ID: 1106248583

View in Genome Browser
Species Human (GRCh38)
Location 13:27967910-27967932
Sequence CTGCTCGCTGTACCTTGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106248576_1106248583 13 Left 1106248576 13:27967874-27967896 CCTTCTTCCCAGCGACAGCAGCT 0: 1
1: 0
2: 2
3: 25
4: 259
Right 1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG 0: 1
1: 0
2: 0
3: 4
4: 51
1106248577_1106248583 6 Left 1106248577 13:27967881-27967903 CCCAGCGACAGCAGCTCTCCCTG 0: 1
1: 0
2: 0
3: 26
4: 184
Right 1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG 0: 1
1: 0
2: 0
3: 4
4: 51
1106248578_1106248583 5 Left 1106248578 13:27967882-27967904 CCAGCGACAGCAGCTCTCCCTGG 0: 1
1: 0
2: 2
3: 22
4: 261
Right 1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106248583 Original CRISPR CTGCTCGCTGTACCTTGAAT TGG Intronic
903201680 1:21745171-21745193 ATGCTTGCTGTACCTTATATAGG - Intronic
912606417 1:110994107-110994129 CTGCTGGCTCTACTTTGATTTGG - Intergenic
912770361 1:112458203-112458225 CTGATTGCTGTTACTTGAATAGG + Exonic
915473197 1:156137892-156137914 CTCCTCCCTATACCTTGAACAGG + Intronic
921171125 1:212550845-212550867 TAGCTCACTGTAGCTTGAATTGG + Intergenic
1067354023 10:45507449-45507471 CTTCTCCCTGTATCATGAATGGG - Intronic
1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG + Intronic
1072005651 10:91244307-91244329 CTGCTCCCTTTACCTGGAATAGG - Intronic
1085506311 11:77062561-77062583 ATGCTTGTTGTACATTGAATTGG + Intergenic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1106735103 13:32581000-32581022 ATACTGGCTGTAGCTTGAATAGG - Intergenic
1118588733 14:67383459-67383481 CTGCTCTGTGTTCCTTAAATTGG - Exonic
1125083385 15:35701629-35701651 CTGTTCCCTTTTCCTTGAATAGG - Intergenic
1131680389 15:94715698-94715720 CTGCTCGCTTTGCCATGAAGTGG - Intergenic
1132251770 15:100340546-100340568 CTTCTCTCTGTACCTGGAACAGG - Intronic
1132332083 15:101019488-101019510 CAGCTAGCTGTACTGTGAATGGG - Intronic
1136530552 16:30865613-30865635 CTACTGCCAGTACCTTGAATTGG - Intronic
1137731574 16:50693980-50694002 CTGCTCTCTGTACCTCTTATGGG + Intronic
1140934105 16:79654731-79654753 CTGCCCACTGATCCTTGAATGGG + Intergenic
1141763351 16:86043390-86043412 CTGCCCGCTGTGCGGTGAATGGG + Intergenic
1146486613 17:33248256-33248278 CTTCTCACTGTTCCTTGAACAGG - Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1156987695 18:43368269-43368291 ATGCTTGCTGCAACTTGAATAGG - Intergenic
1157572859 18:48724421-48724443 CTTCTCGCTGTTCTTTGAACAGG + Intronic
1157726417 18:49967782-49967804 ATGCTGGCTGTACCTTGGAATGG + Intronic
941602241 2:167557929-167557951 TTGCTCCCTTTTCCTTGAATGGG - Intergenic
945143765 2:206715101-206715123 CTGCTCACTGTGGCTGGAATGGG + Intronic
947230054 2:227875497-227875519 CTCCTTGGTGTTCCTTGAATGGG + Intronic
948892108 2:240912531-240912553 CTGCCCCCTGTACCTTGACCTGG - Intergenic
1184179294 22:42809194-42809216 CTGCTCTCTCTACATTGTATAGG + Intronic
1184628862 22:45759902-45759924 GTGCTCTCTGTACCTTGACTGGG - Intronic
953066754 3:39480287-39480309 CTGCTCCCAGAACCTAGAATAGG - Intronic
956376590 3:68619983-68620005 CTGCGTGCTGTACTTTGAAGGGG - Intergenic
965246369 3:166276140-166276162 TTTTTCCCTGTACCTTGAATGGG + Intergenic
972999308 4:44925994-44926016 CTCCTTGCTGTCACTTGAATAGG - Intergenic
977406686 4:96608553-96608575 CTTCTCGCTGTACCTTCACATGG + Intergenic
978163886 4:105583413-105583435 CTGCTTCCTGTTCCTTAAATAGG + Intronic
984483270 4:180333429-180333451 CTCCTTGCTGTTCCTTGAACAGG - Intergenic
986105319 5:4654406-4654428 CTGCTCACTGGACCTTGCATTGG + Intergenic
998611791 5:143696915-143696937 CTGCTCGCTGTTACATGGATTGG + Intergenic
1003974200 6:11327437-11327459 CTGTTCGATGTACTTTAAATAGG - Intronic
1005385753 6:25282432-25282454 CTCCTTGCTGTTCCTTGAACAGG + Intronic
1007768676 6:44176723-44176745 CTCCTCTCTGTGCCTTGGATGGG + Intronic
1010176356 6:73032686-73032708 TGGCTTGCTGTACCTTGAACTGG - Intronic
1012943605 6:105442851-105442873 CTCCTCACTGTCCCCTGAATAGG + Intergenic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1021869302 7:24987776-24987798 CTGCTCACTGGGCCTGGAATGGG - Intergenic
1024576864 7:50771497-50771519 CTGCTGGCTGTACTTTGAACTGG - Intronic
1029524086 7:101084652-101084674 CTGCTCCCAGTACCTGGAACAGG + Intergenic
1039263749 8:35802268-35802290 CTCCTTGCTGCTCCTTGAATAGG - Intergenic
1052714049 9:32093355-32093377 CTGCTCCCGTTACCTAGAATTGG - Intergenic
1053351473 9:37416216-37416238 CTTCTCGCTTTAACTTGAAAAGG - Intergenic
1056952693 9:91056825-91056847 CTGCTGGCTGTACATTTATTTGG + Intergenic
1058975395 9:110121414-110121436 CTTCTCTGTGTGCCTTGAATTGG + Intronic
1060647873 9:125297561-125297583 CTTCTTGCTGTTCCTTGAACAGG - Intronic
1199828350 X:151523190-151523212 CTCCTGGCTTTACATTGAATAGG - Intergenic