ID: 1106248980

View in Genome Browser
Species Human (GRCh38)
Location 13:27969804-27969826
Sequence GTTTGGGGCTGCAGTCGTCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106248980_1106248986 10 Left 1106248980 13:27969804-27969826 CCCGGACGACTGCAGCCCCAAAC 0: 1
1: 0
2: 1
3: 9
4: 165
Right 1106248986 13:27969837-27969859 TCCAGTTATTTTCTTGCCCAAGG 0: 1
1: 0
2: 2
3: 19
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106248980 Original CRISPR GTTTGGGGCTGCAGTCGTCC GGG (reversed) Exonic
902091101 1:13903917-13903939 GACTGGGGCTGCAGTCACCCAGG - Intergenic
906205440 1:43984104-43984126 AATTGGGGCTGCAGGGGTCCTGG - Intronic
906360148 1:45149193-45149215 GTTTGAGGCTGCAGTGGGCTAGG + Intronic
907402317 1:54232791-54232813 GTTAGGGGCTGGAGACGGCCCGG - Intronic
908473174 1:64464337-64464359 GTTTGAGGCTGCAGTGAGCCAGG + Intergenic
912570740 1:110619186-110619208 GTTTGGGGGTACAGTCTCCCAGG - Intronic
913124629 1:115773503-115773525 TTGTGGGGCTGCATTCCTCCTGG - Intergenic
913482176 1:119299302-119299324 GTTTGGAGCTTCAGTCATCTGGG - Intergenic
916305305 1:163323583-163323605 GTGTGTGCCTGCTGTCGTCCTGG + Intronic
917444386 1:175094756-175094778 GTTTGCGCCTGCAGGGGTCCTGG + Intronic
918346086 1:183608589-183608611 TTTTGGGACTGCAGTTGACCAGG + Intergenic
920705667 1:208248743-208248765 GTTTGGGACTGCAGTTGCCTGGG - Intergenic
922744658 1:228037317-228037339 CTTTGGGGCTGGAGGGGTCCTGG - Intronic
922802815 1:228371907-228371929 GGTGGGGGCTGCAGCCCTCCTGG - Exonic
923021416 1:230167212-230167234 GTTTGAGGCTGCAGTGAGCCAGG - Intronic
924464792 1:244290329-244290351 ATTAGGGGCTGCAGTCATCAGGG - Intergenic
1063385351 10:5613120-5613142 GTATGAGGCTGCAGCAGTCCTGG + Intergenic
1063460712 10:6213449-6213471 GTTTGAGGCTGCAGTAATCATGG + Intronic
1063716235 10:8529891-8529913 GTTTGAGGCTGCAGTGAGCCAGG + Intergenic
1065322619 10:24523251-24523273 GTTTGAGGCTGCAGTGGGCTAGG + Intronic
1066390452 10:34973835-34973857 GTTAGGAGCTGCAGTTGTACTGG + Intergenic
1067801323 10:49361310-49361332 GTTGGGGCCTGCAGTCCTCGTGG - Intergenic
1067851182 10:49755619-49755641 GTAAGGGGCTGCAGCCCTCCTGG + Intronic
1069125767 10:64630741-64630763 GTTTGGGGCTGCAGTGAGCCAGG + Intergenic
1069815707 10:71192498-71192520 GTTTGAGGCTGCAGTGAGCCAGG + Intergenic
1075797942 10:125134637-125134659 GTCTGGGGCTGCTGTGGTGCGGG - Intronic
1077048540 11:556502-556524 GTTCCGGGCTCCAGTGGTCCGGG + Exonic
1077185583 11:1234064-1234086 GTTGGGGGCTGCAGGTGTCATGG + Intronic
1077314531 11:1912102-1912124 GTTTGAGGCTGCAGTGAGCCAGG + Intergenic
1084491379 11:69480379-69480401 GTGTGCGGCTGCAGACGTCACGG + Intergenic
1084770030 11:71336651-71336673 CTTTGGGGCTGGACCCGTCCAGG + Intergenic
1085024759 11:73229931-73229953 TTTTGGGGCTGCAGTTCTCAAGG + Intronic
1087728914 11:101756510-101756532 CCTTGGGGCTGCAGAAGTCCTGG + Intronic
1089469746 11:118711080-118711102 GTTTGGAGATGGAGTCGCCCAGG + Intergenic
1090636832 11:128694706-128694728 GGCGGGGGCTGCAGTCGCCCGGG + Intronic
1093925684 12:24906119-24906141 GGTTGAGGCTGCAGTGGGCCAGG + Intronic
1098381379 12:69873304-69873326 GTGTTGGGCTGCATCCGTCCTGG + Intronic
1098999532 12:77162173-77162195 CTTTGGAGCTGCAGTCTCCCAGG - Intergenic
1099260013 12:80367043-80367065 GTTTGAGGCTGCAGTGGGCTAGG - Intronic
1102937837 12:116912254-116912276 GTTTGAGGCTGCAGTGGGCCGGG - Intronic
1105605121 13:21920747-21920769 GCAGGGGGCTGCACTCGTCCGGG + Intergenic
1106248980 13:27969804-27969826 GTTTGGGGCTGCAGTCGTCCGGG - Exonic
1107264498 13:38536659-38536681 GATTGGGGCTGCAGCAGTCTCGG - Intergenic
1108316683 13:49243557-49243579 GTTTGGGGCTACAGTCTTTAGGG - Intergenic
1108816969 13:54304635-54304657 GTTTGTTGTTGCAGTCGACCTGG - Intergenic
1109303987 13:60618736-60618758 GGTTGGGGCTTCAGTCATCTGGG + Intergenic
1109428099 13:62194222-62194244 GAATGGGGCTACAGTGGTCCAGG + Intergenic
1113577571 13:111404928-111404950 GTTTGGGGCTGCAGGAGTGGAGG - Intergenic
1113591264 13:111502962-111502984 GTTTGGGGAGGGAGTTGTCCTGG + Intergenic
1113657140 13:112073886-112073908 GCCTGGGGACGCAGTCGTCCGGG - Intergenic
1113904948 13:113814874-113814896 GTTTGGGGGTGCTGTGGCCCCGG + Exonic
1113925016 13:113936720-113936742 GGTTGGGGGTGCAGTCGTCGGGG + Intergenic
1114259810 14:21028318-21028340 GTTTGGGGCTGCAGTGAACTAGG - Intronic
1118850137 14:69576716-69576738 GTTAAGGGCTGCAGAGGTCCAGG + Intergenic
1119202426 14:72766518-72766540 GTTTGAGGCTGCAGTGAGCCAGG - Intronic
1125757026 15:42071141-42071163 CTTTGTGGCTACAGTAGTCCTGG + Exonic
1127346402 15:58105137-58105159 GGTTGGGGCTGCAGTGAGCCAGG - Intronic
1129340820 15:74885347-74885369 GTTCGAGGCTGCAGTAGGCCTGG + Intergenic
1131259505 15:90881211-90881233 GCTTGGGGCTGCTGTGGTCCTGG + Intronic
1131501972 15:92976828-92976850 GTTTGAGGCTGCAGTGAGCCAGG + Intronic
1133212789 16:4272512-4272534 GTGTGGGGCTGCAGCCGTCCCGG + Intronic
1133705453 16:8350368-8350390 GTTTGGGGCTGCTGTTGACATGG - Intergenic
1135679945 16:24447795-24447817 GTTTGAGGCTGCAGTAAGCCAGG - Intergenic
1136099511 16:27983264-27983286 GTTTGAGGCTGCAGTGAGCCCGG + Intronic
1136316977 16:29460209-29460231 ATTTGAGGCTGCAGTGGGCCAGG - Intronic
1136431552 16:30199551-30199573 ATTTGAGGCTGCAGTGGGCCAGG - Intronic
1137521723 16:49200710-49200732 GTGTGCTGCTGCAGTCGCCCAGG - Intergenic
1138637469 16:58352474-58352496 GGTTGGGGCATCAGTGGTCCAGG + Intronic
1141569741 16:84927381-84927403 GTTTGAGGCTGCAGTGAGCCAGG + Intergenic
1144858359 17:18283671-18283693 ATTTGGGGCAGCAGTCTTCTGGG - Intronic
1147721756 17:42543779-42543801 GTTGAGGGCTGGAGGCGTCCTGG + Exonic
1147871108 17:43588256-43588278 GCTTGGGGCTGCAGTCAGCCAGG - Intergenic
1148633242 17:49128333-49128355 GTTTGGGGCTGAAGGCTTGCGGG + Intergenic
1149256360 17:54831742-54831764 GTTTGAGGCTGCAGTTAGCCAGG + Intergenic
1149508090 17:57212707-57212729 GTTTGAGGCTGCAGTGGGCTAGG - Intergenic
1151425894 17:74030877-74030899 GTTTGAGGCTGGAGTCTTCTGGG - Intergenic
1152298250 17:79480774-79480796 GGTGGGGGCTGCAGTTGCCCAGG - Intronic
1153444307 18:5154856-5154878 GTTTGAGGCTGCAGTGAGCCAGG - Intronic
1153544466 18:6191919-6191941 GTTTGGGGCTGCAGTGAGCTAGG + Intronic
1153566607 18:6425125-6425147 GTTTGAGGCTGCAGTGAGCCAGG + Intergenic
1156331986 18:36131103-36131125 GTTTGAGGCTGCAGTGGACGGGG + Intronic
1159015772 18:63100727-63100749 GTTTGGGGATGCAGCTGTCAGGG - Intergenic
1161148658 19:2695105-2695127 GTTTGAGGCTGCAGTGAGCCAGG + Intronic
1161571818 19:5035053-5035075 GGTGGGGGCTGCTGCCGTCCCGG + Intronic
1162668197 19:12232871-12232893 GTTTCTGCCTGCAGTCATCCTGG - Intronic
1163419402 19:17205785-17205807 GTGTGGGGCTGCAGAAGTCAAGG - Intronic
1164386930 19:27779762-27779784 GGTTGAGGCTGCAGTCATTCTGG - Intergenic
1164606793 19:29605433-29605455 GTTTAGGGCTGCAGTGAACCTGG - Exonic
1164730323 19:30498828-30498850 GTCTGAGGCTGCAGTCCTCCGGG + Intronic
1165316983 19:35061987-35062009 GTTTGAGGCTGCAGTGGGCTAGG + Intronic
1166216510 19:41339185-41339207 GGTTGTGGCTGCAGTCAGCCAGG - Intronic
1167559064 19:50214710-50214732 GTTTGAGGCTGCAGTGAGCCAGG + Intronic
1168092449 19:54095195-54095217 GTCTCGGGCTGCAGTGCTCCTGG + Exonic
925357716 2:3253867-3253889 GTTAGGGGCTCCTGTCCTCCTGG - Intronic
928421262 2:31138893-31138915 GTTTGGGGCAGCAGCCCTGCCGG - Intronic
928663309 2:33525806-33525828 GTTTGAGGCTGCAGTGAGCCAGG + Intronic
932307827 2:70716375-70716397 GGTTGGGGCTGGAGTCTGCCAGG + Intronic
932416025 2:71574374-71574396 ATGTGGGGCTGCACTTGTCCTGG + Intronic
935245554 2:101216164-101216186 GTTTGAGGCTGCAGTGAGCCAGG + Intronic
940266997 2:151849324-151849346 GTTTGGAGCTGCAGTGAGCCAGG - Intronic
942826039 2:180178087-180178109 GGTTGGGGCTGCAGTTGTCTGGG - Intergenic
948138561 2:235656082-235656104 AATGGGGGCTGCAGTCTTCCTGG - Intronic
1169915087 20:10675235-10675257 GTTTGGGGCTTGAGTTCTCCTGG + Intergenic
1173160210 20:40646816-40646838 GTCTGGGGCTCCGGTCTTCCTGG - Intergenic
1173406741 20:42772998-42773020 GTTTGGGGCTAAAGTGGACCTGG - Intronic
1174041339 20:47702124-47702146 GTTTGAGGCTGCAGTGAGCCAGG - Intronic
1174046128 20:47735144-47735166 TTTTTGGGCTGCAGTGGCCCTGG + Intronic
1175842953 20:62042042-62042064 ATTTAGGGCTGCAGGTGTCCAGG - Intronic
1177218807 21:18164063-18164085 GTTTTGGGTTGTAGTCATCCAGG + Intronic
1179904230 21:44413904-44413926 CATTGGGGCTGCAGTGCTCCGGG - Exonic
1181209092 22:21278211-21278233 GTTTGAGGCTGCAGTGAGCCAGG - Intergenic
1181502814 22:23327986-23328008 GTTTGAGGCTGCAGTGAGCCAGG + Intergenic
1182079551 22:27519172-27519194 ATCTGGGGCTGCAGTCCTCCTGG + Intergenic
1183587397 22:38760840-38760862 GTTGGGGGCTGCAGCCCTGCAGG - Intronic
1183624927 22:38996131-38996153 GTTTGGGGCTGGACTCCTGCTGG - Intergenic
1183904756 22:41032175-41032197 GTTTGAGGCTGCAGTGAACCAGG - Intergenic
1184566057 22:45292837-45292859 GTTTGAGGCTGCAGTGAGCCAGG + Intronic
949158168 3:851503-851525 GCTAGGAGCTGCAGTCGTACTGG + Intergenic
951864702 3:27294935-27294957 GTTTGGGGAGGCAGTGCTCCAGG - Intronic
954683656 3:52359197-52359219 GATTGGGGCTGCGGCTGTCCAGG + Intronic
955698632 3:61661139-61661161 GTTTGAGGCTGCAGTAGGCTAGG - Intronic
959087481 3:101866872-101866894 GTTTGGGCCTCCAGTGTTCCGGG + Intergenic
960057048 3:113283431-113283453 GTTGGGGGTGGCAGTCGACCAGG - Exonic
962351081 3:134656188-134656210 GTTTGGGGATGTAGCCTTCCTGG - Intronic
969397121 4:6929303-6929325 GTGTTGGGCTGCAGTTGTCAGGG + Intronic
974046469 4:56902965-56902987 GATTGGGGCTGCAGTGAGCCAGG - Intergenic
976423378 4:84871701-84871723 GTTTGAGGCTGCAGTGGGCTGGG - Intronic
998328714 5:141304713-141304735 GATTGGGGCTGCAGTGAGCCAGG - Intergenic
1001028187 5:168242008-168242030 CTTTGGGGCTGGAGACCTCCAGG - Intronic
1002172897 5:177385266-177385288 GTTTGGGGCTGGAGGGGGCCAGG - Intronic
1002765207 6:233309-233331 GTCTGGGGCTGCCGGCCTCCAGG + Intergenic
1002778737 6:350300-350322 CTCTGGGGCTGCAGGCATCCTGG + Exonic
1006569915 6:34994038-34994060 GTTTGAGGCTGCAGTGAACCAGG - Intronic
1006801427 6:36762182-36762204 GATTGGGGCTGCAGTGAACCAGG + Intronic
1013562109 6:111315942-111315964 GTTGGGGACTGCTGTGGTCCAGG + Intronic
1014828046 6:126068963-126068985 CTTTGGGCCAGCAGTTGTCCAGG + Intergenic
1015232689 6:130934539-130934561 GTTTGAGGCTGCAGTGAGCCAGG - Intronic
1017079088 6:150650101-150650123 ATTTGGGGCTGCAGTTTTTCTGG - Intronic
1021849254 7:24791567-24791589 GCTAGGAGCTGCAGTCGTACTGG - Intergenic
1021958691 7:25852176-25852198 GTTCGGGGCTCCAGGCGGCCGGG + Intergenic
1022108730 7:27214682-27214704 CTTTGGGGCTGCAGCCACCCAGG - Intergenic
1022246904 7:28569231-28569253 GTTTGAGGCTGCAGTAAGCCAGG - Intronic
1023248150 7:38229336-38229358 GTGAGGGGCTGCAGTGGACCTGG - Intronic
1023347536 7:39286829-39286851 GTTTGAGGCTGCAGTGAGCCAGG - Intronic
1023870414 7:44260364-44260386 GTATGGGGCTGCTGGAGTCCAGG - Intronic
1025078251 7:55962121-55962143 ATATGGGGTTGCAGTCTTCCTGG + Intronic
1026193786 7:68154295-68154317 ATTTGGGGGTGAAGTGGTCCAGG - Intergenic
1026843739 7:73685369-73685391 GCTTGAGGCTGCAGTCGGCAGGG - Intronic
1033015448 7:137666332-137666354 GTTTGAGGCTGCAGTGAGCCAGG + Intronic
1033033399 7:137847441-137847463 GTTTGGGGACGCAGGGGTCCGGG - Intergenic
1034424816 7:151008977-151008999 GTTTGGGGCTGAAGATGTCTCGG - Exonic
1035395308 7:158531160-158531182 GTTTGGGGCAGCTGTTGGCCGGG - Intronic
1035789397 8:2289898-2289920 GTTTAGGGATGCAGTCGTGAGGG - Intergenic
1035803408 8:2431807-2431829 GTTTAGGGATGCAGTCGTGAGGG + Intergenic
1038103689 8:24409456-24409478 GTTTGAGGCTGCAGTGAACCTGG + Intergenic
1038539300 8:28378307-28378329 GTTTGAGGCTGCAGTGAGCCAGG - Intronic
1040931823 8:52743163-52743185 GTTTGAGGCTGCAGTGAGCCTGG + Intronic
1041281153 8:56211791-56211813 GTTTGGAGCTGGAGACGGCCTGG + Exonic
1042652082 8:71054056-71054078 GATTGGGGCTGCAGTTATCTGGG - Intergenic
1044729457 8:95218498-95218520 GTTTTGCACTGCAGTCCTCCTGG + Intergenic
1049447470 8:142638037-142638059 GATTGGGGCAGCAGTGGTGCTGG - Intergenic
1050102455 9:2133348-2133370 GTTTGAGGCTGCAGTAAGCCTGG - Intronic
1050934714 9:11380471-11380493 GTTTAGGGCTGCAGGTATCCAGG + Intergenic
1051248789 9:15138227-15138249 GTTTGGGGGTGCAGTCCTAGGGG + Intergenic
1057445980 9:95115007-95115029 GGTTGGGGCTGCAGTGAACCAGG - Intronic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1060186744 9:121568288-121568310 GTTTGGAGCTGCAGCCCTCAGGG + Intronic
1061628083 9:131853857-131853879 GGTTGAGGCTGCAGTCAGCCGGG + Intergenic
1185777956 X:2820817-2820839 GTTTGAGGCTGCAGTGAACCAGG - Intergenic
1186022660 X:5273701-5273723 GTTTGAGGCTGCAGTAGGCTAGG + Intergenic
1187698018 X:21940612-21940634 GTTCGGGGCTGGAGGCGTCCCGG + Exonic
1191953992 X:66624719-66624741 GTTTGTTCTTGCAGTCGTCCTGG - Intronic
1192436279 X:71145494-71145516 TTTTGGGGCTGCAGCGGTGCTGG - Intronic
1196708859 X:118741833-118741855 GTTTGGGGTTGAATTTGTCCAGG + Intronic
1197131923 X:123015125-123015147 GTTTGAGGCTGCAGTGGGCTAGG + Intergenic
1200122385 X:153797330-153797352 GTTGGGGGCTGCAGTGTCCCTGG - Intronic