Intergenic
1157427409 18:47595614-47595636 AGGTTCCTCTTTCTGTGCCAAGG - Intergenic
1160673127 19:375719-375741 AAGTGCCTCTTTGGGATCCAGGG + Exonic
1161370380 19:3907986-3908008 CAGTGCCCCTCTCTGATGCACGG + Intronic
1167809891 19:51820311-51820333 CACTTCCCCTCTCTGAGCCATGG + Intronic
927667705 2:25043554-25043576 ACGTTTGCATTTCTGATCCAGGG + Intronic
933663537 2:84946409-84946431 TGGTTCCCCTTTCTGATCTGTGG + Intergenic
933756868 2:85646555-85646577 AAGTTCCCATTCCTGCTTCAAGG - Intronic
936787654 2:116113527-116113549 AAGTTCCAGTTTCTCATTCATGG + Intergenic
936990934 2:118365292-118365314 GACTTCACCTTTCTGAGCCAAGG + Intergenic
937116202 2:119406711-119406733 AAATTCCCATTTCTCATACAGGG - Intergenic
938632076 2:133178071-133178093 AAGTTCCCCTTTGGTATCAATGG + Intronic
938669134 2:133570512-133570534 TAGTTTTCATTTCTGATCCAAGG + Intergenic
940971056 2:159897239-159897261 AAATTATCCTTTCTGATCCCTGG + Intronic
941129276 2:161626092-161626114 TAGTTCCCGTCTCTCATCCAGGG - Intronic
944085296 2:195839403-195839425 GATTTCTCCTTTCTAATCCATGG - Intronic
945239916 2:207667368-207667390 AACTTCCCCATTCTAACCCACGG + Intergenic
945843845 2:214919538-214919560 AGGTTCCCTATTCTGTTCCATGG - Intergenic
945959642 2:216119256-216119278 AATTTTCGCTTTCTGCTCCAAGG + Intronic
1168959793 20:1861036-1861058 CACTTGCCCTTTCTGATCAAAGG + Intergenic
1170812801 20:19687744-19687766 AAGCACCCCTTTCAGATCCCTGG + Intronic
1171374572 20:24683626-24683648 AAGTTTCCCTTTCTGAGACCAGG + Intergenic
1176892817 21:14338996-14339018 AAGATCTCCTATCTGATCCATGG + Intergenic
1178278321 21:31258942-31258964 AAGTTCTCCATTGGGATCCATGG + Intronic
1180237844 21:46475164-46475186 AAGTTCTCCTTTCAGTTGCAAGG + Intronic
1182380699 22:29884432-29884454 ACCTTCCCCTTTCAGATTCAGGG + Intronic
1183066774 22:35368799-35368821 AAGTTGCCCTTTCGAATCCAAGG + Intergenic
954283612 3:49602169-49602191 ATGTTCCTCTTTCTGATCCAAGG - Intronic
954623155 3:52007068-52007090 AAGTCCCCCTTTCTGAGCCTCGG - Intergenic
956780019 3:72596365-72596387 AAGTGCCCCTTTCTGCTTCCAGG - Intergenic
958619544 3:96538923-96538945 ATGTTCCTTTTTCTGTTCCAGGG - Intergenic
961794964 3:129402821-129402843 CACTTCCCCTTTCTCATCCTTGG + Intronic
962964470 3:140340739-140340761 AATGTCCTTTTTCTGATCCAGGG + Intronic
964898159 3:161623035-161623057 AATTTCCACTTTCTTATGCAAGG - Intergenic
965549950 3:169954293-169954315 AAGTTCCCCTTCTTGTTTCATGG + Intergenic
966236900 3:177711902-177711924 TAGTTCCCCTCGCTGCTCCAGGG - Intergenic
968821012 4:2851248-2851270 AATTTCACCATTTTGATCCAGGG - Intronic
969851486 4:9960535-9960557 ATGTACCCCTATCTGATCAAAGG + Intronic
970172988 4:13307857-13307879 AAGTTCACCTTTCTGATGTTTGG + Intergenic
972466561 4:39362708-39362730 AAGTTTCTCTTGCTAATCCAAGG - Intronic
973297010 4:48534861-48534883 TAATTCTCCTTTCTGAACCAAGG - Intronic
974338221 4:60579230-60579252 ATGTCCTCATTTCTGATCCAGGG - Intergenic
975717350 4:77217641-77217663 TTGTTCCCCTTTGGGATCCAAGG - Intronic
976494774 4:85714879-85714901 ATGTTCCTCTTTCTAATCAATGG - Intronic
978939533 4:114420068-114420090 GAGTTCCCCTTTCAGAAACAAGG - Intergenic
979237202 4:118414785-118414807 AATTTCCCCCTTTTAATCCAAGG + Intergenic
983877791 4:172897054-172897076 ATGTTTGCCTTTCTGAACCAAGG - Intronic
984376934 4:178943652-178943674 AACTTCCCCTTTCTTAGGCATGG - Intergenic
985723756 5:1504849-1504871 AAGTTCCCCGGTCTGACCCTGGG + Intronic
986997314 5:13621868-13621890 AAGTTCCCTTATCTGATTAAAGG + Intergenic
987527117 5:19066710-19066732 GAGTTGCCCTTTGTGATTCAAGG - Intergenic
988530228 5:32021156-32021178 AAGTTCCCCTGTGGAATCCAGGG + Intronic
990564040 5:57011148-57011170 AATTTCCTTTTTCTGCTCCAGGG - Intergenic
992175176 5:74142819-74142841 ATTTTCCCCTTTCCAATCCATGG - Intergenic
994154598 5:96488952-96488974 AAGTTGCCCTTTGTGGTCCTTGG - Intergenic
995154591 5:108895082-108895104 AAGATCCCATTTATTATCCAGGG + Intronic
996165289 5:120215115-120215137 AATATCCCCTTCCTGATCCCAGG - Intergenic
996822564 5:127646954-127646976 TACTTACCCATTCTGATCCAGGG - Intergenic
997073694 5:130646699-130646721 CAATTCCCCCTTTTGATCCAGGG + Intergenic
997411874 5:133696883-133696905 AGGTTGTCCTTTCTGAGCCATGG + Intergenic
999353238 5:150898109-150898131 ATGTCTCCCTTTATGATCCATGG + Exonic
1001546171 5:172571673-172571695 GACTTCCCCTTTCTGAGCCCTGG - Intergenic
1004326240 6:14676351-14676373 AAGTTACACTTTCTCCTCCAGGG - Intergenic
1004350613 6:14887368-14887390 AAGTTAACCTCTCTGAGCCACGG - Intergenic
1005771554 6:29077904-29077926 AATTTCCTCCTTGTGATCCAAGG - Intergenic
1006318520 6:33305090-33305112 AAGGTCCCATTTCCGGTCCATGG + Exonic
1006965502 6:37980058-37980080 ATGTTCCCTTCTCTGTTCCATGG + Intronic
1009676373 6:66827887-66827909 AAGTTTCCGTTTCTGCTTCAGGG + Intergenic
1012301869 6:97599803-97599825 AATTTCTCCTTCCTAATCCAGGG + Intergenic
1012848419 6:104418672-104418694 AAATTACCCTTTCTGCTCCTAGG - Intergenic
1014163521 6:118197518-118197540 AAGTTTCCCTATCTGATTCCAGG + Intronic
1018048365 6:159985381-159985403 AAGTTCCTCATTCTGAGCCTTGG + Intronic
1019115126 6:169754096-169754118 AAATTCCCCTTTCTGACCATTGG + Intronic
1020469414 7:8518782-8518804 AAGTAGCTCTTTCTAATCCATGG + Intronic
1020637769 7:10716782-10716804 AATGTCCTTTTTCTGATCCAAGG - Intergenic
1020706983 7:11557695-11557717 AAGTTCCTCTTTGTTATCAATGG - Intronic
1022314148 7:29228974-29228996 ATGCTCTCCTTTCTGGTCCATGG + Intronic
1022900719 7:34807950-34807972 AAGTTCCCTTTTCTTATATAAGG - Intronic
1029641767 7:101825385-101825407 AAGTTCAGGTTTCTGCTCCATGG + Intronic
1031095586 7:117415681-117415703 GAGTTCCCCTTTATGTGCCAGGG - Intronic
1031365395 7:120895003-120895025 AAGTTCCCCATTTCCATCCAAGG - Intergenic
1032133968 7:129257336-129257358 AAGTTCCCTTTTCCACTCCAAGG - Intronic
1032300824 7:130685033-130685055 AAGATCCGGTTTTTGATCCAGGG + Intronic
1033304455 7:140214289-140214311 TAGTTCCCCTTCCTGAGCCTTGG + Intergenic
1034548152 7:151802466-151802488 GAGTTCCCCTTTCTTCTTCACGG - Intronic
1034679711 7:152919351-152919373 AAGTTCCCATTTCTGAGGCCGGG - Intergenic
1038301048 8:26349012-26349034 AAGTGCCCCTTTCTACTCAATGG - Intronic
1039456359 8:37710050-37710072 AAGGGCTCCTTTCTGATCTATGG - Intergenic
1041640141 8:60189938-60189960 AAGTTTCCTTTTCTTATCCAAGG + Exonic
1042034759 8:64520197-64520219 CATTTCCCCTTTCTGATCAAAGG + Intergenic
1043603568 8:81971516-81971538 TTGTTCCCATTTCTGATCCATGG + Intergenic
1043708297 8:83380402-83380424 ATGTTCCCATTCCTGATCCCTGG + Intergenic
1043817804 8:84824673-84824695 AGGTTCTCCATTCTGTTCCATGG - Intronic
1044329778 8:90903992-90904014 AAGTTACCCCTAGTGATCCAGGG + Intronic
1048025523 8:130583244-130583266 AAGTTCCCATTGCTCTTCCAGGG - Intergenic
1048249996 8:132857048-132857070 ATGTTCCTCTTTCTGTTCCAGGG - Intergenic
1049275842 8:141719753-141719775 AAGTTCCCCTGTGTGTCCCAGGG - Intergenic
1050640162 9:7658943-7658965 AAGCTCCCCTTTCGCATACATGG - Intergenic
1055482668 9:76725170-76725192 GGGTTCCCCTTTCTGATTTATGG + Intronic
1057031493 9:91779053-91779075 AATATCCCTTTTCTGTTCCAGGG - Intronic
1057140928 9:92726423-92726445 AATGTACCCTTTCTGACCCATGG + Intronic
1062041160 9:134404944-134404966 CATTTCCCCTTTCAGATCCTTGG - Intronic
1186451537 X:9677887-9677909 CAGCTCCCTTTTCTGACCCATGG - Intronic
1187127008 X:16463267-16463289 AATTACCCCTTGCTGATCCAAGG + Intergenic
1187185533 X:16981208-16981230 AAGTTCCCACATCTGCTCCATGG - Intronic
1191697327 X:64003528-64003550 ATGTTCCCCTTTCTGACCTATGG - Intergenic
1194147592 X:90282010-90282032 AAGTTGCCCTCTCTAATCCAAGG - Intergenic
1196285630 X:113876436-113876458 AAGGTCCTCCTTCTGTTCCAGGG + Intergenic
1198450347 X:136761342-136761364 AAGTTCCAATCTCTGTTCCATGG + Intronic
1200493987 Y:3858767-3858789 AAGTTGCCCTCTCTAATCCAAGG - Intergenic
1202018942 Y:20444280-20444302 AAGTTCCCTGCTCTGACCCAGGG + Intergenic