ID: 1106248576

View in Genome Browser
Species Human (GRCh38)
Location 13:27967874-27967896
Sequence AGCTGCTGTCGCTGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106248576_1106248584 22 Left 1106248576 13:27967874-27967896 CCTTCTTCCCAGCGACAGCAGCT 0: 1
1: 0
2: 2
3: 25
4: 259
Right 1106248584 13:27967919-27967941 GTACCTTGAATTGGCCCGAGTGG 0: 1
1: 0
2: 0
3: 1
4: 29
1106248576_1106248583 13 Left 1106248576 13:27967874-27967896 CCTTCTTCCCAGCGACAGCAGCT 0: 1
1: 0
2: 2
3: 25
4: 259
Right 1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106248576 Original CRISPR AGCTGCTGTCGCTGGGAAGA AGG (reversed) Intronic
901683261 1:10928661-10928683 AGCTGCTGTTGCTGAGCACAGGG + Intergenic
903304471 1:22402920-22402942 GGCTGCTGGGGCTGGGCAGATGG - Intergenic
904200511 1:28816403-28816425 AGGAGCTGTGGCTGGGAAGCAGG + Intronic
904276686 1:29389512-29389534 AGCTGCTGTGCCAGGGAGGAGGG + Intergenic
904758130 1:32780663-32780685 ACCTTCTGTCTCTGGGAAAAAGG + Intronic
905661582 1:39730366-39730388 AGGTGCTGCGGCTGAGAAGATGG - Intronic
905806551 1:40881521-40881543 AGCTGTTGTCACTGGGAGCAGGG - Intergenic
906701331 1:47860299-47860321 AGCTGTGGTAGCTTGGAAGAGGG - Intronic
908351271 1:63287508-63287530 AGCTGGTGTTGCTTGTAAGAGGG - Intergenic
913166677 1:116193679-116193701 AGTTGCTATCACTGGGAAGAAGG + Intergenic
915326084 1:155081942-155081964 CGCCGCTGTCGCAGGGAGGAGGG + Intronic
915681107 1:157582783-157582805 AGCTGTTGTGGCTGGGAAGCTGG - Intronic
916859163 1:168784769-168784791 AGCAGATGTGGCTGGAAAGAGGG - Intergenic
918883815 1:190164384-190164406 AGCTGCTGTCATTGGTAAGCAGG + Intronic
920492402 1:206427380-206427402 GGCTGCTGTAGCTGGAAAGCTGG + Intronic
922511912 1:226175719-226175741 AGCAGCTGCCTCTGGGGAGAAGG + Intronic
922720177 1:227896310-227896332 AGCTGAAGCTGCTGGGAAGAGGG - Intergenic
924193447 1:241579659-241579681 AGTTGCTGTCTCTGAGGAGAAGG - Intronic
1062856721 10:783511-783533 AGCGGCAGTCGCTGTGGAGACGG - Intergenic
1063344398 10:5297771-5297793 AGCTGCTTTCACTGGGAGGGCGG + Intergenic
1063439604 10:6062017-6062039 TGGTTCTGTGGCTGGGAAGAGGG + Intronic
1064573133 10:16716470-16716492 TGCTGCTTTCTCTGGGAAGTCGG + Intronic
1067090343 10:43263145-43263167 AGATGCTGTGGCTGGGTAGAGGG + Intronic
1067432945 10:46255890-46255912 AGTTGCTGGCCCTGGGAAGCCGG - Intergenic
1067523180 10:47022989-47023011 AGCTGCCGTGGCTGGCAAGGGGG + Intergenic
1070507841 10:77131024-77131046 AGTGGCTGACCCTGGGAAGAAGG + Intronic
1073897160 10:108175847-108175869 AGATGCTGGGGCTGGGAAGAGGG - Intergenic
1074432786 10:113408121-113408143 AGCTGCTGTTGCTTTGAATAGGG + Intergenic
1074495627 10:113977892-113977914 AGGTCATGTGGCTGGGAAGAGGG - Intergenic
1074557799 10:114507984-114508006 AGCTGCTTTGGCTGGGAAGCTGG - Intronic
1075659351 10:124182565-124182587 GGCAGCTGACGCTGGGGAGATGG - Intergenic
1076223189 10:128751393-128751415 TGCGGCTGTTGCTGGGAAGCTGG - Intergenic
1076425523 10:130364716-130364738 AGCTGCAGAAGCTGGGAAGAGGG + Intergenic
1076759042 10:132590987-132591009 GGCTGCTGTCACAGGGAAGGTGG + Intronic
1077264911 11:1643635-1643657 GGCTGCAGTCTCTGGCAAGACGG + Intergenic
1079274097 11:19017581-19017603 AGCTGCAGTTGCTAAGAAGACGG + Intergenic
1080406911 11:31987591-31987613 GGCTGGGGGCGCTGGGAAGAGGG + Intronic
1080757052 11:35211354-35211376 AGCTGAGGTCACTGGGATGAAGG - Exonic
1081136346 11:39444214-39444236 AGGTGCTGCAGCTGAGAAGATGG - Intergenic
1081611946 11:44568205-44568227 GGCTGCAGTGACTGGGAAGAAGG + Intronic
1083136132 11:60678341-60678363 AGCTGGTGTGGCTGGGAAGCAGG + Intergenic
1083167556 11:60900497-60900519 CGCTGCTGTCTCTGTGAAGTGGG - Intronic
1084191373 11:67500457-67500479 AGCTGCGGTGGCAGGGAAGCAGG - Intronic
1086142184 11:83511686-83511708 AGCTTCCCTCTCTGGGAAGAGGG + Intronic
1087855943 11:103091952-103091974 TGCTGCTGTCTCTGGGAACTGGG - Exonic
1088682283 11:112253647-112253669 AACTGCTGTCATTGGGAAGCTGG + Intronic
1088906028 11:114156145-114156167 GGCTGCAGTCCCTGGGCAGAGGG + Intronic
1089830381 11:121322088-121322110 AGTGGCTTTGGCTGGGAAGAGGG + Intergenic
1090194130 11:124800377-124800399 AGCGGCGGCCGCTTGGAAGATGG - Exonic
1093454042 12:19347068-19347090 AGCTGCTATCACTGGGCAGAGGG - Exonic
1096368468 12:51048338-51048360 CGCTTCTCTCGCTGTGAAGATGG + Exonic
1097198931 12:57261779-57261801 AAGTGCTGTCACTGGGCAGAGGG - Intronic
1099352552 12:81591599-81591621 AGCTGGTGTAGCTGGGACGTAGG - Intronic
1101320372 12:103668377-103668399 ATCTGCTGTGGCATGGAAGAGGG + Intronic
1102027157 12:109720159-109720181 AGCTGCTGCGGCTGGGATGCTGG - Intronic
1102387935 12:112526633-112526655 AGCTGCTGCCCTTGGAAAGACGG - Intergenic
1104522473 12:129488086-129488108 AGCTGCTCTCGCTTCCAAGATGG - Intronic
1104918329 12:132277950-132277972 AGCTGCTGGCCCTGGTCAGAGGG - Intronic
1105401444 13:20099625-20099647 AGCTGCTGCCGCTAGGATGGAGG - Intergenic
1106248576 13:27967874-27967896 AGCTGCTGTCGCTGGGAAGAAGG - Intronic
1106512774 13:30425525-30425547 AGCGACTGTCTTTGGGAAGAAGG - Intergenic
1108847400 13:54694378-54694400 CCCAGCTTTCGCTGGGAAGAAGG + Intergenic
1110559788 13:76898519-76898541 AGCTGCAGTGGCTGGGATGCAGG + Intergenic
1110615216 13:77534227-77534249 GGCTGCTTCCGCTGGGAGGAAGG - Intergenic
1113372281 13:109734299-109734321 TGCTGCGGCCGCTGGGAAGAGGG + Intergenic
1115137084 14:30123300-30123322 AGCTGCTGTCATTGGGAGGATGG - Intronic
1117514802 14:56490101-56490123 AGCTGCTGAAGCTTGGTAGATGG - Intronic
1118323111 14:64764817-64764839 AGGGGCTGTTGCTGGGAAAAAGG + Intronic
1118494582 14:66295642-66295664 AGCTGTTGTTGCCGGGAAGCTGG - Intergenic
1119633394 14:76253777-76253799 AGCTGGTGTCCCTGGGAAGATGG - Intronic
1120171120 14:81247955-81247977 GGCTGCTGACCCTGGGAGGAGGG + Intergenic
1122950641 14:105042590-105042612 CGCTCCTGTCGCTGGGAAGCCGG - Intergenic
1123462026 15:20481704-20481726 AGCTATTGCCTCTGGGAAGAAGG + Intergenic
1123656030 15:22518684-22518706 AGCTATTGCCTCTGGGAAGAAGG - Intergenic
1124309940 15:28613857-28613879 AGCTATTGCCTCTGGGAAGAAGG - Intergenic
1125603087 15:40926179-40926201 CGCTGCGGTCGCTGCGGAGAAGG - Intergenic
1128284147 15:66422161-66422183 AGTTGCTGTGGCAGGGTAGAAGG - Intronic
1129188191 15:73923109-73923131 AGCTGCTGCCTCTGGAAAGCGGG - Intergenic
1129203236 15:74018661-74018683 AGCTGCTGTGAATGGGAAGATGG + Intronic
1129230162 15:74192626-74192648 AGCTGCTGGCCCAGGGAAGGTGG - Intronic
1130623731 15:85491328-85491350 ATCTGCTGACCCTGGGCAGATGG + Intronic
1131184297 15:90262143-90262165 AGCAGCAGTCTCTTGGAAGAGGG - Exonic
1131250631 15:90827958-90827980 AGCTGCTTTGGCTGTGAAAAGGG - Intergenic
1132407666 15:101553911-101553933 AGTTACTGTCTCTGGGAATAAGG + Intergenic
1132571943 16:648001-648023 TGCGGCAGGCGCTGGGAAGAAGG - Intronic
1132887423 16:2188838-2188860 AGCTGCAGGGGCTGGGAAGGGGG - Intronic
1133346149 16:5071896-5071918 CGCTGCTGCTGCTGGGAGGATGG + Exonic
1136228181 16:28872684-28872706 CCCTGCTGTCGCTGGGAGGATGG - Exonic
1136242445 16:28952329-28952351 AGCTCCTGTGGCTGGGATGCAGG - Intronic
1136289735 16:29264360-29264382 AGCTGCCGGGGCTGGGCAGAGGG - Intergenic
1139383311 16:66548328-66548350 AGCTCCAGTGGCTGGGAAGGGGG - Intronic
1139852987 16:69961899-69961921 GGCTGCCAGCGCTGGGAAGAGGG + Intronic
1139881958 16:70184807-70184829 GGCTGCCAGCGCTGGGAAGAGGG + Intronic
1140370552 16:74410699-74410721 GGCTGCCAGCGCTGGGAAGAGGG - Intronic
1141020993 16:80496346-80496368 AACTGCTGCCTCTGGGAAGGGGG + Intergenic
1141355882 16:83346302-83346324 AGCTGCTTTTGATGGAAAGATGG + Intronic
1141852158 16:86653845-86653867 AGCTGCTGCAGCCGGGAAGATGG - Intergenic
1142095615 16:88237836-88237858 AGCTGCCGGGGCTGGGCAGAGGG - Intergenic
1142749472 17:1978498-1978520 GGCTGCTGTTGCTGGGAGGCCGG - Intronic
1143223761 17:5282696-5282718 GGCTGCCGTCGCTGGGGAGGGGG + Intronic
1143585782 17:7849486-7849508 AGCCTCTGTCCCTGGAAAGAAGG + Exonic
1143799558 17:9367386-9367408 AGCAGCTGTCCTTGGCAAGAAGG - Intronic
1144421150 17:15099850-15099872 AGCTTGTGCCACTGGGAAGATGG - Intergenic
1144729109 17:17516678-17516700 AGGGGCTGTGGCTGGGAAGGAGG - Intronic
1144829764 17:18124614-18124636 AGCTGCTCTGGCTGGGAGGGTGG - Intronic
1144890804 17:18492950-18492972 AGCTGATGCCTCTGGGATGAGGG + Intronic
1145141419 17:20451368-20451390 AGCTGATGCCTCTGGGATGAGGG - Intronic
1145783143 17:27577294-27577316 AGCTGCTGTCTCTGGGAGCCTGG + Intronic
1146270086 17:31479279-31479301 ATCTGATGTGTCTGGGAAGAGGG + Intronic
1147798470 17:43063683-43063705 AGCTGGTGATGCTGGGAAAATGG - Intronic
1150526353 17:65926841-65926863 AGGTGCTGTCCCTGGCATGAGGG - Intronic
1151230477 17:72681398-72681420 AGCTGCTGTGGGTGGAAAGTTGG + Intronic
1152053138 17:77998169-77998191 AGCAACTGTCGGTGGGAGGAAGG - Intergenic
1152312051 17:79557460-79557482 AGCTGCAGTCTCTGAGATGATGG + Intergenic
1152809485 17:82374824-82374846 AGCTGCTGGCGCTGGGCACCTGG + Exonic
1154940672 18:21110932-21110954 CGCTGCTGGTGCTGGTAAGAGGG - Exonic
1156985517 18:43346240-43346262 AGCTGCTGCCACTGAGATGAAGG + Intergenic
1157565278 18:48675475-48675497 GGCTGCTGGCGCTGGGACCAGGG - Intronic
1158481630 18:57826522-57826544 AGTTGCTGTCGCATGGTAGATGG - Intergenic
1160142277 18:76336252-76336274 AGCTGCTGTCCCTGGCAAGCAGG - Intergenic
1160235483 18:77082740-77082762 AGCTGCTGCTGCAGGGAGGAAGG - Intronic
1162293043 19:9792972-9792994 AGCTGCGGTTCCTGGGAAGGGGG + Intronic
1162437480 19:10670788-10670810 AGCTGTTGTCTCTGGGCAGTGGG - Intronic
1162876343 19:13623641-13623663 AGTTTCTCTTGCTGGGAAGAAGG - Intronic
1163475510 19:17523725-17523747 GGCTGATGTTGCTGGGGAGAGGG - Intronic
1164437623 19:28245150-28245172 AAGAGCTGTCCCTGGGAAGAAGG + Intergenic
1164540233 19:29116421-29116443 AGCTGCTGGCTCTGACAAGAGGG + Intergenic
1165783010 19:38444656-38444678 ATCTGCTCCCGCTGCGAAGAGGG + Exonic
1166562873 19:43744923-43744945 AGCTGCTGGAGCTGGAATGAGGG + Intronic
1167018939 19:46860524-46860546 AGCTGCTGGCGCAGGGCGGAGGG - Intergenic
1167856768 19:52248299-52248321 AGCAGCTGTCCCTGGTAAGCTGG + Intergenic
925386787 2:3467603-3467625 AGATGCTGGATCTGGGAAGAAGG + Intronic
925511514 2:4631145-4631167 ATTTGCTGGCGCAGGGAAGAGGG + Intergenic
929958501 2:46478873-46478895 AGCTGGTGTCCCTGGAAAGCGGG - Intronic
931634940 2:64332570-64332592 AGTTGGTGGGGCTGGGAAGAGGG + Intergenic
931706731 2:64952372-64952394 ATCTCCTGTCGCTGTGAAAATGG + Intergenic
931808048 2:65827148-65827170 AGCTCCTGTCGCTGGCATAAAGG - Intergenic
932426373 2:71637931-71637953 AGCTGGTGTGGCCGGGAGGAAGG + Intronic
933001415 2:76928604-76928626 AGCTGCTGGTGCTGGTGAGATGG + Intronic
933764842 2:85699659-85699681 GGCTACTGTTGGTGGGAAGAGGG + Intergenic
934148145 2:89116529-89116551 AGGTGCTGTAGCTGAGGAGATGG - Intergenic
934221142 2:90084082-90084104 AGGTGCTGTAGCTGAGGAGATGG + Intergenic
936026282 2:109033463-109033485 AGGTGCTGTAGCTGAGAAGATGG + Intergenic
936039285 2:109137476-109137498 TGCTGCTGTGGCTAGGACGATGG + Intronic
936491928 2:112979360-112979382 CACTGCTGTGGCTGGGAAGCTGG + Intronic
938410440 2:131059374-131059396 AGGTGGTGTGGCTGGGGAGAAGG - Intronic
939743587 2:145940917-145940939 AGCTGATTACGCTGAGAAGAAGG - Intergenic
939802097 2:146722230-146722252 GGCTGCTGCAGCTGGGAAGATGG - Intergenic
942566245 2:177267048-177267070 ATTTGCTGTCTTTGGGAAGACGG + Intronic
943023973 2:182606950-182606972 AGGTGCTGCCGCTGAGGAGATGG + Intergenic
943162208 2:184269046-184269068 AGCTGCTGTCTCAGGGTAGCTGG + Intergenic
946112783 2:217434802-217434824 AACTGCTGTCGACCGGAAGATGG - Intronic
946189592 2:218001433-218001455 AGCTGCTGTGACTGGAGAGAGGG - Intronic
946716648 2:222560106-222560128 AACTGCTGACGATGGGCAGAGGG - Exonic
947832437 2:233151071-233151093 AGCTGTTGTTGCTGAGAAGTTGG + Intronic
948133754 2:235620597-235620619 AGGGGCTGTGGCTGGGAGGAAGG - Intronic
948473513 2:238202459-238202481 AGCTGCTGTTGTAGGGTAGACGG - Intronic
1171240616 20:23564580-23564602 AGCTGCTGTCTCAGGGATCACGG - Intergenic
1171482495 20:25464623-25464645 AGCTGCTGTCCCCGGGAGGCAGG - Intronic
1175220964 20:57416272-57416294 AGCAGCTGTCTCTGGGATAAGGG + Intergenic
1175552386 20:59825974-59825996 AGATGCTGTCTCTGGGAAAGTGG + Intronic
1176898934 21:14416913-14416935 AACTCCAGTCCCTGGGAAGATGG - Intergenic
1178043543 21:28669006-28669028 ACTTGCTGTCCCAGGGAAGAAGG + Intergenic
1178049683 21:28733873-28733895 CGCTGCCGTTGCTGGGAAGGGGG - Intergenic
1180061012 21:45385106-45385128 AGCTGCTGGAGCTGGGTGGATGG - Intergenic
1181532324 22:23523857-23523879 AGCGGCTGGTGCTGGGAACAGGG - Intergenic
1182295450 22:29309273-29309295 TGCTGCTGTTGCTGGGAGCAGGG + Intronic
1184198516 22:42948196-42948218 AGCTGCTGTGGCTGTGAAGGAGG + Intronic
1184929444 22:47670178-47670200 TTCTGCTGTCTCTGGGAAGAAGG - Intergenic
1185127191 22:49017778-49017800 ACGTGATGTCGCTGGGAGGAGGG - Intergenic
951615968 3:24544445-24544467 ATTTGTTGTCTCTGGGAAGAAGG + Intergenic
952258919 3:31720585-31720607 TGCTGCTGTAGGTGGGAAAATGG + Intronic
953926558 3:46985621-46985643 GGCCGGTGTCCCTGGGAAGAGGG - Intronic
954581201 3:51703816-51703838 AGCAGCCGTGGCTGGGATGACGG + Exonic
955353253 3:58209605-58209627 TGTTGCTGTCACTGGGAAGGAGG - Intronic
956022826 3:64950451-64950473 AGCCGCAGCAGCTGGGAAGAAGG + Intergenic
956144307 3:66176874-66176896 TCATGCTGTCTCTGGGAAGAAGG - Intronic
956645804 3:71454687-71454709 AGCTGCTCTTGATGGGGAGATGG + Intronic
959021327 3:101190718-101190740 ACCTCCTCTCCCTGGGAAGAGGG - Intergenic
959026360 3:101244246-101244268 AGCTGCAGTATCTGCGAAGATGG + Exonic
960492336 3:118332966-118332988 AGCTGGTGTGGCTGGGATGCAGG - Intergenic
961222521 3:125212130-125212152 AGCTGATCTTCCTGGGAAGAAGG + Intronic
961715369 3:128853884-128853906 AGCTGCTGTGGGTGGCAAGCAGG + Intergenic
961941138 3:130638178-130638200 AGCTGTTGTTTCTGGGGAGAAGG - Intronic
964397775 3:156265541-156265563 CACTGCTGTCCCTGGGAAAAGGG + Intronic
964445021 3:156749456-156749478 AGCCGCTGTCACTGGGCAGAGGG + Intergenic
965632388 3:170746517-170746539 AGGTACTGCAGCTGGGAAGATGG - Intronic
965763189 3:172102717-172102739 AGCTTCTGGCGCTGGGGAGGAGG + Intronic
966973554 3:185066502-185066524 ATCAGCTCTCTCTGGGAAGAGGG - Intergenic
967263579 3:187670153-187670175 GGCTGCTGCCGCGGGGAAGCAGG - Exonic
969492638 4:7508931-7508953 AGCTGCTTTCCCTGGGGACAAGG + Intronic
970312698 4:14798983-14799005 AGCTGCAGTGGCTGGGATGCAGG + Intergenic
971230802 4:24799301-24799323 AGGTGCTGTGGCTGTAAAGATGG - Intronic
972128762 4:35802746-35802768 AGCTGCTGTGGCTAGCAACAAGG - Intergenic
972512437 4:39781896-39781918 AGTTGCTGTCACTGGGAAGAAGG + Exonic
975057875 4:69957758-69957780 AGAGGCTGTGGCTGGAAAGAGGG + Exonic
975942115 4:79660369-79660391 AGCTGGAGGGGCTGGGAAGAGGG - Intergenic
978416105 4:108477681-108477703 AGAAGCTGTCCCTGGGAACAAGG - Intergenic
978753291 4:112276278-112276300 ACTTGCTGTTGCTGGGAGGAAGG - Exonic
978833576 4:113118740-113118762 AACTGCAGTCGCTGTCAAGAAGG - Intronic
979268164 4:118727517-118727539 AGTTGCTGCAGCTGGGATGAAGG + Intronic
979809580 4:125019306-125019328 AGGTACTGTAGCTGAGAAGATGG + Intergenic
984834993 4:184011101-184011123 TCCTGCTGACGCTGGGAAGCAGG - Exonic
985585272 5:729192-729214 GGCTGCTCGTGCTGGGAAGAAGG - Intronic
985598783 5:813519-813541 GGCTGCTCGTGCTGGGAAGAAGG - Intronic
985707859 5:1411692-1411714 AGCAGATGTCCCTGGGATGAAGG - Intronic
986062674 5:4206502-4206524 ATCTGTTGTTGCTGGGAAAATGG + Intergenic
986989020 5:13530101-13530123 AGCAGCTGAAGCTGGGAAAATGG + Intergenic
987836313 5:23168067-23168089 ATCTGCTTTGGATGGGAAGAAGG + Intergenic
988170711 5:27652248-27652270 AGCTGCAGTGGCTGGGATGCAGG - Intergenic
988647268 5:33108344-33108366 AGCTGGAGTGGCTGGGATGAAGG - Intergenic
990136003 5:52645007-52645029 AGCTGGAGTGGCTGGGAAGCAGG - Intergenic
991226466 5:64278903-64278925 AGCTGCTGTGCCTGGTATGATGG + Intronic
991974206 5:72170540-72170562 AGCTCCTCTCGGTGGGCAGAAGG - Intronic
992005291 5:72471488-72471510 ATCTGCTGTCTCTGGGGAAAAGG + Intronic
992638115 5:78745077-78745099 ACCTGCTGTGGCTGGGAAAGAGG - Intronic
992960246 5:81950833-81950855 AGCTGCTGGGGTTGGGAAGAAGG - Intergenic
998183460 5:139961523-139961545 GGTTGCTGTCGCTGGGATGGTGG - Intronic
998366005 5:141631969-141631991 AGTGGCTGTCACTGGGCAGAGGG + Intronic
998396587 5:141822469-141822491 AGATACTGTGGCTGGGGAGATGG + Intergenic
999258359 5:150222415-150222437 AGCAGCTGAGGCTGGGGAGAGGG + Intronic
1000391340 5:160726491-160726513 AGGTGCTGTCTCTGGGAGGCAGG + Intronic
1001098158 5:168792231-168792253 AGCTGCTGTGGCTAGGGACAGGG - Intronic
1001467499 5:171981229-171981251 AGCTTCTGTCTCTGTGAAGTTGG - Intronic
1003306049 6:4930461-4930483 AGCTGCTTTCGGTGGAAAGGCGG + Intronic
1003874261 6:10422629-10422651 GGCTGATGGCGCTGGGAGGAGGG - Intergenic
1006372708 6:33655321-33655343 AGGGGCTGCCCCTGGGAAGAGGG + Intronic
1006381484 6:33700489-33700511 AGCTGGTGTCTCTGGGGCGAGGG + Exonic
1010658924 6:78546009-78546031 TGCTTCTGTTGCTTGGAAGATGG - Intergenic
1010941297 6:81920987-81921009 GACTGCTGTTCCTGGGAAGATGG + Intergenic
1011498444 6:87961901-87961923 AGCTGTTCTGGCTGGAAAGAAGG + Intergenic
1011894788 6:92212062-92212084 AGGATCTGTCTCTGGGAAGATGG + Intergenic
1013584743 6:111568512-111568534 AGATGCTCTTGATGGGAAGAGGG + Intronic
1014183148 6:118407267-118407289 AGCTACTTTTGCTGGGAAGCCGG - Intergenic
1014861208 6:126470244-126470266 AGCTGGAGTGGCTGGGATGAAGG - Intergenic
1019616722 7:1966366-1966388 AGCTGCTGGGGCTGAGGAGATGG + Intronic
1019639083 7:2093462-2093484 AGCAGCTTTCCCTGGGAAGAGGG + Intronic
1019936474 7:4261484-4261506 AGCTGCTGTGGCTGGCAATGGGG + Intronic
1021096305 7:16539694-16539716 AGCTGGAGTGGCTGGGAAGCAGG - Intronic
1022036210 7:26537266-26537288 AGCTGCTTTCTCTTGGAAGATGG + Intronic
1023485597 7:40682744-40682766 ACCTACTTTCTCTGGGAAGAAGG + Intronic
1024117569 7:46208423-46208445 AGCTGCAGAGGCAGGGAAGAGGG + Intergenic
1024144599 7:46500454-46500476 AGTTTCTTTTGCTGGGAAGAAGG - Intergenic
1024235133 7:47392134-47392156 AGTTGCTGTCCCTGAGGAGAGGG - Intronic
1024251282 7:47507647-47507669 AGCTGCAGCCTCTGGGCAGAAGG - Intronic
1024912134 7:54458040-54458062 AGCTGATGTAGCTGGGATGCAGG - Intergenic
1028567055 7:92245642-92245664 GGCTGCTGTGCCTGGGAGGAGGG - Intronic
1029237193 7:99130870-99130892 AACCGCTGTGGCTGGGATGATGG - Intronic
1031063288 7:117076111-117076133 AGGTGCTGTAGCTGAGGAGATGG - Intronic
1032077496 7:128843015-128843037 AGATGCTGTCACTGGGAACAGGG + Intronic
1032497349 7:132372491-132372513 AGCTGATGCCACTGGGAGGAAGG - Intronic
1033385583 7:140871810-140871832 AGCTGCAGTGGCTGGGAATGTGG - Intronic
1033514544 7:142093271-142093293 TGCTCATGTCTCTGGGAAGACGG + Intronic
1033991348 7:147291096-147291118 AGCAGCTGTCTATGGGAAGGTGG - Intronic
1034327288 7:150248137-150248159 AGCTCCTGTCCCAGGGAAGCAGG + Intronic
1034765921 7:153721320-153721342 AGCTCCTGTCCCAGGGAAGCAGG - Intergenic
1034908102 7:154968840-154968862 TGCTGCTGTTGCTGTGAAAATGG + Exonic
1038159091 8:25019614-25019636 ATCTGCTGTGCCTGGGAAGGAGG + Intergenic
1038425611 8:27462149-27462171 ACCTGCTGGAGCTGGGGAGAGGG + Intronic
1043278904 8:78438312-78438334 GGCTGCTGTCACTTGGTAGAAGG + Intergenic
1045336962 8:101213909-101213931 AGTAGCTGTTGCTGAGAAGAGGG + Intergenic
1046250087 8:111619454-111619476 AGCTGCTGTCGCTCTGATGGTGG - Intergenic
1046827233 8:118704473-118704495 GGCAGCTGTGGTTGGGAAGATGG + Intergenic
1047216143 8:122877544-122877566 AGGTCCTGAGGCTGGGAAGAGGG + Intronic
1048624980 8:136175334-136175356 AGCTGCTCTCACTGAGAACAGGG - Intergenic
1049611380 8:143557404-143557426 AGCTGCTGCCGCTGTGGCGAAGG + Intronic
1052614774 9:30823831-30823853 AACTGATGTTGCTGGGAAAAGGG - Intergenic
1054887387 9:70213264-70213286 AGATGCTGTCACTGGGAAAGTGG - Intronic
1055972529 9:81926073-81926095 AGCTGCTGTCTGTTGGAATAGGG + Intergenic
1055974282 9:81941145-81941167 AGCTGCTGTCTGTTGGAATAGGG + Intergenic
1056901690 9:90605992-90606014 ATCGGCTGTCCCTGGGCAGAGGG - Intergenic
1059100959 9:111470903-111470925 AGCTGCTGTCTCTGGGGGAAAGG - Intronic
1060919206 9:127408810-127408832 AGCTCCAGTCGGTGGCAAGAGGG - Intergenic
1061743001 9:132721094-132721116 AGTTGCTGTGGATGGGAGGACGG - Intergenic
1185872556 X:3676083-3676105 GGCTGCTGACGCTGGGATCAAGG - Intronic
1186758732 X:12700944-12700966 AGCTGCTGTGGCTGATAAGGAGG + Intronic
1186886978 X:13923536-13923558 AGCTGCTCACCCTGCGAAGAAGG - Intronic
1188542337 X:31264969-31264991 TACTGCTGTGGCTGGGAAAATGG + Intronic
1191669902 X:63739344-63739366 AGCTGCTGTAGGAGGGATGAAGG + Intronic
1194053843 X:89105339-89105361 AGCTGCAGTGGCTGGGAGGAAGG + Intergenic
1196250265 X:113452049-113452071 AGCTTCTGTCTCTGTGGAGATGG - Intergenic
1196294095 X:113979127-113979149 AGGTGCTGTAGCTGAGGAGATGG - Intergenic
1196313526 X:114196734-114196756 AGCTGAAGTAGCTGGGAAGCAGG + Intergenic
1197998666 X:132408938-132408960 AGCAGCAGTCTCTGGTAAGATGG - Intronic
1199071139 X:143476922-143476944 AGCTGCCGTGGCTGGGATGCAGG - Intergenic
1199714074 X:150493588-150493610 AGTTGTTATCTCTGGGAAGAGGG - Intronic
1200038767 X:153350563-153350585 AGCAGCTGTGGCTGGGGACAGGG + Exonic