ID: 1106251242

View in Genome Browser
Species Human (GRCh38)
Location 13:27983169-27983191
Sequence TTTGGGGCACAGAAAGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 277}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106251242_1106251246 -4 Left 1106251242 13:27983169-27983191 CCTTGATCTTTCTGTGCCCCAAA 0: 1
1: 0
2: 2
3: 24
4: 277
Right 1106251246 13:27983188-27983210 CAAAAATGTCGAGTTCATCCTGG 0: 1
1: 0
2: 0
3: 9
4: 122
1106251242_1106251247 3 Left 1106251242 13:27983169-27983191 CCTTGATCTTTCTGTGCCCCAAA 0: 1
1: 0
2: 2
3: 24
4: 277
Right 1106251247 13:27983195-27983217 GTCGAGTTCATCCTGGTCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106251242 Original CRISPR TTTGGGGCACAGAAAGATCA AGG (reversed) Intronic
900384147 1:2401708-2401730 AGTGTGGTACAGAAAGATCAGGG + Intronic
901662107 1:10804916-10804938 TTTGGGGCAGAGGGACATCAGGG - Intergenic
902092344 1:13913503-13913525 TTTGGGGCCCTGTAAGGTCAGGG + Intergenic
902942511 1:19810812-19810834 TTCGAGGCACAGAAAGGTGAAGG - Intergenic
902975270 1:20083820-20083842 GTTGAGGCTCAGAAAGCTCAGGG - Intronic
903203114 1:21759559-21759581 TTTAGGGCACAGTAAGATGTAGG - Intronic
903234161 1:21938658-21938680 GTTGGGTCAGAGACAGATCATGG - Intergenic
903316463 1:22511786-22511808 CCTGGGGAACAGAATGATCAAGG + Exonic
903351923 1:22722413-22722435 TTTGGGGTAAAGAAATAGCAAGG + Intronic
903876226 1:26475107-26475129 TTTTAGGCACAGAAAGCTGAAGG + Exonic
904356419 1:29942964-29942986 TTTGGGGCACATCAAGAATAAGG + Intergenic
904400345 1:30252605-30252627 TCTGGGGCACAGCGAGACCAGGG + Intergenic
905037545 1:34927850-34927872 TTTGGGTCACTGAAAGACCTGGG + Intronic
905630049 1:39513591-39513613 TTTGGGGAAAAGATAGATGAAGG + Intronic
905667710 1:39772599-39772621 TTTGGGGAAAAGATAGATGAAGG - Intronic
907074406 1:51565293-51565315 TTTGGGGAACATAAGGTTCAAGG - Intergenic
907313827 1:53554913-53554935 TCTGGGGCACAGAAAGGAAAGGG + Intronic
909088647 1:71198330-71198352 TTTGAGGCACAGACAAATAAAGG + Intergenic
909696658 1:78475072-78475094 AATGAGGCACAGAAAGATTAAGG - Intronic
910626278 1:89311646-89311668 TTTGAGGCACAGAACAATAAAGG - Intergenic
910997943 1:93129117-93129139 TCTGGGGCAGATAAAAATCAAGG + Intronic
911611606 1:99964598-99964620 TTCTGGGAACACAAAGATCATGG + Intergenic
914450119 1:147784178-147784200 TTTGGGGCAGAGAAAGAAATGGG - Intergenic
916260541 1:162837592-162837614 TTTGGGGCACAGGCAAAACAGGG + Intronic
917453555 1:175166981-175167003 CTTGGAGCACAGAAAGGACAGGG - Intronic
917525891 1:175788155-175788177 TTTCGGAGGCAGAAAGATCAAGG - Intergenic
918878268 1:190080065-190080087 TTAGGGGCACTGAATTATCAAGG - Intergenic
919658619 1:200221707-200221729 TAGAGGGCACAGAGAGATCACGG - Intergenic
919777799 1:201205564-201205586 TTTGGGGCACAGATGGCTCTAGG + Intronic
919801278 1:201356131-201356153 GCTAGGGAACAGAAAGATCATGG - Intergenic
920091189 1:203454407-203454429 ACTGAGGCACAGAAAGGTCAAGG - Intergenic
921389033 1:214601014-214601036 TTTGGGTCTCAGAAAGTTGAAGG + Intergenic
921705630 1:218319565-218319587 TCTGGGACACAGAAAGCACAAGG - Intronic
922313379 1:224417955-224417977 TTTACTGCACATAAAGATCATGG - Intronic
922697304 1:227737081-227737103 GTTGGGGCACAGAGGGATCAGGG + Intronic
923867914 1:237960362-237960384 TGTGGGGCACAGAAGGGACAGGG + Intergenic
924048304 1:240054832-240054854 TTTGGATAACAGAAACATCAAGG + Intronic
924051044 1:240079853-240079875 TTTGGGGGACAGAAAAAGAATGG + Intronic
924293920 1:242566557-242566579 TCTGGGGCAAAGCAACATCAAGG - Intergenic
1063097097 10:2917848-2917870 TCTGGGGTTCAGAAAGACCAAGG - Intergenic
1063147136 10:3305842-3305864 TTTGGAACACAGAACGCTCAAGG + Intergenic
1064328519 10:14372817-14372839 TTGGGGGCACAGAAGGATCCTGG - Intronic
1067496807 10:46768104-46768126 TTTGGTGCACAGAGATATAAGGG + Intergenic
1067597846 10:47572299-47572321 TTTGGTGCACAGAGATATAAGGG - Intergenic
1068000799 10:51331769-51331791 TAGGGGGCAGAGAAAGATGATGG - Intronic
1069958113 10:72063906-72063928 TTTGGGATACAGAAGGATCCTGG - Intronic
1070506347 10:77116700-77116722 ATTGGGGCAGAGAAAGAAGAAGG - Intronic
1070664709 10:78334834-78334856 TAGGCGGTACAGAAAGATCAGGG - Intergenic
1070707358 10:78650066-78650088 TTAGTGGCAAAGAAATATCAAGG + Intergenic
1070998209 10:80805459-80805481 ATTGGGGCACAGCAAAAGCAAGG - Intergenic
1071226527 10:83536499-83536521 TTTTAGGCAATGAAAGATCATGG + Intergenic
1071353025 10:84765692-84765714 TGTGAGGGAAAGAAAGATCAAGG + Intergenic
1072250522 10:93578808-93578830 TTTGGAGCACATCAAGAACAAGG + Intronic
1072566190 10:96618699-96618721 TATGAGGCACAGCAAGGTCAAGG + Intronic
1072762187 10:98065834-98065856 TTTGGGGATCAGACAGATCTGGG - Intergenic
1074497294 10:113991351-113991373 CCTGGGGCCCAGAGAGATCAAGG - Intergenic
1074707058 10:116142463-116142485 TTTGGAGCACGGAAAGGTCTTGG - Intronic
1074825897 10:117215798-117215820 TTAGGTGCACAGAAACACCAAGG + Intergenic
1075210652 10:120488132-120488154 CTTGGGGAAAAGAATGATCAGGG + Intronic
1075219952 10:120576264-120576286 TTTGGGTCACAGACCTATCATGG - Intronic
1076350573 10:129812209-129812231 GTTGGGGCAAAAGAAGATCAGGG + Intergenic
1076399672 10:130173426-130173448 TTTGGCGCCCAGCAAGAGCATGG - Intronic
1081724653 11:45319784-45319806 TTTGGTGCAGAGAAACATCTGGG + Intergenic
1082744963 11:56951199-56951221 TATAGGGGACAGAAAGATCAAGG + Intergenic
1083015005 11:59444050-59444072 TTTGAGGAACAAAGAGATCAAGG + Exonic
1083279677 11:61619240-61619262 GCTGGGGCATAGAAAGAACAAGG - Intergenic
1084726153 11:70943518-70943540 TTTAGGGCACAGCAAACTCATGG + Intronic
1084737618 11:71115878-71115900 TTTCTGGCACAGAAAAGTCAAGG - Intronic
1084765740 11:71307171-71307193 TTAGGGGCACAGAGATATTAAGG - Intergenic
1090034279 11:123234905-123234927 CTTTGGGGACAGAAAGATCTGGG + Intergenic
1091633488 12:2179898-2179920 TTTGAAGCAGAGAAAGAGCATGG - Intronic
1091785950 12:3243564-3243586 CTTAGGGCACAGCCAGATCACGG + Intronic
1093665474 12:21807721-21807743 TTTGGAAGACAGAAAGATCTTGG + Intronic
1094066661 12:26368901-26368923 TTTGGGGAAATGAAAAATCAGGG + Intronic
1094221012 12:27993618-27993640 TTTGGAGAAGAGAAAGATCTTGG + Intergenic
1094396414 12:30011303-30011325 TTTGGGGCTAAGAAAGAAAATGG - Intergenic
1095249801 12:39965180-39965202 TTTGGGGCAAAGAAAATTGAAGG - Intronic
1095877082 12:47090974-47090996 TTGGGGGAACAGAATGTTCATGG - Intronic
1097904871 12:64909419-64909441 TTGGGGGCACATAAACCTCAAGG - Intergenic
1101641702 12:106589889-106589911 TTTGGGGCACAGACAAATCTTGG + Intronic
1102925657 12:116824112-116824134 TGTTGGGCACAGAAATACCATGG - Intronic
1104460152 12:128948746-128948768 TTTGGGGTCCAGAGAGAACATGG + Intronic
1106251242 13:27983169-27983191 TTTGGGGCACAGAAAGATCAAGG - Intronic
1108715498 13:53074344-53074366 TTTGAGGCTCAGAGAGATAAGGG - Intergenic
1110269846 13:73576913-73576935 TATGGGGCATAAAAAGCTCAGGG + Intergenic
1112291856 13:98150871-98150893 TTTGGCACACAGAAGGATTATGG + Intronic
1112747040 13:102538291-102538313 TTTAGTCAACAGAAAGATCATGG - Intergenic
1112939982 13:104849569-104849591 TTGGGGACAATGAAAGATCAAGG + Intergenic
1113230111 13:108204347-108204369 TTTGGAGCATAGAAAAAACATGG - Intergenic
1113629191 13:111869426-111869448 CTTGGGGCACAGGAAGAGGATGG - Intergenic
1113641597 13:111961515-111961537 TTTGGGGCCCAGAAAGATTGAGG - Intergenic
1113753543 13:112792827-112792849 TTTGGGGCACAGAATTCACATGG + Intronic
1114584931 14:23802631-23802653 TCTGGAGCCCAGGAAGATCAAGG + Intergenic
1115442225 14:33448941-33448963 TTTTGGCCACAGACATATCAGGG - Intronic
1116439503 14:44936225-44936247 AGTGGGGCAGAGAAAGACCATGG + Intronic
1116534966 14:46017062-46017084 ATTGGGGCACAGAGATATAAGGG + Intergenic
1117021747 14:51577905-51577927 ATTGAGGCAACGAAAGATCAAGG - Intronic
1117293999 14:54362280-54362302 TGTGAGGCACAGCAAGAACACGG - Intergenic
1118733478 14:68685637-68685659 TTTGGGGCACAGGAAGGGGAGGG - Intronic
1119672702 14:76531518-76531540 CTTCAGGCACAGAATGATCAAGG - Intergenic
1121597244 14:95173822-95173844 TCTAGGGCACAGAAAGAGGAAGG - Intergenic
1124236224 15:27991525-27991547 TTAGAGAAACAGAAAGATCAGGG + Intronic
1126506848 15:49414561-49414583 TTTGGGGCAGAGAAATAACATGG + Intronic
1127249945 15:57223220-57223242 TTTGGGGGACAGATAGACCTGGG - Intronic
1127281048 15:57493326-57493348 TTTGGGCCACAGACAGATTTTGG + Intronic
1128323939 15:66711476-66711498 CTTGGGGCACAGACAGATATGGG - Intronic
1128585531 15:68846330-68846352 TATGGGGCACAGGAAGTACAAGG + Intronic
1128644682 15:69367721-69367743 ATTCGGGCACAGAAAGTTTATGG + Intronic
1129234786 15:74217601-74217623 TTTGGGGGAGAGAAAGACCCTGG + Intergenic
1130708901 15:86260137-86260159 TTGGAGGCACAGCAAGAGCAAGG + Intronic
1133449498 16:5891734-5891756 TGTGGGGCCCAGAAAGTTCCTGG + Intergenic
1135186926 16:20323334-20323356 TTAGGGGCACAGAGAGATTAAGG - Intronic
1136448351 16:30337674-30337696 TTTGGGCCATTGAAAGAGCATGG + Intergenic
1138446394 16:57066811-57066833 TTCGGGGAACTGAAAGTTCATGG - Intronic
1138862997 16:60781861-60781883 TTTGAGGCTCAGAAAGATGACGG - Intergenic
1139254537 16:65528459-65528481 TTTGGAGAACAGAAAGCTGAGGG + Intergenic
1139428158 16:66895840-66895862 TTTGGGGCAGTGGAAGATAAAGG - Intergenic
1140192163 16:72827413-72827435 AATGAGGCACAGAAAGGTCAAGG + Intronic
1140479381 16:75254166-75254188 TTCGGGGCACAGAAGGGACAGGG + Intronic
1141231691 16:82173178-82173200 TCAGGTGCATAGAAAGATCAAGG - Intergenic
1142047522 16:87935157-87935179 TTTGGGCCATTGAAAGAGCATGG - Intronic
1143303818 17:5930294-5930316 TGTGGGGCAGAGGAAGACCAAGG - Intronic
1144248878 17:13395780-13395802 TTTGAGGGACTGAAAGACCAGGG - Intergenic
1144639531 17:16929985-16930007 TTTGGGGCCCTGAAGGAGCAAGG + Intronic
1146503813 17:33387270-33387292 ATTGAGGCTCAGAAAGATTAAGG + Intronic
1147943320 17:44065931-44065953 TTTGGGGGAGAGTAAGTTCAGGG - Intronic
1148382483 17:47209934-47209956 TATGGAGAACAGACAGATCATGG + Intronic
1150251836 17:63709853-63709875 TCTGGGGCACAGAAAGAAGGAGG + Intronic
1151015888 17:70552301-70552323 TTTGGGTCACCTAAAGTTCAAGG - Intergenic
1152574179 17:81132921-81132943 CTTGGGGCACTGTAAGAACAAGG - Intronic
1152822299 17:82443574-82443596 TTTGGGCCACAGCAAGACCTCGG - Exonic
1155134586 18:22976764-22976786 TTTGGTACTCATAAAGATCAAGG - Intronic
1155890496 18:31262095-31262117 ATTGGGGTAAAGAAAGAGCAAGG + Intergenic
1157604218 18:48915589-48915611 TTTGGGGGTCAGACAGATCTGGG - Intergenic
1159699109 18:71602220-71602242 TTTGGGGTACATAAATATAAAGG - Intergenic
1161661546 19:5549629-5549651 ATTGGGGCACAAAGAGGTCAGGG - Intergenic
1162098098 19:8322754-8322776 TTTGGCGCACAGAAGGGTCCAGG - Exonic
1163115401 19:15185854-15185876 TTTGGGGACCAGAATGATCTGGG - Intronic
1165145086 19:33725571-33725593 TTTGGGGCAAAGGAAGGTGAAGG - Intronic
1166228419 19:41411488-41411510 TTTGGGGCACAGCTAGATCCAGG + Intronic
1166516883 19:43453868-43453890 ACTGAGGCACAGAAAGATGATGG + Intergenic
925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG + Intronic
925616455 2:5748583-5748605 AGTGAGGCACAGAGAGATCAGGG - Intergenic
926261965 2:11272515-11272537 TTTGGGGCACATAATGAATAAGG + Intronic
926296728 2:11574382-11574404 TTTGGGTCACAGAAGGCTCTTGG + Intronic
932893503 2:75616100-75616122 GTGGGGGCTCAGAAAGACCAAGG - Intergenic
932954039 2:76330584-76330606 TTTGGAGCAGAAAGAGATCAAGG + Intergenic
935205872 2:100896089-100896111 CCTGGGGCACAGAAAGCTCTAGG - Intronic
936491280 2:112974622-112974644 TTTGGGGCAAAGAAGGCTAAGGG + Intronic
940229747 2:151438058-151438080 TTTGGGGCAGAGATTGTTCACGG - Intronic
940696564 2:156986421-156986443 TTTGGGGCAAGGACAGAACACGG - Intergenic
940742821 2:157530429-157530451 ATTGGGGCAGAGAAAACTCAGGG - Exonic
941273049 2:163454404-163454426 TTTGGGCCACAAATAGATCAGGG - Intergenic
943013208 2:182477442-182477464 ATTGAGGCTCAGAAAGGTCAAGG + Intronic
944123129 2:196262865-196262887 CTTGGGGAACACAAAGATAAAGG - Intronic
944738596 2:202590206-202590228 GTTGGGGCACAGAAAAAAGAGGG - Intergenic
945375907 2:209079087-209079109 ATTGGGGCACAGAGATATAAGGG - Intergenic
1168928721 20:1604172-1604194 CTTGTGGCACAGACAGATCCAGG + Intronic
1169689699 20:8316725-8316747 TTTGGGAGACAGAAAGACGAGGG + Intronic
1169879276 20:10328942-10328964 CTTGGGGCCCAGAAAAATCAGGG - Intergenic
1170307100 20:14950623-14950645 CTTGGTGCACAGAAACTTCAGGG + Intronic
1170427756 20:16252281-16252303 TTTGGGGCACATAAAGCTCAGGG + Intergenic
1173330529 20:42072578-42072600 GTTGAGGCTCAGAAACATCAAGG - Intergenic
1173781460 20:45760411-45760433 ATTGGGGCACAGAGATATAAGGG - Intronic
1178024051 21:28444830-28444852 AATGAGGCACAGAAAGATGAAGG + Intergenic
1178315174 21:31560825-31560847 TTTGGGGCACTGAAAAAACATGG + Intergenic
1179008018 21:37531592-37531614 CTGGGGGCACAGCAAGAACAGGG - Intergenic
1180162710 21:46005507-46005529 TTTGGGGCAGAGCAAGAAGAGGG + Intergenic
1180211036 21:46295654-46295676 TTTGGGGCACAGGCAGCACAGGG - Intronic
1180723006 22:17923344-17923366 TTTGGAGCCCAGAGAGGTCATGG - Intronic
1181090178 22:20467149-20467171 TCTGGGTCACAGAGAGGTCAAGG - Intronic
1182134121 22:27884486-27884508 TTTGGGTCACAGAATGTGCAGGG - Intronic
1182280069 22:29213464-29213486 GGTGTGGCACAGAAAGATGAAGG + Intronic
1182694598 22:32188228-32188250 GTTGGGTCTCAGGAAGATCATGG - Intergenic
1183144942 22:35981819-35981841 TTTGAGGCCCCAAAAGATCAAGG + Intronic
1184200392 22:42964665-42964687 TTTGGGGCATGCAAAGTTCAGGG - Intronic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1184828465 22:46969064-46969086 TTTGGGGGTCAGAATGATTAGGG - Intronic
950019795 3:9779289-9779311 TTTGGGCCACTGAAACATGATGG + Intronic
950907012 3:16547938-16547960 TTTTGGACACAGACTGATCAAGG - Intergenic
953125726 3:40090177-40090199 GATGAGGCCCAGAAAGATCAGGG - Intronic
953165809 3:40463907-40463929 TTTGGGGCAGTAAAAGATCCTGG + Intergenic
953355108 3:42249319-42249341 TCTGGGGCACAGACAGCTCCAGG + Intergenic
955299615 3:57764722-57764744 ATTGAGGCACAGAGAGATCTTGG + Intronic
955319283 3:57962616-57962638 ATTAAGGCACAGAAAGGTCAAGG - Intergenic
955391918 3:58528164-58528186 AATGAGGCACAGAGAGATCAAGG - Intronic
956390480 3:68767628-68767650 TTTGGGACACAGAAAGATGAGGG + Intronic
957295075 3:78325020-78325042 TTTGGGGCACAAAGAGGTCAGGG - Intergenic
960311490 3:116121683-116121705 ATTGGAGCACAGATAGATAAAGG + Intronic
961590101 3:127972647-127972669 TTTGGAGCACAGAAATTGCAAGG + Intronic
962030270 3:131592298-131592320 ACTGAGGCACAGAAAGATGAAGG + Intronic
962145192 3:132833256-132833278 TTGGGGGCAAAGAAAAATGAAGG + Intergenic
962615562 3:137122858-137122880 TCACGGGCACAGCAAGATCAAGG + Intergenic
962957909 3:140283314-140283336 TTTGGCCCTCAGAAAGATGAAGG - Intronic
962996209 3:140631305-140631327 TTTTGGGAACAGAAAGATTAGGG - Intergenic
963007995 3:140744133-140744155 AGAGGGGCTCAGAAAGATCATGG + Intergenic
964691669 3:159456598-159456620 TTTGGGGGACAGAAGGAAGAGGG + Intronic
965320210 3:167244587-167244609 TTTAGGTAACAGAAAAATCAAGG + Intronic
965574457 3:170204245-170204267 TTTGGGCCACAGATAAATCAGGG - Intergenic
967216329 3:187213582-187213604 AGTGGGTCACAGAAAGACCAGGG + Intergenic
968015067 3:195322594-195322616 TTTGGGGGAAAAAAAAATCAGGG + Intronic
969322881 4:6423764-6423786 TTTGAGGAACTGAAAGATCAGGG + Intronic
973946598 4:55962884-55962906 TTTGAGCCACAGAGAGATGAAGG - Intronic
974369150 4:60991709-60991731 GTTGGGGCACAGCCAAATCAGGG - Intergenic
974941731 4:68477607-68477629 TTTGGAGCACTGAAAAATGATGG + Exonic
978570621 4:110132934-110132956 TGTGGGACATAGAAATATCAGGG + Intronic
980012184 4:127609000-127609022 TTTGGAGCAAGGAAAGTTCAAGG + Intergenic
980012280 4:127610117-127610139 TTTGGAGCAAGGAAAGTTCAAGG + Intergenic
981813026 4:148796874-148796896 ATTGGAGCAGAGAAAGATCAGGG + Intergenic
988807711 5:34755880-34755902 ACTGAGGCACAGAAAGATTATGG + Intronic
990023459 5:51157302-51157324 TTAAGGGAACAGAAAGAACATGG + Intergenic
991160417 5:63492666-63492688 TGTTGGGCACAGACAGATTAAGG + Intergenic
991251102 5:64562430-64562452 TTTGAGGCACTGAGAGATTAAGG + Intronic
992491849 5:77252226-77252248 TTTGGGGCACAGATGAATCTGGG + Intronic
994979391 5:106854349-106854371 ATTGTGGCACAGAAAGATGAAGG - Intergenic
996351192 5:122543731-122543753 TTGGGGGAAAAGAGAGATCATGG - Intergenic
996598019 5:125227281-125227303 TTTGGGGCACAGAGGGATAATGG + Intergenic
996876881 5:128250217-128250239 TTTGGGGCAAAGAAACAATAGGG - Intergenic
997117958 5:131146170-131146192 TGTGGGGCAGGGAAAGTTCAAGG - Intergenic
998172653 5:139881596-139881618 CTTGGGGAACAAAAAGATCCTGG + Intronic
998230247 5:140357183-140357205 TTGGGGCCACAGAAAGGGCAAGG + Intergenic
999070354 5:148737689-148737711 TTTGGGGCACAGTTTGATCTAGG - Intergenic
999229819 5:150055141-150055163 TTTTGGACAGGGAAAGATCAGGG + Intronic
1001429688 5:171649440-171649462 TTTAGGGTACAGAAAAATCGGGG + Intergenic
1001494645 5:172179307-172179329 TTTGGGGCTCAGTAGGATCTGGG - Intronic
1001554222 5:172625265-172625287 CTTTGGGCACAGAAAGATCTGGG + Intergenic
1002584661 5:180235745-180235767 TTTGGGGCTGAGAATTATCACGG - Exonic
1003692174 6:8365598-8365620 TTTTGTGGACAGACAGATCAGGG + Intergenic
1004868062 6:19873828-19873850 TTTGGAGCACATAAAGAAGATGG - Intergenic
1004956893 6:20737135-20737157 ATGGAGGCACAGAAAGCTCAGGG - Intronic
1006336399 6:33423170-33423192 TTGGGGGCAGAGAAAGATGAAGG - Intronic
1006504216 6:34477504-34477526 CCAGGGGCACAGAAAGATGAGGG + Intronic
1006520730 6:34569528-34569550 TTTGAGGCACAGAGAGGTTAAGG + Intergenic
1007110737 6:39312290-39312312 TCTGGTGCTCAGAAAGATCTGGG + Intronic
1008284535 6:49631614-49631636 GTTGGGGCAAAGAAAGCACAAGG - Intronic
1008665984 6:53716975-53716997 TTTTAGGCACAAAAAGATAAAGG + Intergenic
1009290904 6:61881054-61881076 TTTGGGCCACAGAAACCTCGTGG + Intronic
1009305125 6:62079955-62079977 TTTTGGCCACAGAAAACTCATGG - Intronic
1009925290 6:70113469-70113491 TTTGGTGCACAGAAACTCCAAGG - Intronic
1010567625 6:77435827-77435849 TTTGGAGCACAAAGAGAACAGGG + Intergenic
1011637124 6:89384866-89384888 TGTGGGGCAGAGAAAGATATAGG - Intronic
1017543580 6:155427729-155427751 TTTGGGGCTCTGGAAGAACAGGG - Intronic
1017613308 6:156214130-156214152 CTTGGGGCCCATGAAGATCAAGG + Intergenic
1018971349 6:168531565-168531587 TTTGGGGAACAGGAAAATTAAGG + Intronic
1020869061 7:13605102-13605124 TTTGTGCCACAGAAAGCTCATGG - Intergenic
1020933760 7:14433399-14433421 TTTGGGGGTCAGAGAGATCTGGG + Intronic
1023661725 7:42477550-42477572 TGTTGGATACAGAAAGATCAGGG + Intergenic
1024692962 7:51822837-51822859 CTTGGGGCAGAGAAAAAGCAAGG - Intergenic
1025615230 7:63112546-63112568 CCAGGGGCACAGAAACATCATGG - Intergenic
1025790881 7:64685808-64685830 TTTGGGGCTTAGGAAGATTAGGG - Intronic
1028596306 7:92549429-92549451 TTTGGTGCTTATAAAGATCATGG - Intergenic
1029045533 7:97623939-97623961 TTTGGAAAACAGAAAGATTAGGG + Intergenic
1029409222 7:100398090-100398112 TTTAGGGGACAGAAAGCCCAAGG - Intronic
1031161706 7:118176693-118176715 TATGGGGCAGAAAAAAATCAAGG - Intergenic
1033258476 7:139821887-139821909 TTCGTGCCACAGAAAGACCAAGG - Intronic
1038529494 8:28306313-28306335 TTTGGGGTAAAGAAAGTGCAAGG + Intergenic
1038627661 8:29209726-29209748 TCTAGGGCACAGAAAGATAGAGG + Intronic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039550294 8:38438585-38438607 ACTGGGGCACAGAAAGATTTGGG + Intronic
1045197301 8:99944823-99944845 ATTGGGGCACAGAGATATGAGGG - Intergenic
1045330398 8:101151134-101151156 TTTAAGGAACAGAAAGAACAGGG - Intergenic
1050230037 9:3514182-3514204 CTTGAGGCAAAGAAAGATTAGGG - Intronic
1051126867 9:13814604-13814626 TGTGGAGGACAGAAAGACCAAGG - Intergenic
1052109106 9:24558430-24558452 CTTGGGGCTCAGACAGATCTGGG - Intergenic
1052301920 9:26961627-26961649 TTAGGGGCAAAGAAAGATGTTGG + Intronic
1055438685 9:76317974-76317996 TTTGTGGCACAGCAATATTATGG + Intronic
1055892990 9:81142968-81142990 TTGGGGGAATAGAAAGACCAAGG - Intergenic
1057843644 9:98505681-98505703 CTTGGGGCACAGAGACATGAAGG + Intronic
1057952650 9:99382151-99382173 TTTGAGGCAAAGGAAGATGAAGG - Intergenic
1057963475 9:99479433-99479455 TTTGGGGGACATAAAGATAAAGG - Intergenic
1058732566 9:107864394-107864416 TTGGGGGAACTGAAAGATGATGG - Intergenic
1061648213 9:132023937-132023959 TTTTGGGAACAGGAAGAACAAGG + Intronic
1062140841 9:134958000-134958022 TTCTGGGCACAAAAAGAACATGG + Intergenic
1062175452 9:135159605-135159627 ATTGAGGCACAGAAAGATGGGGG + Intergenic
1186792424 X:13011940-13011962 TCTGAGGCTCAGAAAGATGAAGG - Intergenic
1186864344 X:13704369-13704391 TTTTGGGCTGAGAAAGGTCATGG + Intronic
1186865902 X:13720702-13720724 TCTGAGGCACTGAAAGATCTTGG + Intronic
1187494924 X:19787152-19787174 GTTGTGGACCAGAAAGATCAAGG - Intronic
1188290582 X:28382737-28382759 TTTGGTGGGCAGAAAGATCTGGG - Intergenic
1188539693 X:31235944-31235966 TTTGTAGCAGAGAAAGACCAAGG - Intronic
1188956447 X:36439768-36439790 TCTGGGGCAAAGAAAGAACTAGG - Intergenic
1189036029 X:37494052-37494074 CTTGGGGCAGATAAAGGTCAAGG - Intronic
1189037544 X:37507600-37507622 CTTGGGGCAGATAAAGGTCAAGG - Intronic
1189174729 X:38944687-38944709 TTTGGGGCATATTAAGTTCAAGG - Intergenic
1189223987 X:39397354-39397376 TTTGAGGCACAGAGAGGTCAAGG - Intergenic
1189689089 X:43596854-43596876 CTTAGGGCACAGGGAGATCAAGG - Intergenic
1190894605 X:54604789-54604811 ACTGAGGCACAGAAAGATTAAGG - Intergenic
1192273922 X:69610991-69611013 TTTGGGGAACAGCAAATTCAGGG + Intergenic
1194690186 X:96974725-96974747 TTGGGGGCATAGAATCATCAAGG + Intronic
1195691645 X:107630825-107630847 ATTGGGGCAAAGAAAGGTTAAGG - Intronic
1195701924 X:107712159-107712181 TTTGTGGCTCAGGAAAATCAAGG + Intergenic
1195860853 X:109381235-109381257 TTTTGGGCAAAGCAAGAGCAGGG - Intronic
1196046935 X:111266312-111266334 TTTGAGGCACAAAGAGAACAAGG - Intronic
1198432796 X:136584629-136584651 GTTTGGACACAGAAAGAACAGGG - Intergenic
1198875371 X:141219247-141219269 TTTGTGGCACATAAACACCATGG - Intergenic
1199134383 X:144233565-144233587 TTGAGGGCTCAGAAAGATGAGGG + Intergenic
1202162421 Y:21948992-21949014 TTTGGGGGAAAAAAAAATCAAGG + Intergenic
1202169798 Y:22031342-22031364 TTTGAGGCACAGATCGTTCATGG - Intergenic
1202221568 Y:22555031-22555053 TTTGAGGCACAGATCGTTCATGG + Intergenic
1202228935 Y:22637381-22637403 TTTGGGGGAAAAAAAAATCAAGG - Intergenic
1202314219 Y:23558784-23558806 TTTGGGGGAAAAAAAAATCAAGG + Intergenic
1202321550 Y:23640641-23640663 TTTGAGGCACAGATCGTTCATGG - Intergenic
1202549217 Y:26029415-26029437 TTTGAGGCACAGATCGTTCATGG + Intergenic
1202556583 Y:26111811-26111833 TTTGGGGGAAAAAAAAATCAAGG - Intergenic