ID: 1106248578

View in Genome Browser
Species Human (GRCh38)
Location 13:27967882-27967904
Sequence CCAGGGAGAGCTGCTGTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106248578_1106248584 14 Left 1106248578 13:27967882-27967904 CCAGCGACAGCAGCTCTCCCTGG 0: 1
1: 0
2: 2
3: 22
4: 261
Right 1106248584 13:27967919-27967941 GTACCTTGAATTGGCCCGAGTGG 0: 1
1: 0
2: 0
3: 1
4: 29
1106248578_1106248583 5 Left 1106248578 13:27967882-27967904 CCAGCGACAGCAGCTCTCCCTGG 0: 1
1: 0
2: 2
3: 22
4: 261
Right 1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG 0: 1
1: 0
2: 0
3: 4
4: 51
1106248578_1106248586 24 Left 1106248578 13:27967882-27967904 CCAGCGACAGCAGCTCTCCCTGG 0: 1
1: 0
2: 2
3: 22
4: 261
Right 1106248586 13:27967929-27967951 TTGGCCCGAGTGGCCAAACCCGG 0: 1
1: 0
2: 0
3: 1
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106248578 Original CRISPR CCAGGGAGAGCTGCTGTCGC TGG (reversed) Intronic
900031695 1:377375-377397 ACAGGGAGAGCTGCCGGGGCTGG + Intergenic
900052242 1:605567-605589 ACAGGGAGAGCTGCCGGGGCTGG + Intergenic
900307671 1:2019162-2019184 CCAGGGAGAGCTGCCCGCGAGGG + Intergenic
900480821 1:2898297-2898319 CCAGGAAAAGCTGCTGCCGGGGG + Intergenic
900527765 1:3137474-3137496 CCAGGGAGGGGTGCTGCTGCTGG - Intronic
900824062 1:4912219-4912241 CCCTGGAGAGCTGCTGTCTCTGG + Intergenic
900862177 1:5241574-5241596 CCAGGGAGGGCAGCTGGCCCAGG - Intergenic
901084502 1:6602412-6602434 CCAGGTCGAGCTGCTGCTGCAGG + Exonic
901445453 1:9305371-9305393 CCAGGGACAGCTGCTGTTGTGGG + Intronic
901630674 1:10646767-10646789 CCAGGAAGCGCTGCTGCCACAGG + Intronic
902128698 1:14239920-14239942 CAAGGGAGAGCTGCTGTCCTGGG - Intergenic
902370838 1:16005986-16006008 CCAGGGAGAGCTGCTTCCCGTGG - Exonic
902401075 1:16157067-16157089 CCAGGAAGAGCAACTGTGGCAGG + Intergenic
902761121 1:18581380-18581402 CCAGGCATATCTGCTGTGGCTGG + Intergenic
903273819 1:22208418-22208440 GCAGGGAGAGAGGCTGACGCGGG + Intergenic
904273839 1:29367552-29367574 GCAGGGAGTGCTGCAGTCTCAGG + Intergenic
904453745 1:30633927-30633949 GCAGGGAGGGCTGCTGTCTGGGG + Intergenic
904897445 1:33827529-33827551 GCAGGGAGAGCTGGGGTTGCAGG - Intronic
906323370 1:44829904-44829926 CCAAGGAGAGCTGCTGAGGTAGG - Exonic
906556761 1:46720008-46720030 CCAGGAAGACCTGTTGTGGCTGG + Intergenic
907910530 1:58822028-58822050 CCAAGAAGAGCTGCTGGCACTGG + Intergenic
907962466 1:59296568-59296590 CCAGGGAACGCTGCAGCCGCGGG + Intergenic
908248345 1:62245457-62245479 CCAGTAAGAGGTGCTGTCCCTGG + Intronic
915079273 1:153340521-153340543 CCAGGGAGACCCACTGTCCCAGG - Exonic
915507975 1:156369279-156369301 GCAGGGGAAGCTGCAGTCGCCGG - Exonic
916348180 1:163818366-163818388 CCAGGGAAAGCTGAAGTAGCAGG - Intergenic
918068041 1:181114785-181114807 CCAGGAGGAGCTGCTGTAGCTGG + Intergenic
919516866 1:198535839-198535861 CCAGGCAGAGCAGCTGTAGGGGG + Intronic
919897886 1:202020733-202020755 CCAGGGAGAGCTGACCTAGCTGG - Intergenic
920385818 1:205569490-205569512 CCAGGGAGAGCTGCGGGGGAGGG - Intronic
920670612 1:208001355-208001377 CCAGGTGAAGCTGCTGTTGCTGG - Intergenic
920964070 1:210687827-210687849 AGACGGAGAGCTGCTGTGGCTGG - Intronic
922326783 1:224535731-224535753 CAAGGGAGGGCTGCTGCCACTGG + Intronic
922909826 1:229206149-229206171 GCTGGGCGAGCTGCAGTCGCTGG + Intergenic
923471041 1:234291332-234291354 CCAGGCAGAGCTGATGCTGCTGG + Intronic
1062760123 10:11605-11627 CCAGGTGGGGCTGCTGTCGCAGG - Intergenic
1063352992 10:5373711-5373733 GCAGGGAGAGATGCTGATGCCGG + Exonic
1065725419 10:28664048-28664070 GGAGGGAGAGGTCCTGTCGCAGG - Intergenic
1066320223 10:34295608-34295630 CCAGTCAGAGCTGCTTTTGCAGG + Intronic
1067068901 10:43118688-43118710 CCAGGGAGTGCCGCTAGCGCGGG - Intronic
1067377277 10:45739426-45739448 CCATTGAGAACTGCTGTTGCAGG + Intronic
1067884982 10:50080113-50080135 CCATTGAGAACTGCTGTTGCAGG + Intronic
1069590676 10:69639823-69639845 CCAGGGAGAGGGTTTGTCGCCGG + Intergenic
1069696222 10:70387409-70387431 CCAGGGAGAGGTGCGGCCCCAGG - Intergenic
1070572625 10:77651447-77651469 GTAGGGAGAGCTGCTGTGGATGG - Intergenic
1070776495 10:79112898-79112920 CCAGAGAAAGCTGCTGTCACAGG - Intronic
1071525854 10:86357852-86357874 CCACAGAGAGCTGCTGTTCCTGG - Intronic
1075048663 10:119165809-119165831 CGTGGGAGAGCTGCGCTCGCCGG - Intergenic
1075116283 10:119629839-119629861 TCAGGGAGAGATGATGTGGCTGG - Intergenic
1075295450 10:121271304-121271326 CCAGGGGCAGCAACTGTCGCAGG + Intergenic
1075401223 10:122163097-122163119 CCAGGGAGAGCTGCGGCACCTGG - Intronic
1075554665 10:123421727-123421749 TGAGGAAGAGCTGCTGTCACAGG - Intergenic
1075734627 10:124656334-124656356 CCAGGGAGCCCTGCTGTAGTGGG + Intronic
1076707472 10:132309483-132309505 GCAGGGAGAGCTGCGGTGGCTGG - Intronic
1076782540 10:132732120-132732142 GCATGGGCAGCTGCTGTCGCGGG - Intronic
1076996590 11:300037-300059 ACAGGGAGGGCGGCTGTCGGAGG + Intergenic
1080605310 11:33860433-33860455 CCAGGCAGTGCTGATGTCGCTGG - Intronic
1081639402 11:44742557-44742579 CCTGGGAGAGCTCCTATGGCGGG - Intronic
1083462693 11:62825075-62825097 CCCGGGAGAACTGCTCTCTCCGG + Exonic
1084273491 11:68040763-68040785 CCAGGGAGCACTGCTGTGGGGGG - Intronic
1084746093 11:71170870-71170892 CCAGGGATTCCTGATGTCGCTGG + Intronic
1085134653 11:74075167-74075189 CCAGGCAGAGCTGTTGTGGAAGG + Intronic
1089457074 11:118631939-118631961 CCAGGGAGAGGTGCTAGCCCTGG + Exonic
1089599277 11:119603543-119603565 CCAGGGAGGGCTGTTGTCCATGG + Intergenic
1089645766 11:119877669-119877691 CCAGAGAGGGCTCCTGTGGCTGG + Intergenic
1090657926 11:128860012-128860034 CCAGGGGGCGCTGCTGCTGCTGG - Intronic
1091563067 12:1629462-1629484 CCAGGGAGAGTAGGTGTTGCGGG + Intronic
1091792063 12:3277681-3277703 CCAGGTGGAGCTGGTGGCGCCGG + Intronic
1094357665 12:29595569-29595591 CCAGAGAGAGCTGCTCTTGAGGG - Intronic
1096919379 12:55067874-55067896 CCAGAGAGGGCTGCAGACGCTGG + Intergenic
1097968720 12:65609388-65609410 CCATGGGGAGCTGCTGAGGCAGG + Intergenic
1102300292 12:111766689-111766711 CCAAGGCGAGCTGCGTTCGCGGG + Intronic
1102519221 12:113468542-113468564 CCTGGGGGAGGGGCTGTCGCAGG - Intronic
1103505672 12:121441130-121441152 CGAGGGAGACGGGCTGTCGCCGG + Exonic
1104569373 12:129911545-129911567 CCAGGGAGAGCAGCCGTGCCTGG + Intergenic
1104692795 12:130839204-130839226 CCAGGGAGGGCTGCTGGCGCCGG - Intronic
1104699621 12:130892109-130892131 CCAGGGAGCGCTGCAGGTGCCGG - Intergenic
1104846879 12:131851351-131851373 CCTGGGGGAGGTGCTGGCGCGGG + Exonic
1106248578 13:27967882-27967904 CCAGGGAGAGCTGCTGTCGCTGG - Intronic
1108525089 13:51279664-51279686 CCAGGGAGGGCTGCTGGACCAGG + Intronic
1110313733 13:74080959-74080981 GCAGGTAGAGCTGCTGTCAGTGG - Intronic
1111397123 13:87677908-87677930 CCGGGAGGACCTGCTGTCGCCGG + Exonic
1112439286 13:99414183-99414205 CCAGGGTGATCTGATGTCGAGGG - Intergenic
1112692696 13:101915929-101915951 CCAGCGGGAGCTGCTGTAGAAGG - Intronic
1113957118 13:114104951-114104973 CCTGTGAGGGCTGCTGACGCTGG - Intronic
1114031461 14:18584009-18584031 CCAGGTGGGGCTGCTGTCGCAGG - Intergenic
1114536832 14:23428306-23428328 CCAGGGACAGCTGATTTCCCAGG - Intronic
1117842102 14:59870588-59870610 GCAGGACGAGCTGCTGCCGCTGG - Exonic
1121798557 14:96755075-96755097 CCAGGGGGAGCAGCTGCTGCAGG + Intergenic
1122297544 14:100713847-100713869 CCAGGCTGAGCAGCTGTCCCTGG + Intergenic
1122806981 14:104264754-104264776 CCAGGCAGTGGTGCTGACGCAGG + Intergenic
1124035869 15:26053220-26053242 CTAGTCAGAGCTGCTGTTGCTGG + Intergenic
1124343743 15:28907499-28907521 CCAGGCAGAGCAGCTGTCCGTGG + Intronic
1124964177 15:34421028-34421050 CCAGGCAGAGCAGCTGTCCGTGG - Intronic
1124980790 15:34567256-34567278 CCAGGCAGAGCAGCTGTCCGTGG - Intronic
1126208153 15:46069797-46069819 GCAGGAAGAGCTGTTGTGGCAGG + Intergenic
1126342100 15:47652356-47652378 CCAGGAACAGCTGCTGTTGTTGG - Intronic
1128710199 15:69866023-69866045 CCAGGAAGTGCTGATGTGGCTGG - Intergenic
1129151025 15:73687846-73687868 GCAGGGAGAGATACTGTCTCTGG + Intronic
1129231872 15:74201502-74201524 CCAGGCAAAGCAGCTGTGGCTGG + Intronic
1129243397 15:74265216-74265238 CAAGGGCCAGCTGCTGTCCCTGG + Intronic
1129271258 15:74420517-74420539 CCAGGGAGGGCTGATATCCCCGG - Intronic
1129298891 15:74614617-74614639 TCAGGGAGAGCCGCTGGCGAAGG + Intronic
1129888692 15:79056800-79056822 CCAGGCAGAGCTGGATTCGCAGG + Intronic
1130611260 15:85363391-85363413 CCAGGCAGAGATGCTGTGGATGG + Intergenic
1130928437 15:88402422-88402444 CCAGGTGGAGCTGCTGCTGCTGG + Intergenic
1132241584 15:100261580-100261602 CCCTGGAGAGCTTCTGTCACTGG - Exonic
1132311860 15:100863062-100863084 CAAGTGAGGGCTGCTGTCCCAGG - Intergenic
1132833809 16:1942692-1942714 CCAGGGCCAGCTCCTGTGGCCGG - Intronic
1134447699 16:14343358-14343380 CCTGGGAGAGATGCTGTTCCAGG - Intergenic
1134570063 16:15283401-15283423 CTTGGGGGAGCTGCTGTGGCTGG - Intergenic
1134732313 16:16472648-16472670 CTTGGGGGAGCTGCTGTGGCTGG + Intergenic
1134935123 16:18239315-18239337 CTTGGGGGAGCTGCTGTGGCTGG - Intergenic
1136289430 16:29262436-29262458 CCAGGGAGGGCTGGTGTCCACGG - Intergenic
1136496365 16:30647508-30647530 CCTGGGGGAGCTGCTGACCCTGG + Intergenic
1139357603 16:66376612-66376634 CCAGGCAGAAGTGCTGTTGCTGG - Intronic
1140477765 16:75247493-75247515 TCAGGGAGAGCTGCAGCCGTCGG + Intronic
1141070385 16:80949036-80949058 CCAGGGGGCGCTGCTGCCCCTGG - Intergenic
1141737063 16:85860874-85860896 CAACGGAGTGCTGCTGTCGTCGG - Intergenic
1142095169 16:88235416-88235438 CCAGGGAGGGCTGGTGTCCACGG - Intergenic
1142752663 17:1998092-1998114 CGAGGGAGAGCTGCCGGGGCTGG + Intronic
1144180167 17:12744335-12744357 GCAGGAACAGCTGCTGTTGCTGG - Exonic
1145880130 17:28347137-28347159 CCAGGGGGAGCTGGGGTTGCAGG - Intergenic
1146285430 17:31571326-31571348 CCAGGCAGGGCTGCTGTTGTGGG + Exonic
1146658374 17:34648655-34648677 CCTGGGAGGGCTGCAGTCCCTGG + Intergenic
1147686250 17:42288400-42288422 GCTGGGAGGGCTGCTGGCGCGGG + Exonic
1148515795 17:48215812-48215834 CCAGGGAGAGCTGGTGATGCTGG - Intronic
1151953209 17:77366707-77366729 CCAGGCAGTGCTGCAGTCCCTGG + Intronic
1152610958 17:81314836-81314858 CCAGGCAGAGCTGGGGTCCCAGG - Intronic
1152947959 17:83208338-83208360 ACAGGGAGAGCTGCCGGGGCTGG - Intergenic
1152953030 18:11959-11981 CCAGGTGGGGCTGCTGTCGCAGG - Intergenic
1155073409 18:22335731-22335753 CCAGGGAGTTCTGCCGTCCCAGG - Intergenic
1155284434 18:24273308-24273330 CTAGGGAGAGATTCTGTAGCAGG - Intronic
1157607050 18:48932525-48932547 GCGGGGAGAGCTGCTTTTGCTGG - Intronic
1158638238 18:59179965-59179987 CCAGGCAGTGCTGCTGCCGTTGG + Intergenic
1158954024 18:62523186-62523208 CCAGGGGGAGGAGCCGTCGCGGG + Exonic
1160325596 18:77944685-77944707 ACAGGTAAAGCTGCTGTTGCAGG - Intergenic
1160860098 19:1234072-1234094 CCAAGGAGGGCTGCGGTGGCTGG + Intronic
1161097797 19:2403240-2403262 CCAGGGTCAGCTGCTGGCTCTGG + Intronic
1161227017 19:3151423-3151445 CCCGGGAGAGCTGCTATGGCAGG - Intronic
1161236109 19:3198991-3199013 ACAGGGAGAGCCGCTGACCCTGG - Intronic
1161269625 19:3382679-3382701 CCTGGGAGAGCGTCTGACGCCGG + Intronic
1161582307 19:5087513-5087535 CCAGTGAGAGCTGCTGCCCAGGG + Intronic
1161737732 19:6001930-6001952 CCAGGGAGCTCTGCTGCTGCAGG + Exonic
1161737756 19:6002064-6002086 CCAGGGAGGGCTGCCGTGGCTGG - Intronic
1162017084 19:7851728-7851750 CCAGGCAGAGCTGATGCAGCTGG + Exonic
1163291067 19:16379259-16379281 CCCAGGAGTGCTGCTGTGGCGGG - Intronic
1163312379 19:16522122-16522144 GCAGGGAGAGCTGCGGGCGGGGG - Intronic
1163638017 19:18446326-18446348 CCTGGGAGAGCTGCCGGAGCTGG + Exonic
1164476537 19:28579833-28579855 CCATGGAGAGCTGCTGTCCCTGG + Intergenic
1164811986 19:31164723-31164745 CCGGGGAGAGCTGCTGGAACAGG - Intergenic
1166380766 19:42353999-42354021 GCAGGGGGTGCTGCTGTCGGGGG - Exonic
1168577970 19:57528750-57528772 CCTGGGAGAGCTGCTCTTGCTGG - Intronic
925444737 2:3918211-3918233 CCAGTGAGAGCTGGTGCTGCAGG + Intergenic
927236674 2:20881226-20881248 CCAGGGAATGCAGCTGTCCCAGG + Intergenic
929955523 2:46455331-46455353 ACAGGGAGACCTGCTGTTGTAGG - Intronic
930800594 2:55438705-55438727 CCACTGAGAGCTGCAGACGCTGG + Intergenic
933995652 2:87667554-87667576 CCAGGAAGAGCTGATGTTGCAGG + Intergenic
936298205 2:111283358-111283380 CCAGGAAGAGCTGATGTTGCAGG - Intergenic
936997163 2:118427365-118427387 CCAGGGATGGCTGATGTCGTAGG - Intergenic
937537910 2:122914033-122914055 TCATGGAGAGCTGCTGACCCTGG + Intergenic
939802956 2:146735682-146735704 CCAGGGAGAGCTGAAGTAGAAGG - Intergenic
940855087 2:158723408-158723430 CCAGTGCCAGCTGCAGTCGCGGG + Intergenic
946024934 2:216665950-216665972 CCAGGTGGAGCTGCTATCCCTGG + Intergenic
946827545 2:223694515-223694537 CCAGGGACAGCTGGGGTAGCAGG - Intergenic
947542884 2:230990851-230990873 CCCGGGCGTGCTGCTGTTGCAGG - Intergenic
947722588 2:232378844-232378866 CCAGGGAGAGCTGTAGCCTCAGG - Exonic
947726929 2:232406927-232406949 CCAGGGAGAGCTGTAGCCTCAGG - Exonic
947736077 2:232456232-232456254 CCAGGGAGAGCTGTAGCCTCAGG - Exonic
948579003 2:238971510-238971532 CCCAGGACAGCTGCTGTCTCTGG + Intergenic
1169020333 20:2326330-2326352 GCAGAGAGAGCTGCTGTGGGTGG - Intronic
1169074311 20:2751918-2751940 CCAGGAAGTGCTGCTGAAGCGGG + Exonic
1170554442 20:17504358-17504380 CCAGTAAGAGCTCCTGTCTCAGG + Intronic
1171180888 20:23089362-23089384 CCAGGGAAGGCTGGTGTCCCTGG + Intergenic
1171482498 20:25464631-25464653 CGCGTGAGAGCTGCTGTCCCCGG - Intronic
1172517424 20:35544653-35544675 CCAGGCACAGCTGCCGCCGCGGG - Intronic
1172830935 20:37833780-37833802 ACGGGGAGAGCTGCTGGCACAGG - Intronic
1175246565 20:57585856-57585878 CCAGGTGCTGCTGCTGTCGCTGG - Intergenic
1175416331 20:58803866-58803888 CCAGGAAGGGCTGCGGTCGGAGG - Intergenic
1176080146 20:63268412-63268434 GCTGGGAGGGCTGCTGTCGTAGG + Intronic
1179910585 21:44445560-44445582 GCAGGCAGAGCTTCCGTCGCGGG - Intergenic
1180455574 22:15511066-15511088 CTAGGTGGGGCTGCTGTCGCAGG - Intergenic
1180954713 22:19736523-19736545 CCAGGGAGAGCAGAGGTCCCAGG + Intergenic
1181669342 22:24418918-24418940 CCAGGCAGGGCTGCTGGGGCAGG - Intronic
1183020769 22:35024207-35024229 CCAGGGGGAGCTGTGGTCTCAGG - Intergenic
1183215442 22:36476657-36476679 CCAGGGATAGCTGGTGTAGGAGG - Intronic
1183498193 22:38162565-38162587 TACGGGAGAGCTGCTGTCACTGG + Intronic
1183739645 22:39662628-39662650 CCAGGGAGGGCTTCTCTCCCAGG - Intronic
1184091420 22:42294936-42294958 GCAGGGAGACATGCTGGCGCTGG + Intronic
1185088161 22:48751962-48751984 CCTGGGAGAGGGGCTGTGGCTGG + Intronic
950725107 3:14912168-14912190 CCAGAGAGAGCTGGTGGTGCTGG + Intronic
953431567 3:42844634-42844656 CCTGGCAGAGCTCCTGTAGCAGG - Intronic
953679192 3:45026789-45026811 CCAGGGAGAGCTGCACAGGCTGG + Intronic
953906868 3:46872722-46872744 CCAGGTTCAGCTGCTGTCTCAGG + Intronic
954879517 3:53823933-53823955 CCAGGGATTGCTGCTGCCCCAGG + Exonic
957036077 3:75294265-75294287 CCAGGGAGGGCTGCGGTGGGTGG + Intergenic
958962256 3:100521728-100521750 TCAGCCAGAGCTGCTGTGGCAGG + Intronic
960056867 3:113282181-113282203 CCAGGGAGAGCTGGAGCCACTGG + Intronic
960622539 3:119650896-119650918 GCAGGTAGAGCTGCTTTCGGGGG - Intronic
961079817 3:124016661-124016683 CCAGGGAGGGCTGCGGTGGTGGG + Intergenic
961303317 3:125936407-125936429 CCAGGGAGGGCTGCAGTGGGTGG - Intronic
961467509 3:127090578-127090600 CCAGGGAGGGCTGCTCCCACAGG + Intergenic
962811377 3:138961770-138961792 ACAGGGAGAGCACCTGTGGCTGG + Intergenic
966491782 3:180535694-180535716 CCAGGGAAAGCTGATGTAGCTGG - Intergenic
967728100 3:192880603-192880625 CTAGGGCGAGCAGCTGTCGGAGG + Intronic
968514103 4:1009317-1009339 CCCGGGGCAGGTGCTGTCGCGGG + Intergenic
969435751 4:7188432-7188454 GAAGGGAGAGCTGCTGTCTGGGG - Intergenic
969508924 4:7606033-7606055 TCAGGGAGAGGTGCTCTGGCCGG + Intronic
969569803 4:8001720-8001742 CCAGGGAGAGCTGGGGGCTCAGG - Intronic
970205353 4:13649980-13650002 CCAGGGTGGGCTGCTTTCTCTGG + Intergenic
974068349 4:57101436-57101458 CCAGGGAGAGGAGCAGTCCCGGG - Intronic
975249197 4:72157744-72157766 CCAGGTGCAGCGGCTGTCGCTGG - Intergenic
977323223 4:95546458-95546480 ACAGGAAGAGCTGCTATCCCTGG + Intronic
981588753 4:146333103-146333125 CCAGGTAGAACTGCTTTCTCTGG - Intronic
981745308 4:148046960-148046982 CCAGGGACAGCTGTAGTCACGGG - Exonic
981782089 4:148442263-148442285 GCAGGGAGAGCGGCACTCGCTGG - Exonic
985788368 5:1911702-1911724 ACAGGAAGAGCTGGTGTCCCGGG - Intergenic
994608839 5:102009383-102009405 TCAGGGAGGGCTGCTGCTGCTGG + Intergenic
996472392 5:123875896-123875918 CTAGGAAGTGCTGCTGTGGCTGG - Intergenic
998114127 5:139523684-139523706 CCAGGGTCAGCTGCTGGCCCTGG - Intergenic
1000205011 5:159050485-159050507 CAAGGGACATCTGCTGTCTCTGG - Intronic
1000624602 5:163524886-163524908 CCAGGAAGAGTTGATGTTGCAGG + Intergenic
1002092823 5:176814842-176814864 GCAGGGAGGGCTGCTATTGCTGG + Intronic
1002181705 5:177434147-177434169 CCAGGCCCAGCTGCAGTCGCTGG - Intronic
1002645231 5:180649500-180649522 CCAGGCAGAGCCACAGTCGCAGG + Exonic
1002742125 5:181441493-181441515 ACAGGGAGAGCTGCCGGGGCTGG - Intergenic
1003029699 6:2591357-2591379 CCAAGGTGAGATGCTGTTGCTGG + Intergenic
1003068220 6:2920993-2921015 GGAGGGAGAGCTGCAGGCGCGGG - Intergenic
1003153900 6:3575049-3575071 CCAGGAAGGGCTGCTCTCCCTGG + Intergenic
1003266968 6:4574393-4574415 CCAGGGGGATGTGCTGTCACAGG - Intergenic
1004875161 6:19944132-19944154 CCAGGGATAGCTGTTGCTGCAGG - Intergenic
1009939363 6:70271680-70271702 CCAGGGAGTCCTGCTGTCCCAGG + Exonic
1012346737 6:98196671-98196693 CCAGGGAATGCTGTTGTCACTGG - Intergenic
1015140067 6:129920788-129920810 CCAGGTTGAGCTTCTGCCGCTGG + Intergenic
1015765390 6:136710778-136710800 CCAGGGAGAGGTTCTTTCCCTGG - Intronic
1018737295 6:166696844-166696866 CCAGGAAGAGCTGGTGTTTCAGG - Intronic
1018946122 6:168347773-168347795 CCTGGAAGAGCAGCTGTGGCGGG - Intergenic
1019179794 6:170178966-170178988 CCAAGGAGAGCAGCTGATGCAGG - Intergenic
1019232071 6:170575405-170575427 GCAGAGGGAGCTGCTGTGGCTGG + Exonic
1019247260 6:170717231-170717253 ACAGGGAGAGCTGCCGGGGCTGG - Intergenic
1020013036 7:4816691-4816713 TCAGGGGGATCTGCTGTCGGAGG + Intronic
1020016485 7:4834801-4834823 CCAGGAGCAGCTGCTGGCGCCGG + Exonic
1023583580 7:41706186-41706208 ACAGGGACAGCTGCTGCCACAGG - Intergenic
1023913083 7:44569112-44569134 GCAGGGTGAGCTGCTGTGGTGGG - Exonic
1024249889 7:47498112-47498134 GCAGGGAGAGCTTCTTTCTCAGG + Intronic
1026727341 7:72879820-72879842 CCGGGGCGGGCTGCTGTCGCTGG - Exonic
1027116515 7:75485907-75485929 CCGGGGCGGGCTGCTGTCGCTGG + Exonic
1027275312 7:76549796-76549818 CCGGGGCGGGCTGCTGTCGCTGG - Intergenic
1027721438 7:81746974-81746996 CCAGGCATTGCTGCTGTTGCTGG + Intronic
1029545219 7:101206929-101206951 GCAGGGACAGCTGCGGGCGCAGG + Intronic
1029721022 7:102364346-102364368 CCGGGGCGGGCTGCTGTCGCTGG - Exonic
1033606651 7:142932639-142932661 CCAGGAAGAGCAGCTGGGGCAGG - Intronic
1033644007 7:143287376-143287398 CTAGGGACAGCTGCTGGTGCAGG + Exonic
1034416060 7:150964792-150964814 CCAGGCAGAGAGGCTGTCTCCGG + Intronic
1035500875 8:90704-90726 ACAGGGAGAGCTGCCGGGGCTGG + Intergenic
1036910724 8:12755240-12755262 CCGCGGGGAGCTGCTGGCGCTGG - Exonic
1039843369 8:41309096-41309118 CCTGGGCGTGCTGCTGGCGCTGG - Exonic
1040652624 8:49465713-49465735 CCACGGTGAGCTGCTGCCGTGGG + Intergenic
1042485199 8:69339839-69339861 CCAAGGTGACCTGCTGTCCCAGG - Intergenic
1045377794 8:101592533-101592555 TCAGGTAGAGCTGATGTGGCTGG - Intronic
1046670940 8:117055417-117055439 CCAGGGACAGCAGCAGTTGCTGG + Intronic
1048882384 8:138881748-138881770 CCAGGGAGACCACCTGTCACTGG - Intronic
1048993412 8:139774548-139774570 CGCGGCACAGCTGCTGTCGCTGG - Intronic
1049040656 8:140110221-140110243 ACAGGGGGAGCTGCTGTAGGGGG - Intronic
1049347024 8:142144582-142144604 CCTGGGAGAGGTGGTGACGCAGG + Intergenic
1049560927 8:143309893-143309915 GCAGGGAGAGCTGATGACACAGG + Intronic
1053299765 9:36940635-36940657 CCAGGATGTGCTGCTGTCCCAGG + Intronic
1053525952 9:38831143-38831165 CCAGGGTGGGCTGCTTTTGCGGG + Intergenic
1054198184 9:62055568-62055590 CCAGGGTGGGCTGCTTTTGCGGG + Intergenic
1054640174 9:67532795-67532817 CCAGGGTGGGCTGCTTTTGCGGG - Intergenic
1056888993 9:90471654-90471676 ACAGGCAGACCTGCTGTCTCTGG - Intergenic
1057200596 9:93137741-93137763 CCAGTGAGAGCTGTGGTCCCTGG - Intergenic
1057481297 9:95447391-95447413 CCAGGTGGGGCTGCTGTCTCGGG + Exonic
1058671556 9:107364672-107364694 ACAGGGTGAGCTGCTGTGCCTGG + Intergenic
1059424152 9:114210443-114210465 CCAGGGGGAGCGGCTGTCTGGGG + Intronic
1060664780 9:125426315-125426337 CCAGGCAGAGCTCCTGAAGCTGG + Intergenic
1061095895 9:128456598-128456620 CGAGGGAGAGCCTCTGTCGGCGG - Intronic
1062032035 9:134366098-134366120 CCTGGGAGCGGTGCTGTCCCTGG + Intronic
1062121091 9:134834420-134834442 GCAGGGAGAGCAGCTGCAGCTGG + Intronic
1062247239 9:135575454-135575476 CCAGGGGGAGACGCTGTCTCTGG - Intergenic
1203608035 Un_KI270748v1:72708-72730 ACAGGGAGAGCTGCCGGGGCTGG - Intergenic
1186160759 X:6774656-6774678 CCAGGTAGGGTTGCTGTGGCTGG + Intergenic
1186896489 X:14009232-14009254 CCAGTGAGTGCTGCTGCTGCTGG + Intronic
1192371894 X:70521112-70521134 CGAGGGTGAGCTGCTGAAGCAGG - Intergenic
1199927216 X:152480313-152480335 CCAGGGAGGGCTGTTGTCCACGG - Intergenic
1200228169 X:154430854-154430876 CAAGGAAGAGCTGGTGTGGCTGG + Intronic