ID: 1106247789

View in Genome Browser
Species Human (GRCh38)
Location 13:27963586-27963608
Sequence GTTGCTTTGAAAAGAAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 308}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106247789_1106247790 24 Left 1106247789 13:27963586-27963608 CCTGAGTTTCTTTTCAAAGCAAC 0: 1
1: 0
2: 1
3: 22
4: 308
Right 1106247790 13:27963633-27963655 AGTTTAAAGTCTCAGAACCAAGG 0: 1
1: 0
2: 1
3: 24
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106247789 Original CRISPR GTTGCTTTGAAAAGAAACTC AGG (reversed) Intronic
902674595 1:17999917-17999939 GTGGCTTTGTCAAGAAACTCAGG + Intergenic
903453316 1:23469934-23469956 ATTGCTGTGAAAAGAAATTGAGG + Intronic
903480291 1:23648113-23648135 TTTCCTTTGAAAAGTATCTCAGG + Intergenic
903691240 1:25175148-25175170 GTTCCATGGAACAGAAACTCAGG + Intergenic
903844341 1:26268845-26268867 GATTCTTTGAAGAGAAACTTGGG - Intronic
904377895 1:30093376-30093398 GATTCTTTGAAGAGAAACTTGGG + Intergenic
904797326 1:33066500-33066522 GCTGCTTTCTAAAGAAAATCTGG + Intronic
905951568 1:41955863-41955885 GTTGCTTAGAAAAGGGCCTCCGG + Intronic
907716554 1:56931783-56931805 GTTAATTGGAAAAGGAACTCTGG - Intronic
908745463 1:67372167-67372189 GTTTATATGGAAAGAAACTCAGG + Intronic
909881039 1:80878941-80878963 GTTACTTTTAAATGAAACTCTGG + Intergenic
910418779 1:87032567-87032589 TTTGCTTTAAAAAGTACCTCAGG + Intronic
912461492 1:109835183-109835205 GTTGCTTTGCAATGAAATGCAGG + Intergenic
912529524 1:110310273-110310295 GAAGCTCTGAAAAGAAACACTGG - Intergenic
914222360 1:145692407-145692429 GTTATTTTGAAAAGGAATTCTGG + Intronic
914576927 1:148980763-148980785 GTTACTTTTTAAAGAACCTCTGG + Intronic
915452695 1:156017646-156017668 GGTGCTTTTAAAAGAAATTCAGG - Intronic
916229170 1:162522243-162522265 TTTGTTTAGAACAGAAACTCAGG + Intronic
917101061 1:171445842-171445864 TCTTCTTTGAAAAGAAACCCTGG - Intergenic
918664091 1:187126887-187126909 TTTGCTTGTAAAAGAAACTGAGG - Intergenic
918674532 1:187266319-187266341 ATTCCTTTGTAAAGAAAGTCCGG + Intergenic
919278580 1:195454641-195454663 GTTGCTTGTAGAAGAAACACTGG + Intergenic
920297149 1:204965587-204965609 GTGGCTATTAAAAAAAACTCGGG - Intronic
920446345 1:206021484-206021506 GTTGGCTTCAAAAGAAACTCAGG + Intronic
921269115 1:213451487-213451509 GCTGCTGTGAAAAGAAACAGAGG - Intergenic
923259665 1:232256886-232256908 TATGCTGTGAAAAGAAGCTCAGG + Intergenic
923494024 1:234509179-234509201 GTTGCTTAGAAAAGCTACTTGGG + Intergenic
924817269 1:247453623-247453645 TAGGCTCTGAAAAGAAACTCTGG - Intergenic
1063208452 10:3856618-3856640 GTTGCTTGGCAATGAAACACCGG - Intergenic
1066435243 10:35391599-35391621 GATTCTTTGAAGAGAAACTTGGG + Intronic
1067300901 10:45008387-45008409 GTATCTTTGGAAACAAACTCTGG - Intergenic
1070558500 10:77548153-77548175 GTGGATTTGGAAGGAAACTCAGG - Intronic
1070913189 10:80135898-80135920 TCTGCTTTGAAAAGCAACCCTGG - Intronic
1072391478 10:94991880-94991902 GATTCTTTGAATAGAAACTTGGG + Intergenic
1072807940 10:98436825-98436847 CTTGCCTTGAAAAGAAAGACAGG + Intronic
1073083782 10:100875638-100875660 GTTGCTCTGACCAGAAACTAAGG - Intergenic
1073159990 10:101384688-101384710 GTTGATTTGAAAATATACACAGG + Intronic
1073195074 10:101683831-101683853 GCTGATTTGGAAGGAAACTCAGG + Intronic
1074567337 10:114592553-114592575 GTTGCATTGAAAATAAACTGAGG + Intronic
1076513931 10:131032719-131032741 GTTGCTTTGAAAAATAAATGAGG - Intergenic
1076554903 10:131314908-131314930 ATTGCTTTGGAAAGAAGTTCTGG - Intergenic
1077559642 11:3251258-3251280 GATTCTTTGAAAAGAAACTTGGG - Intergenic
1077565535 11:3297061-3297083 GATTCTTTGAAAAGAAACTTGGG - Intergenic
1077586858 11:3460391-3460413 TTTGCTTAAAAAAGAAACACAGG - Intergenic
1077831198 11:5872705-5872727 GATGCTTAGAAAAGAAACTGAGG - Intronic
1078389812 11:10927267-10927289 GCTGCTTTGAAAGGTAGCTCTGG - Intergenic
1079241733 11:18726683-18726705 GTGGCCTTGTAAAGATACTCAGG - Intergenic
1079767154 11:24408102-24408124 GTTACTTGGAGAAGTAACTCAGG - Intergenic
1080007732 11:27427599-27427621 GTTGCTTTACAAAGAAATTCTGG + Intronic
1080295955 11:30727685-30727707 ATTTATTTGAAAAGAAACTGTGG + Intergenic
1083021346 11:59510598-59510620 GTTGCTTTAAACAGAAAATGTGG + Intergenic
1084242856 11:67834422-67834444 CTTGCTTAAAAAAGAAACACAGG - Intergenic
1084830143 11:71762557-71762579 CTTGCTTAAAAAAGAAACACAGG + Intergenic
1085584221 11:77686066-77686088 GTTTCTTGGAAATGAAACTATGG - Intronic
1085868962 11:80326918-80326940 GTAGCTTTTAAAAAATACTCTGG - Intergenic
1086193266 11:84106230-84106252 TTTACTTTGAAAAGTAAATCTGG + Intronic
1087240164 11:95765638-95765660 GTTTCATTGAATAGAAATTCTGG + Intergenic
1087456614 11:98394843-98394865 GATTCTTTGAAAAGAAATTTAGG + Intergenic
1089848100 11:121474247-121474269 GCTGGTTAGAAAAGAATCTCAGG + Intronic
1091919064 12:4289921-4289943 TTTGGTTTGAAAAAAAACCCTGG + Intronic
1092413096 12:8269121-8269143 CTTGCTTACAAAAGAAACACAGG - Intergenic
1096361306 12:50989912-50989934 GTTTCTTTGAAAAGACACAGGGG - Intronic
1096471982 12:51884599-51884621 GATTCTTTGAAGAGAAACTTGGG - Intergenic
1097519802 12:60652649-60652671 GATTCTTTGAAGAGAAACTTGGG + Intergenic
1097770806 12:63582204-63582226 GTGGCTTTGAAAAGTATTTCTGG - Intronic
1097810087 12:64009668-64009690 CTTGATTTGAAATGAAGCTCTGG + Intronic
1098154535 12:67583743-67583765 GTTACCTTGAAAATAAAATCGGG - Intergenic
1100500510 12:95169780-95169802 GTTGCTTTTCAAAGAGAGTCAGG + Intronic
1101123248 12:101605336-101605358 GTTATTTTTAAAACAAACTCAGG - Intronic
1101728413 12:107406791-107406813 GTTGCTTTGAAAAAAAACAAAGG + Intronic
1101778959 12:107818394-107818416 GATTCTTTGAAGAGAAACTTGGG + Intergenic
1102658579 12:114504866-114504888 TTTGCTTTGGAACAAAACTCAGG + Intergenic
1103042059 12:117703900-117703922 TTTACTTTGCAAAGAAACTGGGG + Intronic
1103097254 12:118142009-118142031 TTAGCTTTGAAAAGAAATTTGGG + Intronic
1104884226 12:132095754-132095776 GATTCTTTGAAGAGAAACTTGGG - Intronic
1106247789 13:27963586-27963608 GTTGCTTTGAAAAGAAACTCAGG - Intronic
1106473533 13:30078403-30078425 GTTACCTTGGAAAGAAACTGAGG + Intergenic
1107360706 13:39614976-39614998 TTTTCTTTGAAAATAAACTGTGG - Intergenic
1107631294 13:42345185-42345207 GGAGCTTTAAAAACAAACTCTGG + Intergenic
1108108720 13:47043855-47043877 CCTGCTTTGAAAAGATTCTCTGG - Intergenic
1108647375 13:52443866-52443888 CTTGCTTTTAACAGAAACACAGG - Intronic
1109573706 13:64226004-64226026 GTGGCTTTTAAAAGAGACTGAGG - Intergenic
1109589170 13:64454353-64454375 GTTTTTTTGAAAAGATATTCAGG + Intergenic
1109765215 13:66886465-66886487 GTGGCTTTGAAAAGCCACTGAGG + Intronic
1110439347 13:75509665-75509687 GTTGCTTTGAAAAAACAGTAAGG - Intergenic
1111422943 13:88041038-88041060 GATGCTTCTAAAAGCAACTCAGG - Intergenic
1111903293 13:94226566-94226588 GATGCTTAGAAAAGAGCCTCAGG - Intronic
1111981741 13:95023904-95023926 GTGGCTTTGAAAACTTACTCAGG + Intronic
1112447731 13:99480773-99480795 GATGCATTGAAATAAAACTCTGG - Intergenic
1114163966 14:20199812-20199834 GTTGCAATGAAAAGAAAAGCAGG - Intergenic
1114641650 14:24226774-24226796 GTAACTTTAAAAAGAAACTAAGG - Intronic
1116653071 14:47618861-47618883 ATTGCTTTGAAGAGAAAATTTGG - Intronic
1117313533 14:54552055-54552077 GTTGCTTTTAAAAAAATCTCGGG + Intergenic
1117757704 14:58992654-58992676 GTTGCTTGCCAAAGTAACTCAGG - Intergenic
1119144687 14:72301358-72301380 GTTGCTTTGAAATGTCAGTCTGG - Intronic
1120348360 14:83319736-83319758 TTTTCATTGAAAAGAAGCTCAGG - Intergenic
1121172532 14:91867087-91867109 GCTTCTAAGAAAAGAAACTCAGG - Intronic
1121673727 14:95734513-95734535 GATTCTTTGAAAAGAAATTTAGG + Intergenic
1121945332 14:98115660-98115682 GTTCCTTTAACAAGGAACTCAGG + Intergenic
1122509048 14:102250933-102250955 GCTGCTTGGAATAGACACTCCGG + Exonic
1125974264 15:43937300-43937322 ATTCCTTAGAAAATAAACTCCGG + Intronic
1126713582 15:51488619-51488641 GTTCCTTTGAAAAGAAGCTTTGG + Exonic
1126853255 15:52812177-52812199 TGTGCTTTGAAAAAAAACTTAGG + Intergenic
1127232051 15:57007150-57007172 TTTTCTTTAAAAAGAAACTGAGG - Intronic
1127669233 15:61179107-61179129 GGTGCCTTGAAAAGAACCTGAGG - Intronic
1127909554 15:63405132-63405154 GTTTCTTTAAAAAGAAATTTGGG + Intergenic
1127985863 15:64069907-64069929 CTTGCTTTGAAAAGAGGTTCTGG - Intronic
1128773058 15:70297224-70297246 TTTGCTTTGGAAAGAAGCACAGG + Intergenic
1130532635 15:84759115-84759137 GTTGCTTTTATAAGCAACTGTGG - Intronic
1130532636 15:84759120-84759142 GTTGCTTATAAAAGCAACTGTGG + Intronic
1130792588 15:87171390-87171412 GTTTCTTTGAAAATGAACTGAGG + Intergenic
1131372775 15:91897152-91897174 GTTGCTTTTAAAATAAAGACAGG + Intronic
1131606177 15:93905047-93905069 GTGACTTTGAAAAGAAATACTGG + Intergenic
1131697118 15:94889877-94889899 GTTGGTTAGCAAAGAAAATCTGG - Intergenic
1131805828 15:96121494-96121516 GTGGCTTTGACGAAAAACTCCGG + Intergenic
1132276227 15:100566645-100566667 GTTCCTTTAAGAAGTAACTCTGG + Intronic
1132304591 15:100802185-100802207 TTTTCTTTGACAAGAAACCCAGG + Intergenic
1133354296 16:5124627-5124649 CTTGCTTAAAAAAGAAACACAGG - Intergenic
1136091170 16:27921075-27921097 TTTGCTTTGAAAAGTGGCTCTGG - Intronic
1138406237 16:56796669-56796691 TTTGCTTTTTAAAGAAACTGTGG - Intronic
1138973681 16:62176762-62176784 GTTCCTCAGAAAAGAAACTGAGG - Intergenic
1140101710 16:71923388-71923410 GTTGCTTATAAAAGAGGCTCAGG - Intronic
1140622371 16:76751186-76751208 GTCACTTTGCAAAGCAACTCAGG + Intergenic
1141932017 16:87211773-87211795 GATTCTTTGAAGGGAAACTCAGG + Intronic
1143451749 17:7040870-7040892 GTGGCTTAGAAAAGAAATTGAGG + Intergenic
1143786836 17:9261872-9261894 GTGTCTTTGAAAAGACAGTCAGG + Intronic
1144072123 17:11683802-11683824 GATGCTTTGAAAAGAACTGCTGG + Intronic
1146526987 17:33575545-33575567 GGTGCTTTGAAGAGTTACTCAGG + Intronic
1148367459 17:47067206-47067228 GTTGCTTTTGAAGGAAACTTTGG + Intergenic
1150573287 17:66407010-66407032 GTTGCTTTAAAATGAAAGCCTGG + Intronic
1150969648 17:70012574-70012596 GTGGTTTTAAAAAGAGACTCAGG - Intergenic
1153042757 18:829272-829294 TTTGATTTGAAATGAAACTTTGG + Intergenic
1155012031 18:21788600-21788622 GTTGCTATGACTAGAACCTCTGG - Intronic
1156451207 18:37267323-37267345 GATACTTTGGCAAGAAACTCAGG + Intronic
1157990687 18:52492189-52492211 ATTGCCTTGATAAGAAACTTGGG + Intronic
1158031505 18:52970953-52970975 GTTCTTTTGAATTGAAACTCTGG + Intronic
1158106738 18:53893987-53894009 GTTGCTTTGAAAGAACAATCAGG + Intergenic
1158341208 18:56468554-56468576 GTTGCAATGAAAAGAAACAGTGG - Intergenic
1159047284 18:63381407-63381429 GCTGCCATGGAAAGAAACTCAGG + Intergenic
1160545373 18:79649282-79649304 GTTACTTTGAAATAAATCTCAGG + Intergenic
1162241166 19:9355656-9355678 GTTGCTTTGATTAGAAAGTTTGG + Intronic
1162602333 19:11678239-11678261 GTTGTTTTCAAAAGAAAGTGTGG + Intergenic
925243146 2:2351827-2351849 ATTACTTTGTAAATAAACTCAGG - Intergenic
926177655 2:10610515-10610537 TTTTCTCTGAAAAGGAACTCAGG - Intronic
926385656 2:12333346-12333368 GTGCCTTTGAAATTAAACTCAGG - Intergenic
927443450 2:23136907-23136929 ATTGCTTTGTAAAGGAACCCTGG + Intergenic
930403747 2:50927400-50927422 GTTTCTTTAAAAATAAACTCTGG - Intronic
930445448 2:51465487-51465509 GCTGCTTTAAATAGAAAGTCAGG + Intergenic
930852635 2:55976796-55976818 GTTGCATTAAAAAGAAATACAGG - Intergenic
931061988 2:58540558-58540580 ATTGATTTGAAAATAAAGTCTGG + Intergenic
931718028 2:65044737-65044759 GATTCTTTGAAGAGAAACTTGGG + Intergenic
931798240 2:65732600-65732622 GTGGCTTTGGAAAGGAACACTGG + Intergenic
931928122 2:67097584-67097606 GTTACTTAGACCAGAAACTCTGG - Intergenic
933512277 2:83255957-83255979 GATGCTTTAAAAAAAAAATCAGG - Intergenic
933742870 2:85548528-85548550 GTTGCTTAGGAAAGAACCCCCGG + Exonic
934928515 2:98399631-98399653 GGTGCTTTGAGTAGAAACTAAGG + Intergenic
935371045 2:102347288-102347310 GTTTCTGTGGAAAGAAACTATGG - Intronic
935756906 2:106283488-106283510 TTTGCTTTTAAAAGTACCTCCGG + Intergenic
935929523 2:108108800-108108822 GTTGCTTTGAAGAGCAGCTGAGG - Intergenic
936112659 2:109677548-109677570 TTTGCTTTTAAAAGTACCTCTGG - Intergenic
936711697 2:115139222-115139244 TTATCTTTGAAAAGCAACTCAGG + Intronic
936716110 2:115189546-115189568 GATTCTTTGAAGAGAAACTTGGG + Intronic
937411842 2:121683413-121683435 GATTCTTTGAAGAGAAACTTAGG + Intergenic
938213078 2:129484966-129484988 GTTGCTGTGGAAATAAAATCTGG + Intergenic
938477417 2:131628892-131628914 CTTGCTTTAAAAAAAAAGTCTGG - Intergenic
940499182 2:154473588-154473610 GTTGCTTTGCAATGAAATGCAGG - Intergenic
940524004 2:154788776-154788798 TTTTTTTTAAAAAGAAACTCAGG + Intronic
940659207 2:156525333-156525355 TTTGCTATGACAAGATACTCCGG + Intronic
941835801 2:170019290-170019312 CTTGCTATGAAAAGCAAATCTGG - Intronic
942216986 2:173730882-173730904 GTTGCTTTGAGAAGAAAGAAAGG + Intergenic
943737713 2:191375311-191375333 ATTGTTTTTAAAAGAAATTCTGG + Intronic
947779378 2:232743788-232743810 GGTGCTATGAAAAGAAACTGAGG - Intronic
948109667 2:235444624-235444646 GATTCTTTGAAGAGAAACTTGGG + Intergenic
1169020744 20:2328989-2329011 GCTGGTTTCAAAAGAAACTCTGG - Intronic
1169467983 20:5858180-5858202 ATTGCTAGTAAAAGAAACTCTGG + Intronic
1170035181 20:11982009-11982031 GTTGTTCTGAAAAGTAACTAAGG - Intergenic
1170293820 20:14802165-14802187 CATGCATTAAAAAGAAACTCAGG - Intronic
1171036760 20:21718702-21718724 TTTCTTTTGAAAAGAAACCCAGG - Intergenic
1171805349 20:29673923-29673945 GTTTCTTTTAATGGAAACTCAGG + Intergenic
1172010094 20:31841572-31841594 GTTGCTATGATTAAAAACTCTGG + Intergenic
1173450748 20:43161691-43161713 GGTGCTTTTAAAAAAAAATCAGG - Intronic
1175907498 20:62388073-62388095 GGTGCTCTGAGAAGACACTCAGG + Intronic
1180915204 22:19480882-19480904 TTTACCTTGAAAAGAAACTGAGG - Intronic
1181714723 22:24716330-24716352 GATTCTTTGAAGAGAAACTTGGG - Intergenic
1182087604 22:27572185-27572207 CTTGCTGGGAAGAGAAACTCTGG - Intergenic
1185115233 22:48930591-48930613 GCTGCTTTGAAAGGAGACTAGGG - Intergenic
951276241 3:20689666-20689688 GTAGCTTTGAAAAGTAATTTAGG - Intergenic
953539988 3:43809696-43809718 GTTGTTTTGAAAAGCAATTCTGG + Intergenic
955076999 3:55623398-55623420 GATTCTTTGAAGAGAAACTTGGG - Intronic
955841102 3:63113737-63113759 GTTGTTGTGATTAGAAACTCAGG - Intergenic
957058196 3:75460307-75460329 CTTGCTTAAAAAAGAAACACAGG - Intergenic
957651285 3:83008568-83008590 GTTGCCTTGAAAACAATCTCAGG - Intergenic
959644996 3:108689356-108689378 TTTGCTTTTGAAAGATACTCAGG + Intronic
960842751 3:121977147-121977169 GTTGCTGTGGAAAAAAACTGAGG - Intergenic
961000831 3:123372759-123372781 GCTGCTATGAGAAGAAACCCTGG + Intronic
961295251 3:125879386-125879408 CTTGCTTAAAAAAGAAACACAGG + Intergenic
961890654 3:130127773-130127795 CTTGCTTAAAAAAGAAACACAGG - Intergenic
963208327 3:142659372-142659394 TTTGCTTTGTAAAGAAACATAGG + Intronic
963235130 3:142948260-142948282 GTTTTTTTTAAAAGATACTCTGG + Intergenic
963493161 3:146026719-146026741 GTTCTTTTGAAAAAAAAATCTGG + Intergenic
964015169 3:151936385-151936407 TGTGCCTTGAAAAGAAACCCTGG + Intergenic
964879439 3:161407281-161407303 TTTGCTTTGAAAAGAATTTTTGG - Intergenic
966035929 3:175414232-175414254 GTTTCTTTGAGAAAAAACGCAGG + Intronic
969002038 4:3990194-3990216 CTTGCTTAAAAAAGAAACACAGG - Intergenic
969751966 4:9118312-9118334 CTTGCTTAAAAAAGAAACACAGG + Intergenic
969811877 4:9654615-9654637 CTTGCTTAAAAAAGAAACACAGG + Intergenic
971103974 4:23501036-23501058 CTTGCTTTGGAATGGAACTCTGG + Intergenic
971904734 4:32711707-32711729 GTAGTTTTTAAAACAAACTCTGG - Intergenic
972654775 4:41054077-41054099 GTTGGCTTGAAAACAACCTCAGG + Intronic
972801891 4:42484930-42484952 GATTCCTTGACAAGAAACTCAGG + Intronic
973005834 4:45005866-45005888 TTTTCTTTGAAATGAAAATCTGG - Intergenic
973802432 4:54492484-54492506 TTTGTTTTGAAAAGAAAATAAGG - Intergenic
974235328 4:59173509-59173531 GTTGATTTTACAAGAAGCTCTGG - Intergenic
974501478 4:62710088-62710110 GTTGTTTGGAAAAAAAAATCTGG + Intergenic
977149479 4:93491713-93491735 CTTGTTTGGAAAAGAAAATCTGG + Intronic
977350071 4:95872984-95873006 GTTTCTTTGAAGAGAAAGTATGG + Intergenic
979403330 4:120278235-120278257 GAAGCTTTGAATAGAGACTCTGG - Intergenic
980804930 4:137800201-137800223 GTTGCTTAGACAAGAAACATTGG + Intergenic
981205861 4:142039497-142039519 ATTGCTTTGAAGAGAAATTTCGG + Intronic
982055996 4:151549342-151549364 GATTCTTTGAAGAGAAACTTGGG + Intronic
982417236 4:155149635-155149657 ATTGTTTTGTAAAGCAACTCTGG + Intergenic
983191365 4:164756994-164757016 ATTCCTTTGAAAAAAATCTCTGG - Intergenic
984217139 4:176927780-176927802 GTTTCATAAAAAAGAAACTCTGG - Intergenic
984602516 4:181744805-181744827 GTTGCTCAGACAAAAAACTCTGG - Intergenic
986552739 5:8976712-8976734 GTTTCTTTTAAGAGAAACTAAGG - Intergenic
986785958 5:11114019-11114041 GATGCTTGGAATAGAAAATCAGG - Intronic
987086977 5:14479722-14479744 ACTGCTTTGAAAAACAACTCAGG + Intronic
987161407 5:15147872-15147894 GTTACTGTGTAATGAAACTCTGG + Intergenic
987480819 5:18455104-18455126 GGTGCTTGGGAAAGAAACTGAGG - Intergenic
988920634 5:35938566-35938588 GTTGCTTCGAACTGAAACTATGG + Intronic
989507484 5:42244104-42244126 GTTGCTTTGAAATGCAACATTGG + Intergenic
990028429 5:51224906-51224928 GTTGTATTGATAAGAAGCTCTGG - Intergenic
990303733 5:54474784-54474806 GTTGCCTCAAAAAGAAACCCTGG + Intergenic
990906140 5:60805531-60805553 GGTGCTTTGAAAAGATTGTCTGG + Intronic
991277613 5:64868424-64868446 TTAGCTTTGAAAACAAACTTAGG - Intronic
992349427 5:75913681-75913703 GTTGTGTTGAAAAGTAACTGGGG + Intergenic
992522569 5:77570407-77570429 GTTGCTTACAAATGAAACTAGGG + Intronic
993711643 5:91230921-91230943 CTTGCTGTGAAAAGAGACTGAGG - Intergenic
993818900 5:92589606-92589628 ATTACTTGGAAAAGAAGCTCAGG - Intergenic
995139023 5:108713261-108713283 GATGCTTTGAACAAGAACTCTGG - Intergenic
996463653 5:123774786-123774808 ATTGCTCAGAAAATAAACTCTGG - Intergenic
998355916 5:141536549-141536571 GCTGCTGTGAAAAGAAAAACAGG + Intronic
998605128 5:143625699-143625721 ATAGATTTCAAAAGAAACTCTGG - Intergenic
999237850 5:150109920-150109942 GATTCTTTGAAGAGAAACTTGGG - Intronic
999629214 5:153552915-153552937 GTTGTTTGGAAAAGAAAAGCTGG - Intronic
999729077 5:154462221-154462243 TTTGCTTTCTAAAGCAACTCAGG - Intergenic
1000286791 5:159833813-159833835 GATGCTTTGCAAAGTAACTTGGG + Intergenic
1000358033 5:160419580-160419602 GTTGCTATGAAAAGAATACCAGG + Intronic
1001665364 5:173429049-173429071 TCTGCTTTAAAAAAAAACTCAGG + Intergenic
1001747914 5:174106128-174106150 ATTGTTTTGGAAAGAAATTCAGG + Intronic
1003609766 6:7600900-7600922 GTCCCTTTGAAAATAAACTATGG - Intronic
1004058596 6:12167137-12167159 GTTTCTGTGAAAGGAAAATCAGG - Intergenic
1004476334 6:15976429-15976451 TTTGCTCTGAAAAAAGACTCAGG - Intergenic
1004827923 6:19443913-19443935 ATTTCTTTGAAAAAAATCTCAGG - Intergenic
1005344752 6:24878161-24878183 GATTCTTTGAAGAGAAACTTGGG + Intronic
1006760081 6:36452834-36452856 GTTGTTTTAAAAAGAAAATAAGG - Intronic
1007161337 6:39793644-39793666 CTGGCTTTGCAAAGAAACTCAGG - Intronic
1007198517 6:40084845-40084867 GTTGGTTTGATAAAGAACTCTGG + Intergenic
1010183819 6:73119935-73119957 GTTGTTTTGAAAAGAAGCTCTGG + Intronic
1010311778 6:74395221-74395243 GTATCTCTGAAAAAAAACTCAGG - Intergenic
1011410117 6:87059037-87059059 CTTGCTCGGAGAAGAAACTCAGG + Intergenic
1011424710 6:87213817-87213839 GATTCTTTGAAGAGAAACTTGGG + Intronic
1011704700 6:89989433-89989455 ATAGCTTTGAAAATAAACCCAGG + Intronic
1012289181 6:97430633-97430655 GTTTCTTTGAAAAGAAAAACTGG - Intergenic
1013182471 6:107729836-107729858 GTTGTCTAGAAAAGAAACTATGG + Intronic
1013707042 6:112848767-112848789 ATTGCATTGAAATGATACTCTGG - Intergenic
1013879456 6:114878120-114878142 GTTGCTTAGATCAGAAACCCTGG + Intergenic
1014155966 6:118110124-118110146 GTGGCTTTTATAAGAACCTCTGG + Intronic
1014213502 6:118731037-118731059 GTTGCTCTGAGCAGGAACTCTGG - Intergenic
1014463894 6:121731002-121731024 GATTCTTTGAAGAGAAACTTGGG + Intergenic
1016964215 6:149703336-149703358 ATAGCTTGGAAAATAAACTCAGG - Intronic
1018017503 6:159725880-159725902 GTTGCTTTGGAATGAGTCTCAGG - Exonic
1018481393 6:164194659-164194681 TTTTCTATGAAAAGTAACTCTGG - Intergenic
1019569406 7:1703757-1703779 TTTGCTTTGGACTGAAACTCAGG - Intronic
1020745982 7:12078109-12078131 GTTGCTTTGACAAGAATAGCTGG + Intergenic
1021228030 7:18051337-18051359 GATGCTTTAAAAAGAATTTCTGG + Intergenic
1021568394 7:22037853-22037875 GATGGTTTGAAATGAAATTCTGG - Intergenic
1021915316 7:25425832-25425854 GTTGCTTCGTATATAAACTCGGG + Intergenic
1022023794 7:26426959-26426981 GTCTCTTTAAAAAGAGACTCTGG + Intergenic
1022658383 7:32342556-32342578 CTTGCTTTTAAAAGATAATCAGG + Intergenic
1022930288 7:35104442-35104464 GTGGCTTTGAAAAGTATTTCTGG - Intergenic
1026119901 7:67527771-67527793 GTTGCCTTGAGAAGAACCTCAGG + Intergenic
1026206927 7:68265746-68265768 GATTCTTTGAAGAGAAACTTGGG - Intergenic
1028270432 7:88781795-88781817 GTTCCTTTGAAAATATCCTCAGG + Intronic
1029826177 7:103196985-103197007 GTGGCTTTGAAAAGTATTTCTGG - Intergenic
1030561641 7:111094230-111094252 GTTTTTTTAAAACGAAACTCCGG - Intronic
1031069213 7:117143195-117143217 GTTCCTTTGAAAGTAGACTCTGG + Intronic
1031291093 7:119936131-119936153 GTTGCTTTTAAAAGAGAATATGG + Intergenic
1031291653 7:119945008-119945030 ATTGCTTTGGAAAGAAATTTTGG - Intergenic
1032353841 7:131190871-131190893 GTTGCTGGAAAAAGCAACTCAGG + Intronic
1032576614 7:133061196-133061218 CATGCTTTGGAAAGAAACTAGGG + Intronic
1033246084 7:139717354-139717376 GTTGCTTTCTACTGAAACTCAGG + Intronic
1033973995 7:147076980-147077002 GTTGTGTTTTAAAGAAACTCAGG - Intronic
1034380222 7:150685764-150685786 GTTTCTTTGAACAGTAAATCAGG + Exonic
1034652714 7:152704541-152704563 GGTTCTTTGAAGAGAAACTGGGG - Intergenic
1036104204 8:5822903-5822925 GATTCTTTGAAGAGAAACTTGGG + Intergenic
1036105267 8:5831081-5831103 GATTCTTTGAAGAGAAACTTGGG + Intergenic
1037743617 8:21626522-21626544 TTTGCTTTGAAAAGATAGTTTGG + Intergenic
1038299352 8:26327745-26327767 GTGCCTTTGAAAAGAAATTTGGG + Intronic
1038913330 8:31992032-31992054 TTTGCTTTTAAAAGAAAATGAGG + Intronic
1042415346 8:68511669-68511691 GATTCTTTGAAGAGAAACTTGGG + Intronic
1043544361 8:81298515-81298537 TTTGCTTTTAAAAGAAATGCTGG - Intergenic
1043966708 8:86485726-86485748 ATTTCTTGGGAAAGAAACTCAGG - Intronic
1045909087 8:107384246-107384268 GTTGATTTGTTAAGATACTCAGG + Intronic
1046509656 8:115186092-115186114 ATTGCTGTGAAAAGAGACTGAGG - Intergenic
1046648545 8:116811702-116811724 GCTGATTGGAAAGGAAACTCTGG + Intronic
1047148396 8:122232114-122232136 GATTCTTTGAAGAGAAACTTGGG - Intergenic
1049006919 8:139861609-139861631 GATTCTTTGAAAAGAAACTTGGG + Intronic
1049295936 8:141837857-141837879 GTTTCCTTAATAAGAAACTCGGG - Intergenic
1051394724 9:16607374-16607396 GTGGCATTTAAAAGAAACACAGG + Intronic
1052648758 9:31272891-31272913 GATTCTTTGAAAAGAAATTTAGG - Intergenic
1055193205 9:73552974-73552996 GTTGCTTTCATTAGAAACTGAGG + Intergenic
1055401833 9:75932456-75932478 GTTCCATTGAAATGAAACTGTGG - Exonic
1056414262 9:86361134-86361156 GATTCTTTGAAAAGAAATTTAGG + Intergenic
1057504901 9:95626043-95626065 ATTGACTTGAAAAGAAACTCGGG + Intergenic
1058542140 9:106022505-106022527 GTTGCTTTATGAAGAAACTGAGG - Intergenic
1058858939 9:109095382-109095404 GTTGCTATAAAAAGAAATGCTGG + Intronic
1059215866 9:112561552-112561574 ATTTCTCTTAAAAGAAACTCGGG + Intronic
1061346804 9:130032921-130032943 GTTGCTTTGGACAGGAAATCTGG - Intronic
1187833592 X:23407941-23407963 GTAGGTGTGAAAAGAAAATCTGG + Intergenic
1188164808 X:26848758-26848780 GTTGCTAAGAGAAGTAACTCAGG - Intergenic
1188399053 X:29721704-29721726 GTTGATTATAACAGAAACTCAGG + Intronic
1188930107 X:36098475-36098497 GTTGCTCTGAACAGCACCTCTGG - Intronic
1189691139 X:43617843-43617865 TTTGCTTCCAAAAGAAACCCAGG + Intergenic
1190237183 X:48625486-48625508 GTGTCTTTGAAAATAAACTTTGG + Intergenic
1192875584 X:75226087-75226109 GTTGCTTTGGACAGAAACCTTGG + Intergenic
1192965253 X:76170386-76170408 CTTGCTCTGAATAGCAACTCAGG - Intergenic
1193608080 X:83593297-83593319 TTAGCTTTAAAAAAAAACTCAGG + Intergenic
1194693664 X:97018126-97018148 GTTGGTGTGAAAGGAAACTTGGG - Intronic
1196805436 X:119580136-119580158 CTGGCTTTGAAAAGAAAATAGGG + Intronic
1197072507 X:122316150-122316172 GTTAATTTGAAAAGATGCTCTGG + Intergenic
1200311846 X:155086269-155086291 GTTGCTGTTAAAAGCCACTCTGG - Intronic