ID: 1106246578

View in Genome Browser
Species Human (GRCh38)
Location 13:27954686-27954708
Sequence AAGGAGCCCGGGCCCCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106246574_1106246578 -8 Left 1106246574 13:27954671-27954693 CCTTGGAGGACGGTCAAGGAGCC 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1106246578 13:27954686-27954708 AAGGAGCCCGGGCCCCGCGGCGG 0: 1
1: 0
2: 2
3: 16
4: 197
1106246572_1106246578 0 Left 1106246572 13:27954663-27954685 CCGAGTGGCCTTGGAGGACGGTC 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1106246578 13:27954686-27954708 AAGGAGCCCGGGCCCCGCGGCGG 0: 1
1: 0
2: 2
3: 16
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106246578 Original CRISPR AAGGAGCCCGGGCCCCGCGG CGG Intergenic