ID: 1106246436

View in Genome Browser
Species Human (GRCh38)
Location 13:27954068-27954090
Sequence CGCCCGCGGCCTCCGGCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106246436_1106246440 -7 Left 1106246436 13:27954068-27954090 CCAGACGCCGGAGGCCGCGGGCG 0: 1
1: 0
2: 3
3: 18
4: 133
Right 1106246440 13:27954084-27954106 GCGGGCGGCTGCAGCTTTGACGG 0: 1
1: 0
2: 0
3: 10
4: 98
1106246436_1106246441 -6 Left 1106246436 13:27954068-27954090 CCAGACGCCGGAGGCCGCGGGCG 0: 1
1: 0
2: 3
3: 18
4: 133
Right 1106246441 13:27954085-27954107 CGGGCGGCTGCAGCTTTGACGGG 0: 1
1: 0
2: 0
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106246436 Original CRISPR CGCCCGCGGCCTCCGGCGTC TGG (reversed) Intergenic