ID: 1106246436

View in Genome Browser
Species Human (GRCh38)
Location 13:27954068-27954090
Sequence CGCCCGCGGCCTCCGGCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106246436_1106246441 -6 Left 1106246436 13:27954068-27954090 CCAGACGCCGGAGGCCGCGGGCG 0: 1
1: 0
2: 3
3: 18
4: 133
Right 1106246441 13:27954085-27954107 CGGGCGGCTGCAGCTTTGACGGG 0: 1
1: 0
2: 0
3: 13
4: 151
1106246436_1106246440 -7 Left 1106246436 13:27954068-27954090 CCAGACGCCGGAGGCCGCGGGCG 0: 1
1: 0
2: 3
3: 18
4: 133
Right 1106246440 13:27954084-27954106 GCGGGCGGCTGCAGCTTTGACGG 0: 1
1: 0
2: 0
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106246436 Original CRISPR CGCCCGCGGCCTCCGGCGTC TGG (reversed) Intergenic
900311051 1:2033292-2033314 CACCTGCGGCCTCCAGCCTCAGG - Intergenic
901433915 1:9234802-9234824 CGCCCCAGGCCTCAGGCCTCAGG - Exonic
901641431 1:10694883-10694905 CGCGCGCGGCCGCCGGCGGCCGG - Intronic
903190195 1:21651960-21651982 CGCCGGCGGCCCCCGGCAGCTGG - Intronic
903907503 1:26696834-26696856 CGCCCCCAGCCTACGGCTTCGGG + Exonic
905416500 1:37808043-37808065 CTCCGGCGGCCCCCGGCGCCCGG - Exonic
908128797 1:61054253-61054275 CTCCCGAGACCTCCTGCGTCCGG - Intronic
908132139 1:61083657-61083679 GGCCCGCGGCCTCCGGCGTTCGG - Intronic
908132142 1:61083664-61083686 GGCCCGCGGCCCGCGGCCTCCGG - Intronic
909392929 1:75136443-75136465 CGCCCGCGGCGCCCGGGCTCAGG + Intronic
910646988 1:89524907-89524929 AGCCCGCAGCCTCCGGCAGCCGG + Exonic
914386281 1:147172676-147172698 CGCACGCAGCCTCCAGCGCCAGG + Intergenic
914824647 1:151132454-151132476 GGCCCACGGCCTCCAGCGTGGGG - Exonic
915246387 1:154558734-154558756 GGCGCGCGGCTTCCGGCGGCTGG - Intronic
920515712 1:206583501-206583523 CTCCAGAGGCCTCCGGGGTCTGG + Intronic
923040889 1:230319110-230319132 AGGACGCGGCCTCCTGCGTCAGG + Intergenic
924527240 1:244863616-244863638 CGCCCCGGGGCTCCGGCGGCGGG - Exonic
1064544502 10:16437108-16437130 GCCGCGCGGCCTCCGCCGTCGGG - Intronic
1067033852 10:42898739-42898761 CGCCCGCGGCCGCCTGAGTCAGG - Intergenic
1067843268 10:49698828-49698850 CACCCGAGGCCTCCGAAGTCAGG + Intronic
1069623190 10:69850513-69850535 TTCCAGCGGCCTCCTGCGTCTGG + Intronic
1070330027 10:75409790-75409812 AGCCCGAGGCCTCCGGGGTTGGG - Intergenic
1071695457 10:87864169-87864191 CGCCGGCGGCCTCCGGAGCCCGG - Exonic
1073124782 10:101142318-101142340 CGGCCGCGGCCTCCAGCTTTTGG - Intergenic
1075768873 10:124917014-124917036 CTCCCCCGGCCTCCGGCAGCCGG + Intergenic
1076373115 10:129967510-129967532 CGCCCGCCGCCCCTGGCGCCCGG + Intergenic
1076616652 10:131759539-131759561 CTCCCGCAGCCTCCGGTCTCCGG - Intergenic
1077898888 11:6474185-6474207 CGCCAGCTGCCTCCGGCTCCGGG + Exonic
1080551443 11:33376529-33376551 CGCCCCCTCCCTCCGGCGCCCGG + Intergenic
1081831508 11:46119971-46119993 GCCCCGCGGCCGCCGGCGGCGGG + Intronic
1081969444 11:47187427-47187449 CGCCCGGGACCTTCTGCGTCCGG - Intergenic
1085666349 11:78418089-78418111 CGCCCGCGGCTTGGGGCCTCAGG - Intronic
1088579040 11:111299004-111299026 CGCCCGCTGCCCGCGGAGTCCGG + Intronic
1096101011 12:48970492-48970514 CGGCCGCGGCCTCCGCCCTCGGG - Exonic
1096255073 12:50057801-50057823 CGGCCGCGGGCTCCGGCCCCGGG + Exonic
1096389591 12:51218095-51218117 AGCCCGCCGCCCCCGGCGGCTGG - Intergenic
1096992638 12:55817730-55817752 CACCCGCGGCCTCCGCCTCCAGG + Exonic
1097267607 12:57755200-57755222 CGCCCGGGTCCTCCTGCGGCGGG - Exonic
1099989553 12:89708554-89708576 CGCCCGCGGCCGGGGGCGGCGGG - Intronic
1100260659 12:92929341-92929363 CGCCCGCGGCCGCCGGGGGGCGG + Intergenic
1100315480 12:93441492-93441514 CGCCCGCGGCCTCCGGCGGGGGG + Intronic
1102197131 12:111033922-111033944 CGCCCGCGCCCTCCGGGGGTCGG + Intergenic
1102997450 12:117361213-117361235 CGCCCGCGGCCGCCGCGCTCCGG + Intronic
1106246436 13:27954068-27954090 CGCCCGCGGCCTCCGGCGTCTGG - Intergenic
1106602472 13:31199912-31199934 CGGCCGCGCCCTCTGGCGGCCGG - Intergenic
1106720039 13:32427670-32427692 TGCCCGCGCCCTCAGGCGCCAGG + Intronic
1108292510 13:48975848-48975870 CGGCCGCGGGCTCCGTCGGCGGG + Intergenic
1113200998 13:107867342-107867364 CGCCCGCGGGCGCCGCCGCCGGG + Intergenic
1115852404 14:37598650-37598672 AGGCCGCGGCCTCGGGCCTCGGG + Intronic
1121101596 14:91253634-91253656 CGCGCGCGGTTTCCGGGGTCCGG + Intronic
1123018556 14:105386936-105386958 CGTCCACGGCCTGCGGCGGCCGG - Intronic
1125474739 15:40039284-40039306 CGCCCGCGCCCTGGGACGTCCGG + Intergenic
1125674589 15:41495350-41495372 CGCCCCCGGCCTCGGGCGTCTGG + Intronic
1126626063 15:50686766-50686788 CGCCCGCCTCCGCCGGCGACGGG + Exonic
1129082498 15:73052753-73052775 CGGCCGCGGCGCCCGGCGCCCGG - Exonic
1131257333 15:90871419-90871441 CGCCCGCTGCCTCCGGCTCCTGG - Intronic
1132178267 15:99732883-99732905 CGCCGGCCGCCTCCCGCCTCCGG - Intronic
1132523386 16:401755-401777 CGCCCGCGGCCTGCTGGGACTGG - Intronic
1132559905 16:588957-588979 CGTCCGCGGGCCCCGGCGTGGGG - Intergenic
1134609494 16:15597299-15597321 CACCCACGGCCTCCCGCCTCAGG - Intronic
1136146743 16:28320737-28320759 GGCCCGCGCCCCCCGCCGTCGGG + Exonic
1139484728 16:67249077-67249099 CGCCCGGGGACTCTGGCTTCTGG - Exonic
1141686099 16:85570824-85570846 CTCCTGCCTCCTCCGGCGTCCGG - Intergenic
1142115430 16:88353817-88353839 CGCCTGGGGCCTCCGGCAGCTGG + Intergenic
1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG + Intronic
1144756025 17:17681322-17681344 CGCTCGCGGCCCCGGGCGCCAGG - Intergenic
1146646585 17:34580758-34580780 CGCCCGCGGCCACCGGGCTCCGG + Exonic
1147891587 17:43720988-43721010 CGCCCGCGGCCGCGAGGGTCTGG + Intergenic
1148490985 17:48023945-48023967 CGCCCGCCGGCTCCGGCCTGTGG + Intergenic
1150002700 17:61451758-61451780 CGCCCGCGGCCCCCTGGGCCGGG + Intergenic
1152544075 17:80992064-80992086 CGCCCTCGGCCCCCCGCGTTCGG + Intronic
1153854836 18:9136178-9136200 AGCCCGCGGCCCCCCGCCTCAGG - Intergenic
1158976473 18:62715637-62715659 CGCCCGCTGCCTCCGGAGCTGGG + Exonic
1160991983 19:1863781-1863803 CGCGCGCGGCCGCCGGGGGCGGG + Intergenic
1162312440 19:9914871-9914893 AGCCCGCGGCCGCCGCCGTCTGG + Intronic
1163666647 19:18606728-18606750 GGCCCGCGCCCTCCCGCGCCCGG - Exonic
1163708508 19:18831900-18831922 CGCGCGCTTCCGCCGGCGTCGGG + Intergenic
1167258111 19:48443030-48443052 CCGCCGCGGCCACCGCCGTCGGG + Exonic
1168309192 19:55452149-55452171 CGCCCCCGGCCCCCGCCTTCCGG - Intergenic
1202713971 1_KI270714v1_random:32324-32346 CGCCTGCAGCCTCTGGCCTCTGG + Intergenic
931711205 2:64989961-64989983 TGCCAGCTGCCTCGGGCGTCTGG + Exonic
932567744 2:72920168-72920190 CGCCCCCGGCCCTCGGCGCCCGG - Intronic
935591003 2:104845221-104845243 CGGCCGCGGGCTCCTGCGGCGGG - Intergenic
946227262 2:218270586-218270608 TGCCCGCGTCCTCCGGGGTAAGG + Exonic
1169065666 20:2693123-2693145 CGCCCGCAGCCTCCGCCTCCCGG + Exonic
1172143936 20:32743343-32743365 CGCCCACGGCCTCCGGCACCGGG + Exonic
1173166146 20:40688526-40688548 CCACCGCGTCCTCGGGCGTCAGG + Exonic
1176178730 20:63740042-63740064 CGCCCCCGCCCACCGGCGCCCGG - Intronic
1176414866 21:6468290-6468312 CGCCCGCGGCCTCCGGGACCTGG - Intergenic
1178314832 21:31559114-31559136 CGCCTGCGGCCTCGGGGGCCGGG + Intronic
1178922499 21:36747837-36747859 CGCCCGGGGCCTCGGGGGTCGGG - Exonic
1179209421 21:39313171-39313193 CACCCGCGACCCCCGGCGGCGGG + Intronic
1179626839 21:42653751-42653773 CTCCCGCGGCGGCTGGCGTCGGG + Exonic
1179690366 21:43076612-43076634 CGCCCGCGGCCTCCGGGACCTGG - Intronic
1181793132 22:25283108-25283130 CGTCAGCGACCTCCTGCGTCCGG + Intergenic
1181813774 22:25421384-25421406 CGCCAGCGACCCCCTGCGTCCGG + Intergenic
952382575 3:32816795-32816817 CGGCCGAGGCCACCCGCGTCCGG + Intergenic
952942572 3:38455099-38455121 CGCCCGCGGCTGCGGGCGTGTGG + Intronic
955406261 3:58627444-58627466 AGCCCACGGCCTCCACCGTCTGG - Exonic
955768574 3:62369085-62369107 CGGGCGCGCCCTCCGGCGGCAGG + Intergenic
966762321 3:183428807-183428829 CGCCAGCCGCCCCCGGGGTCAGG - Intergenic
966915767 3:184583487-184583509 CGCCCGCGGCCTCCTCCGCGCGG - Intronic
968879834 4:3293175-3293197 CGCCCGCGCCCTCCGCCTCCCGG + Intronic
970195679 4:13547923-13547945 CGCGCGCGACCTCCGGCCGCTGG - Intergenic
976404263 4:84644109-84644131 CACACGCGGCCTACGGGGTCAGG + Intronic
981615042 4:146637386-146637408 CACCCGCGGGTTCCTGCGTCGGG + Intergenic
983229223 4:165112776-165112798 GGGCTTCGGCCTCCGGCGTCGGG - Exonic
985129711 4:186726930-186726952 CGCCCGCGCTCGCCGGCGCCCGG - Intergenic
985580545 5:693422-693444 CGCCCCCGGCCCCCAGCGTCCGG + Intergenic
985895488 5:2748316-2748338 GGCCCGCGGCCGGCGGCGCCCGG - Intronic
985896191 5:2751225-2751247 CGCAGGCGGCCACCGGCTTCGGG - Exonic
990488214 5:56279585-56279607 TCCCCTCGGCCTCTGGCGTCAGG - Intergenic
990545293 5:56815843-56815865 CGTCCGCGGGCTCCGGCGACGGG - Exonic
992098339 5:73382195-73382217 CCAGCGCGGCTTCCGGCGTCCGG - Intergenic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
992663585 5:78984848-78984870 CGCCCGCGGCCTCAAGGGCCGGG + Intronic
994072837 5:95620886-95620908 CGCCCCCGGCCGCCCGCGCCTGG + Exonic
998401172 5:141849827-141849849 CGGCCCCGGCCTCCTCCGTCCGG - Intergenic
1002091870 5:176810740-176810762 CGCCCGCGGCCATGGCCGTCCGG + Exonic
1002185907 5:177454744-177454766 CGCCCGCGCCCTGCGCAGTCCGG - Intronic
1002638387 5:180619195-180619217 CGCCCGCGGCGCCCCGCGCCCGG + Intronic
1007623571 6:43229465-43229487 CGCCCGCGCTCTCCGGCGCCAGG + Exonic
1008378639 6:50819714-50819736 CGCCAGCCGCCTCCGGGGCCCGG + Intronic
1013052805 6:106553716-106553738 AGCCCGTGTCCTCTGGCGTCTGG - Intronic
1014802314 6:125790859-125790881 CGCCCGCGGGGCCCCGCGTCCGG - Exonic
1021452776 7:20798056-20798078 CGCCCGCGGCCGCCGCAGCCCGG - Intergenic
1022285893 7:28956258-28956280 CGCCCACCGCCTCCACCGTCAGG + Exonic
1022363377 7:29685058-29685080 CGGCGGCGGCCTCCGGCCCCCGG + Intergenic
1025078870 7:55965045-55965067 CGTCCGGGGCCTGCGGCCTCAGG - Intronic
1029207739 7:98879200-98879222 CGGCCTGGGCCTTCGGCGTCCGG + Intronic
1031134767 7:117873156-117873178 CCCCCGCGGCCTCCGCCGTGTGG + Intronic
1032159898 7:129502354-129502376 CGACCGCGGCCTCCAGCGCCCGG - Intergenic
1032306203 7:130734066-130734088 CGCCCGCGGCCGGCCGCGTTCGG - Intergenic
1035681420 8:1491332-1491354 GGCCCGAAGCCTCCGGGGTCAGG - Intergenic
1035681432 8:1491361-1491383 AGCCCGAAGCCTCCGGGGTCAGG - Intergenic
1037947748 8:22999779-22999801 CGCCCGCTGCCTCCGCAGCCCGG + Intronic
1038883618 8:31640113-31640135 CGGCCGCCGCCCCCGGCGCCAGG - Intronic
1039542365 8:38382435-38382457 CGCCCGCGGCAGCTAGCGTCTGG + Intergenic
1042926969 8:73976458-73976480 CGCGCGCCTTCTCCGGCGTCCGG + Exonic
1049585249 8:143429989-143430011 CCACCGCGTCCTCGGGCGTCAGG + Exonic
1049803180 8:144527503-144527525 CGCCCGCACGCTCCGGCGCCGGG + Exonic
1052295506 9:26892771-26892793 CGCCCACGGCCGCAGGAGTCGGG - Exonic
1052494966 9:29213651-29213673 CGCCCGCGGCCCCCGGCCAGTGG + Intergenic
1052888808 9:33676926-33676948 CTCCAGCGGCCTCCGGAGCCCGG + Intergenic
1057619016 9:96619118-96619140 TGCCCGGGGCCTCCGGGGCCGGG - Intronic
1059305324 9:113349530-113349552 CGCCCGCCGCCACCTGCGACAGG + Exonic
1061754859 9:132805094-132805116 GGCCCGGGGCCTCCAGGGTCAGG + Intronic
1062022297 9:134325449-134325471 CGCCCGCCGTCTCGGGCGGCTGG - Intronic
1062325697 9:136011551-136011573 GGGCCGCGGCCGCCGGCGTCTGG + Exonic
1187225849 X:17375146-17375168 CCCGCGCGGCCTCCTGCGCCCGG + Intergenic
1188769147 X:34131281-34131303 CGCCCGGAGCCTCCGGAGACTGG - Exonic
1192274750 X:69616934-69616956 CGCCCGCGGCCCCTGGCTGCGGG + Intronic
1197734889 X:129843392-129843414 CGGCCCCGGACTCCGGCCTCCGG - Intronic
1198254722 X:134914937-134914959 CGCCCGCGGCGCCCGGCCCCAGG - Intronic
1199771174 X:150976232-150976254 CCCCGGCAGCCTCCGGGGTCTGG + Intergenic