ID: 1106253284

View in Genome Browser
Species Human (GRCh38)
Location 13:28000306-28000328
Sequence GAGCCACTGCGCCACTGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106253282_1106253284 2 Left 1106253282 13:28000281-28000303 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1106253284 13:28000306-28000328 GAGCCACTGCGCCACTGCGCCGG 0: 1
1: 0
2: 2
3: 11
4: 136
1106253283_1106253284 1 Left 1106253283 13:28000282-28000304 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1106253284 13:28000306-28000328 GAGCCACTGCGCCACTGCGCCGG 0: 1
1: 0
2: 2
3: 11
4: 136
1106253274_1106253284 27 Left 1106253274 13:28000256-28000278 CCTGGTGATCCACCTGCCTCAGC 0: 96
1: 3154
2: 14876
3: 38989
4: 66460
Right 1106253284 13:28000306-28000328 GAGCCACTGCGCCACTGCGCCGG 0: 1
1: 0
2: 2
3: 11
4: 136
1106253275_1106253284 18 Left 1106253275 13:28000265-28000287 CCACCTGCCTCAGCCTCCCAAAG 0: 25296
1: 77323
2: 157079
3: 168016
4: 148902
Right 1106253284 13:28000306-28000328 GAGCCACTGCGCCACTGCGCCGG 0: 1
1: 0
2: 2
3: 11
4: 136
1106253276_1106253284 15 Left 1106253276 13:28000268-28000290 CCTGCCTCAGCCTCCCAAAGTGC 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
Right 1106253284 13:28000306-28000328 GAGCCACTGCGCCACTGCGCCGG 0: 1
1: 0
2: 2
3: 11
4: 136
1106253278_1106253284 11 Left 1106253278 13:28000272-28000294 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1106253284 13:28000306-28000328 GAGCCACTGCGCCACTGCGCCGG 0: 1
1: 0
2: 2
3: 11
4: 136
1106253280_1106253284 5 Left 1106253280 13:28000278-28000300 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1106253284 13:28000306-28000328 GAGCCACTGCGCCACTGCGCCGG 0: 1
1: 0
2: 2
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106253284 Original CRISPR GAGCCACTGCGCCACTGCGC CGG Intergenic
900123871 1:1060923-1060945 CAGCCACGGTGCCACTGCTCAGG - Intergenic
901428574 1:9198842-9198864 GAGACCCTGCACCACTGCTCCGG - Intergenic
901793723 1:11668438-11668460 GCGCCACTGCACCCCTGCCCGGG - Intronic
902268601 1:15287105-15287127 GAGCCACTGTGCCCCTGCCCTGG - Intronic
906146909 1:43565769-43565791 GAGCCTCTGCGCCCCTTCCCAGG - Intronic
906708426 1:47911671-47911693 GAGCCACAGCTCCAGAGCGCAGG + Intronic
910885215 1:91956894-91956916 GAGCCACTGCACCCCTGCTTGGG + Intronic
912562576 1:110561163-110561185 GAGCCACTGCACCACTAGCCAGG - Intergenic
914676577 1:149911025-149911047 GATCCCCTGCCCCACTGCTCTGG + Intronic
915269845 1:154746271-154746293 GGGGCACGGGGCCACTGCGCAGG + Intronic
920826624 1:209429033-209429055 GAGCCACTGCACTCCTGCCCGGG - Intergenic
1062813255 10:481131-481153 GACCCACTGCGCACCTGCCCCGG + Intronic
1067072679 10:43146688-43146710 GAGGCACTGCGCTACAGCTCTGG + Intronic
1067108696 10:43383251-43383273 GAGCCACTGCGCCAGGCCTCAGG + Intergenic
1068139465 10:52986968-52986990 GCGCCACTGCACCACAGCCCAGG + Intergenic
1070804497 10:79263128-79263150 CTGTCACTGCGCCACTGCGCTGG - Intronic
1072958428 10:99907436-99907458 GAGCCACTACACCACTGCCTGGG - Intronic
1074751757 10:116593671-116593693 GAGCCACTGCGCACCTGGCCAGG - Intronic
1075265619 10:120998040-120998062 CAGCCACTGTGCCAATGCCCTGG + Intergenic
1076155834 10:128205027-128205049 GAGCCACTGCACCTCTGCCTGGG - Intergenic
1080684475 11:34503981-34504003 GAGCCGCTGCTTCACTGCCCAGG + Intronic
1081689815 11:45070280-45070302 GAGCCACTGCGCCTGGGCCCTGG - Intergenic
1084709472 11:70835152-70835174 GAGCCACAGCCCCAGTGCACAGG + Intronic
1085215382 11:74826281-74826303 GAGCCACTGCACTACTGCCTGGG + Intronic
1093938671 12:25028938-25028960 ATGCCACTGCACTACTGCGCAGG - Intronic
1097432385 12:59526305-59526327 GAGCCACTGCGCCCGGCCGCAGG + Intergenic
1106253284 13:28000306-28000328 GAGCCACTGCGCCACTGCGCCGG + Intergenic
1107891547 13:44918816-44918838 GAGCCACAGCTCCTCTCCGCCGG - Intergenic
1115181360 14:30629858-30629880 GAGCCACTGTGCCACAGCCAGGG + Intronic
1116186301 14:41605283-41605305 GAGCCGCTGAGGGACTGCGCAGG - Intergenic
1119604902 14:76007141-76007163 GAGCCACTGCGCCTGTGCTGGGG + Intronic
1122732893 14:103814659-103814681 GAGCCACCGCGCCCCGCCGCCGG - Intronic
1123011483 14:105351800-105351822 GAGCCACTGCCCCACAGCCTGGG + Intronic
1125429410 15:39580721-39580743 AAGCCCCTGCGCCACCCCGCGGG + Intergenic
1125756892 15:42070622-42070644 GAGCCCCTGCCCCACACCGCCGG - Intronic
1126004096 15:44240139-44240161 GTGCCACTGCACTACTGCCCGGG + Intergenic
1129771466 15:78205995-78206017 GAGCCTCTGCGCTACAGCGTGGG - Intronic
1133777905 16:8912165-8912187 GAGCCACTGAGCCACTGCACTGG - Intronic
1137594854 16:49716758-49716780 GAGCCACTAGGCCAGTGGGCTGG + Intronic
1139488396 16:67272050-67272072 GGGCCACTGCTCCATTGCTCTGG + Exonic
1141065229 16:80908699-80908721 GAGCCACTGCACTCCTGGGCAGG + Intergenic
1142300849 16:89257108-89257130 GAGTCACTGCGCCCCAGCGCGGG - Intergenic
1142855125 17:2724800-2724822 CAGCCACCGCGCCACCGTGCTGG - Intergenic
1143248908 17:5507849-5507871 GAGCCACTGCGCCTGGCCGCTGG - Intronic
1144779793 17:17802036-17802058 GAGCCACAGTGCCACCGTGCTGG - Intronic
1149318587 17:55461941-55461963 GATCCACTGAGCCACTGATCTGG + Intergenic
1151836936 17:76587971-76587993 GAGCCACTGCGCCAGGCCTCAGG + Intergenic
1152452857 17:80394094-80394116 GAGCCACTGCCCCACTTCAGAGG + Exonic
1152759185 17:82099220-82099242 GAGCCGCTGCCCCACTTCCCAGG + Intergenic
1153707961 18:7766594-7766616 GAACCACTGGGGCACTGTGCAGG + Intronic
1160407940 18:78655572-78655594 GAGCCACTGCGCCCGGCCGCAGG - Intergenic
1160539475 18:79612621-79612643 GAGCCAGTGGGCAACTGTGCTGG + Intergenic
1161439703 19:4283860-4283882 GAGCCACCGCGCCCCCGCCCGGG + Intronic
1162323475 19:9984831-9984853 GAGCCACTGCACCCCAGCGTGGG - Intronic
1166042060 19:40209696-40209718 GAGCCACCGCGCCCGGGCGCAGG + Intronic
1166672325 19:44718572-44718594 GAGCCACTGCGGACCTGCTCGGG - Intergenic
1168151184 19:54449650-54449672 TAGCCACGGAGCCACTGCCCAGG - Intronic
925380616 2:3422960-3422982 CAGTCAATGCGCCACTGCGCCGG - Intronic
928196071 2:29217665-29217687 GAGCCACTGAGCTACAGAGCTGG + Intronic
928266369 2:29815472-29815494 GAGGCACTGGGACTCTGCGCCGG + Intronic
929691577 2:44079268-44079290 GAGCCACTGCACCCCAGCCCAGG + Intergenic
930711907 2:54557925-54557947 GCGCGACTGCCCCAGTGCGCTGG - Intronic
934041922 2:88134235-88134257 GAGCCACGGCAGCACTGCCCTGG + Intergenic
934935266 2:98460716-98460738 GACCCACTGCCACACAGCGCTGG - Intronic
936020690 2:108992816-108992838 GAGCCACTGTGCCACGAGGCAGG - Intergenic
938909955 2:135876634-135876656 GGGCCACGGCTACACTGCGCAGG - Intergenic
939507761 2:143070475-143070497 GAGCCACTGCACCCCTGCCTGGG + Intergenic
944111435 2:196135491-196135513 GAGCCACTGCGCCCCCGCCCAGG - Exonic
944500579 2:200355167-200355189 GAGCCACTGTGGCACTGCTGTGG + Intronic
947877410 2:233476926-233476948 AGGCCACTGCGCCACCGCGCTGG - Exonic
948046636 2:234951065-234951087 TAACCACTGCGCCACTGCCTGGG - Intergenic
1168931081 20:1624467-1624489 GAGGCACTGTGCCCCTGCCCTGG - Intergenic
1170508168 20:17050257-17050279 GAGCCTCTGCACCGCTGTGCAGG - Intergenic
1172859103 20:38033526-38033548 GATCCACTGCGCCGGTGTGCAGG + Exonic
1175338624 20:58213336-58213358 CAGTCAGTGCGCCACTGCGGAGG + Intergenic
1179883659 21:44304330-44304352 GAGTCAATGTGCCACTGGGCGGG - Intronic
1179888047 21:44322817-44322839 GAGCCACAGCGCCACATCCCGGG + Intronic
1182412387 22:30198139-30198161 GAGCCACTGCACCCCAGCCCGGG + Intergenic
1183366068 22:37407611-37407633 GAGCCACTGCGCCTGGCCGCCGG - Intronic
1183924640 22:41197287-41197309 GAGCCTCTGGACCACTGAGCTGG - Intergenic
1184617847 22:45650216-45650238 GAGCCACTGCGCCCATCCCCTGG - Intergenic
1184739234 22:46417559-46417581 GAGCCACTGGGCCACCGGGTGGG + Intronic
1184741875 22:46433317-46433339 GAGCCACTGCGCCTCGCCCCAGG + Intronic
1185138899 22:49089415-49089437 GAGCCCCTGTGCCTCTGCCCAGG + Intergenic
949805563 3:7952047-7952069 GAGCCACTGCCCAACTCTGCTGG + Intergenic
953618273 3:44510968-44510990 GAGCCACCGCGCCAGGCCGCTGG - Intergenic
954727056 3:52621445-52621467 GAGCCACTGCGCCCCAGCTCTGG + Intronic
960137197 3:114117956-114117978 GAGCCACTCCACCACTGTGATGG + Intergenic
962959443 3:140296943-140296965 CAGCCTCTGCACCACTGTGCTGG + Intronic
964612406 3:158628133-158628155 GTCCCACTGCCCCACTGCGGTGG - Intergenic
966593028 3:181702231-181702253 GCGGCACTGAGCCGCTGCGCAGG + Intergenic
967887670 3:194344410-194344432 GAGCCACTGCGCCTGGCCGCAGG - Intronic
968971457 4:3797878-3797900 CAGCCTCTGCGGCCCTGCGCGGG - Intergenic
969302551 4:6305705-6305727 GAGCCCCTGCCCCACTGGGAGGG + Intergenic
983761031 4:171406793-171406815 GAGCCACTGCGCCTGGCCGCTGG - Intergenic
984760010 4:183355968-183355990 GAGCCCCTGGGCCACTGAGAGGG + Intergenic
990594986 5:57303563-57303585 GAGCCACTGCCCCACAGAGAAGG - Intergenic
991587436 5:68215420-68215442 GAACCCCTCCGCCTCTGCGCTGG + Intergenic
997395972 5:133560151-133560173 GAGCCACAGCGCCACTCACCTGG - Intronic
997536485 5:134626254-134626276 GAGCCACTGCACCACAGCCTGGG + Intronic
997984993 5:138494421-138494443 GAGCCACTGCGCCCGTGTGGGGG + Intergenic
998264357 5:140656467-140656489 GAGCCACTGCGCCAGTCCTCTGG + Intronic
1000391647 5:160728864-160728886 GAGCCACTACTTCACTGGGCTGG + Intronic
1001972594 5:175968300-175968322 GAGCGACGGCCCCTCTGCGCAGG + Intronic
1002503918 5:179665774-179665796 CAGCCACTGCTTCACTGGGCAGG - Intergenic
1003926838 6:10884204-10884226 GAGCCACTGCGCCCAATCGCGGG - Intronic
1004107442 6:12678786-12678808 GAGCCACTGCGCCCATCCTCTGG - Intergenic
1004168920 6:13280732-13280754 GAGCCACTGCGCCTGGCCGCAGG - Intronic
1005942262 6:30569368-30569390 GAGCCACCGCGCCCCAGCCCAGG + Intergenic
1006100924 6:31685886-31685908 GAGCCACTGCGCCTGGCCGCTGG - Intergenic
1006777546 6:36607506-36607528 GAGCCACTGCGCCCCGCCCCAGG + Intergenic
1007641716 6:43345916-43345938 GAGCCACTGCGCCCGTCCCCAGG - Intronic
1008787304 6:55184211-55184233 GAGCCACTGCACCCAGGCGCAGG + Intronic
1013480014 6:110545009-110545031 GAGACACAGCCCCACTGCTCAGG + Intergenic
1014726247 6:124975471-124975493 GAGCCACTGCACTCCTGCCCAGG - Intronic
1019170153 6:170129266-170129288 GAGCCACTGAGCCAGTGCGATGG - Intergenic
1023194843 7:37623721-37623743 GAGCCACTGCTCCTCTGACCTGG - Intergenic
1023395672 7:39749738-39749760 GAGCCACTGCCCCACAGGGTTGG - Intergenic
1026329105 7:69336690-69336712 GAGCCACTGAGCCACTGTGCAGG + Intergenic
1027195542 7:76027568-76027590 GTGCCACTGCACCCCTGCCCGGG + Intronic
1027780030 7:82508418-82508440 GAGCCACTCTGCCACGGCTCTGG - Intergenic
1029101495 7:98134528-98134550 GAGCCACTGCGCCAGACTGCTGG - Intronic
1029379302 7:100202330-100202352 GAGTCACTGCACCACTGCCCAGG - Exonic
1030702771 7:112659601-112659623 GAGCCACTGCGCCTCGCCTCTGG + Intergenic
1032817707 7:135494183-135494205 GAGCCACTGCGCCCCACCGCTGG - Intronic
1033473855 7:141672104-141672126 GAGGCACTGCGCATCTGTGCTGG - Intronic
1034429652 7:151034826-151034848 GGGCCACTGGGCCACTGACCTGG - Exonic
1035196667 7:157227412-157227434 GAGCCACTGCGCCACGCCCAGGG - Intronic
1035855753 8:2974450-2974472 GGGGCACTGCCCCACTGCACAGG - Exonic
1037444158 8:18947573-18947595 GTGCCACTGCGGCTCTGCTCTGG - Intronic
1037975168 8:23204059-23204081 GAGCCACCGTGCCACTGTGAAGG + Intronic
1039541219 8:38372778-38372800 GAGCCACTGCGCCCGGCCGCAGG + Intronic
1040065286 8:43140252-43140274 GAGGCTCTGCGCCCCTGCGTTGG - Intergenic
1043398280 8:79859100-79859122 GAGCCACTGCGCCTGGCCGCAGG - Intergenic
1044527090 8:93264474-93264496 GAGCCACTGCGCCCGTCTGCAGG - Intergenic
1045244983 8:100435013-100435035 GAACCACTGTGCCACTACACAGG - Intergenic
1048994862 8:139788095-139788117 AAGCCACTTCCCCACTGCACTGG + Intronic
1049374187 8:142281288-142281310 GAGCCTCTGCCCCACTGGCCTGG + Intronic
1049432158 8:142570161-142570183 GAGCCCCTGTGGCACTGCACAGG - Intergenic
1049724441 8:144138968-144138990 GAGCCACTGTGTCCCTGGGCTGG - Intronic
1050876965 9:10651182-10651204 GGGCCACTGCACAACTGCGTGGG + Intergenic
1051172821 9:14336662-14336684 CAGGCTCTGGGCCACTGCGCAGG - Intronic
1189512668 X:41679043-41679065 GTGCCACTGCACCCCTGCGTGGG + Intronic
1190786519 X:53656016-53656038 GAGCCACTGCGCCCATCCTCTGG - Intronic
1197742059 X:129902778-129902800 GAGCCACTGCACTCCTGCGTGGG + Intergenic
1200015615 X:153160482-153160504 GAGCCACTGCGCCTGGCCGCTGG + Intergenic
1202160257 Y:21926546-21926568 GAGCCACTGCACCCCTGCTTGGG + Intergenic
1202231099 Y:22659836-22659858 GAGCCACTGCACCCCTGCTTGGG - Intergenic
1202312059 Y:23536329-23536351 GAGCCACTGCACCCCTGCTTGGG + Intergenic
1202558744 Y:26134265-26134287 GAGCCACTGCACCCCTGCTTGGG - Intergenic