ID: 1106253510

View in Genome Browser
Species Human (GRCh38)
Location 13:28001808-28001830
Sequence TCCGGGTGGGGTCCCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 189}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106253510_1106253526 26 Left 1106253510 13:28001808-28001830 CCCTGCTGGGGACCCCACCCGGA 0: 1
1: 0
2: 3
3: 28
4: 189
Right 1106253526 13:28001857-28001879 GGCAGTCCCTGGCTTGAAGGTGG 0: 4
1: 43
2: 139
3: 284
4: 559
1106253510_1106253519 5 Left 1106253510 13:28001808-28001830 CCCTGCTGGGGACCCCACCCGGA 0: 1
1: 0
2: 3
3: 28
4: 189
Right 1106253519 13:28001836-28001858 CAGCTTGGCCCCCATGCTTCGGG 0: 1
1: 11
2: 59
3: 174
4: 412
1106253510_1106253528 28 Left 1106253510 13:28001808-28001830 CCCTGCTGGGGACCCCACCCGGA 0: 1
1: 0
2: 3
3: 28
4: 189
Right 1106253528 13:28001859-28001881 CAGTCCCTGGCTTGAAGGTGGGG 0: 1
1: 43
2: 132
3: 295
4: 710
1106253510_1106253514 -10 Left 1106253510 13:28001808-28001830 CCCTGCTGGGGACCCCACCCGGA 0: 1
1: 0
2: 3
3: 28
4: 189
Right 1106253514 13:28001821-28001843 CCCACCCGGAACTGACAGCTTGG 0: 1
1: 0
2: 2
3: 39
4: 160
1106253510_1106253518 4 Left 1106253510 13:28001808-28001830 CCCTGCTGGGGACCCCACCCGGA 0: 1
1: 0
2: 3
3: 28
4: 189
Right 1106253518 13:28001835-28001857 ACAGCTTGGCCCCCATGCTTCGG 0: 1
1: 1
2: 1
3: 7
4: 120
1106253510_1106253525 23 Left 1106253510 13:28001808-28001830 CCCTGCTGGGGACCCCACCCGGA 0: 1
1: 0
2: 3
3: 28
4: 189
Right 1106253525 13:28001854-28001876 TCGGGCAGTCCCTGGCTTGAAGG 0: 1
1: 3
2: 55
3: 174
4: 413
1106253510_1106253523 15 Left 1106253510 13:28001808-28001830 CCCTGCTGGGGACCCCACCCGGA 0: 1
1: 0
2: 3
3: 28
4: 189
Right 1106253523 13:28001846-28001868 CCCATGCTTCGGGCAGTCCCTGG 0: 1
1: 0
2: 8
3: 72
4: 362
1106253510_1106253527 27 Left 1106253510 13:28001808-28001830 CCCTGCTGGGGACCCCACCCGGA 0: 1
1: 0
2: 3
3: 28
4: 189
Right 1106253527 13:28001858-28001880 GCAGTCCCTGGCTTGAAGGTGGG 0: 1
1: 37
2: 136
3: 289
4: 616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106253510 Original CRISPR TCCGGGTGGGGTCCCCAGCA GGG (reversed) Intergenic
900158178 1:1211849-1211871 GCTGGGTGGGGTCCACAGGAGGG + Intronic
900713344 1:4128837-4128859 TTTGGGTGGGTTCCCCAGGAGGG - Intergenic
901796532 1:11682641-11682663 TCGAGGTGGGGTGCACAGCAGGG + Intronic
901883910 1:12209548-12209570 CCCGAGTGGGGTCCCCAGGAGGG - Intergenic
903259593 1:22124176-22124198 AGCGGGGGGGTTCCCCAGCAAGG + Intronic
904008951 1:27379251-27379273 TCAGGCTGGGGGGCCCAGCAGGG + Exonic
904130490 1:28272209-28272231 TCAGGGTGGGTACCCCATCAGGG - Intronic
905022202 1:34825652-34825674 TCCAGGCTGGGCCCCCAGCAAGG - Intronic
905867239 1:41382794-41382816 TCCGAGAGGGGTCCCTAGCTGGG - Exonic
905924205 1:41738334-41738356 TCCAGGTGGCGGCCTCAGCACGG + Intronic
907250983 1:53139351-53139373 TCTGAGTGGGGTCCCCAGCACGG - Intronic
912701618 1:111882340-111882362 TCCGGTTTGGATGCCCAGCAGGG + Intronic
913089467 1:115466616-115466638 TCCAGCAGGAGTCCCCAGCAAGG - Intergenic
913968292 1:143394719-143394741 TGTGGGTGGGGTCTGCAGCAGGG + Intergenic
914062671 1:144220315-144220337 TGTGGGTGGGGTCTGCAGCAGGG + Intergenic
914116479 1:144746039-144746061 TGTGGGTGGGGTCTGCAGCAGGG - Intergenic
915361394 1:155288213-155288235 TCCTGGAGGGGGACCCAGCAGGG - Exonic
916766275 1:167863660-167863682 GCTGGTTGGAGTCCCCAGCAGGG - Intronic
919083011 1:192889060-192889082 TGTGGGTGGGGTCCTCAGGATGG - Intergenic
919205738 1:194420346-194420368 TCTGGGTGGAGTCCACAGCTGGG - Intergenic
922560909 1:226568939-226568961 TCCTTGTAGGGTCCCTAGCAAGG + Intronic
924432419 1:244008291-244008313 TCCGTGTGGGCTCAGCAGCATGG + Intergenic
1062769066 10:85530-85552 TGAGGGTGAGGTCCCCAGGATGG - Intergenic
1063144486 10:3284399-3284421 TGCGTGTTGGGGCCCCAGCAGGG + Intergenic
1063686357 10:8240485-8240507 TCCGGATGGGGTCGTGAGCAGGG + Intergenic
1063978851 10:11437805-11437827 GCCAGGTGGGGTCCCTTGCAGGG + Intergenic
1066010828 10:31192043-31192065 TCCAGGTGAGGCCCACAGCAGGG + Intergenic
1067095647 10:43297777-43297799 TCCATGTGGCCTCCCCAGCATGG - Intergenic
1067655925 10:48191174-48191196 TTCATGTGGGGTCTCCAGCAAGG - Intronic
1067764174 10:49072704-49072726 TCCCTGTGGTGTCACCAGCAAGG - Intronic
1067850355 10:49750447-49750469 CCCGGGTTGTGTCCCCAACAGGG - Intronic
1068119362 10:52770652-52770674 TCCGGGTAAGGACCCCAGCAAGG - Exonic
1069235556 10:66067371-66067393 ACTGAGTGGGGTACCCAGCAAGG - Intronic
1069741767 10:70689468-70689490 TCCTAGTGGGGTGCACAGCAGGG + Intronic
1069878054 10:71575055-71575077 ACTGTGTGGGGCCCCCAGCAAGG - Intronic
1070966922 10:80535677-80535699 TGGGGGTGGGTTGCCCAGCATGG - Intergenic
1072470230 10:95706830-95706852 AGGGGGTGGGGTCCCCAGTAAGG - Intergenic
1072596395 10:96876295-96876317 TCAGGGTGGGGTCCCCATGATGG - Intronic
1072663961 10:97380684-97380706 TCAGGGTGGGGTGCGGAGCAGGG + Intronic
1076594532 10:131617642-131617664 CCCGGGAGGTGCCCCCAGCAAGG + Intergenic
1076692212 10:132229695-132229717 TCAGGGAGGGGTCTCCAGTAAGG - Intronic
1076994120 11:290007-290029 TCCGGCTGGAGGCCCCTGCAGGG + Exonic
1078023506 11:7673700-7673722 TCCGGGTGGGTTCCGCGGCGGGG - Exonic
1078268785 11:9775486-9775508 TCAGGGTGGGGTCCCTAGCTAGG + Intergenic
1080879268 11:36303920-36303942 TCAGGGTGGGATGTCCAGCAGGG + Intronic
1081010993 11:37812310-37812332 TCCAGGTGGGGTCCACAACCTGG - Intergenic
1081531128 11:43959987-43960009 TCCTGGTGGGGGCCGGAGCAGGG - Intergenic
1083614826 11:64021232-64021254 CCAGGGTGGGCTCCCCTGCATGG - Intronic
1083724981 11:64623277-64623299 GCCAGGTGGGGACCCCAGAAGGG + Intronic
1083938386 11:65882212-65882234 AGCTGGAGGGGTCCCCAGCATGG + Exonic
1085530716 11:77190511-77190533 TTGGGGTGGGGTGCACAGCAGGG + Intronic
1088648525 11:111937459-111937481 CCCGGGCGGGGTCTCCAGCCCGG - Intronic
1091692038 12:2603960-2603982 ACCGAGTGGGGAACCCAGCAAGG + Intronic
1091771312 12:3152978-3153000 GACGGGTGGGGGCCCCAGGACGG + Intronic
1091800768 12:3323261-3323283 TCCCAGTGAGGTCCCCAGCAAGG - Intergenic
1091902241 12:4153666-4153688 TGTGGGTGGAGTCCTCAGCAAGG + Intergenic
1095961092 12:47834816-47834838 TTGGGGTGGGGTCCCTATCAGGG + Intergenic
1097156450 12:57015683-57015705 TCCTGGCGGGGGCCGCAGCAAGG - Exonic
1097684232 12:62676926-62676948 TCCAGGTGGAGTCCACAGCCTGG + Intronic
1098012589 12:66070816-66070838 TCAGGGTGGGGCCCCCATGATGG + Intergenic
1098248085 12:68540777-68540799 GCTGGCTGGGGTCCCCTGCAGGG - Intergenic
1102238478 12:111309330-111309352 TCCAGGGTGGGTGCCCAGCAAGG + Intronic
1103214234 12:119189225-119189247 TCAGGGTGGAGTCACAAGCAGGG + Intronic
1103554032 12:121755181-121755203 TCCGGGTGGGGAGCCTAGCCAGG - Intronic
1104692679 12:130838876-130838898 TGCTGGTGGGGTCCCCAGGGCGG - Intronic
1104997816 12:132669751-132669773 TCCAGGTGGTGTCCCCACCATGG - Intronic
1106253510 13:28001808-28001830 TCCGGGTGGGGTCCCCAGCAGGG - Intergenic
1106614006 13:31310069-31310091 TCAGGGTGGGGTCCACAGCCAGG + Intronic
1109588754 13:64447043-64447065 TCAGGGTGGGGTCCTTAGCTTGG - Intergenic
1110395094 13:75020477-75020499 TCCAGCTGGGGTCTCCAACAAGG + Intergenic
1111184792 13:84720089-84720111 GAAGGGTGGGGTCCCCAACAAGG + Intergenic
1112632817 13:101180689-101180711 CCCATGTGGGGCCCCCAGCAAGG + Intronic
1113936823 13:113999305-113999327 TTCAGGTGGCGTCCCCCGCAGGG - Intronic
1117181723 14:53198640-53198662 TCTGGGTGGGGGCCACAGGATGG + Intergenic
1119780765 14:77275552-77275574 GCCGGGTGGGCTCTCCTGCAGGG - Exonic
1120365315 14:83561384-83561406 TGCGGGAGGGGTGACCAGCACGG + Intergenic
1121429880 14:93879193-93879215 GCCTGGGGGGGTCCCTAGCAGGG - Intergenic
1121682180 14:95802738-95802760 TCAGGGTGGGGTCCCCAAGATGG + Intergenic
1122875049 14:104660065-104660087 TCTGGGTGGGGGTCCCAGCGAGG - Intergenic
1123016319 14:105377302-105377324 TCAGGGAGGGGCACCCAGCATGG - Intronic
1124620671 15:31272232-31272254 CCCCGGTGGAGTCCCCACCAGGG - Intergenic
1124882031 15:33651698-33651720 TCCTGTTGTGGTCCTCAGCATGG - Intronic
1126237346 15:46401430-46401452 TACGTGTGGGGTCCACAGAATGG - Intergenic
1126979625 15:54227297-54227319 TCTGGGTGGAGTCCACAGCCAGG - Intronic
1128811999 15:70579741-70579763 TCCTAGTGGGGTCCCCAGGTTGG - Intergenic
1129262116 15:74374331-74374353 TCCTGGTGGGGGCCGCAGCTGGG + Intergenic
1129608929 15:77038110-77038132 GCCGGGTGGGGATCCCAGGAGGG - Intergenic
1130550340 15:84886569-84886591 CCAGGGTGGGGACCCCAACACGG - Intronic
1132375648 15:101326733-101326755 TCCGGGTGGCGTACCCACCCTGG - Intronic
1132458170 16:35774-35796 TGAGGGTGAGGTCCCCAGGATGG - Intergenic
1132563395 16:609253-609275 GCCTGGTGTGGTTCCCAGCAGGG + Intronic
1132826615 16:1908429-1908451 TGCGGGTGAGGTGCCCAGCTGGG - Intergenic
1133336761 16:5011373-5011395 CCCGGGGTGGGACCCCAGCATGG + Intronic
1133742724 16:8663551-8663573 TCCAGGTGGGGCCCCCACCTGGG - Intergenic
1134849679 16:17470269-17470291 GCCGGGTGGGGTCCCTGCCAAGG - Intronic
1137962320 16:52895072-52895094 TCAGGGTGGGGCCCCCATTATGG - Intergenic
1138080940 16:54090930-54090952 TCCATGTGGGCTCTCCAGCAGGG + Intronic
1139147999 16:64345620-64345642 TCCAGGTGGAGTCCACAGCCTGG + Intergenic
1139803052 16:69539935-69539957 TCTTGGTGGGGTCCCCAGAGTGG - Intergenic
1141652626 16:85401623-85401645 CCAGGGTGGGGTCCCCAGGCTGG + Intergenic
1146925642 17:36742878-36742900 TTCGGGTGGGTCCCCGAGCAGGG + Intergenic
1146926630 17:36750194-36750216 TTCTGGTGCGGTGCCCAGCACGG + Intergenic
1147758786 17:42784402-42784424 TCCCTGTAGGGTCCACAGCAGGG - Exonic
1148102639 17:45102002-45102024 TCTGGGTGGAAACCCCAGCATGG + Intronic
1149088670 17:52751426-52751448 AGGGGGTGGGGTCCCCAGTAAGG + Intergenic
1149160446 17:53686985-53687007 AGTGGGTGGGGTCCCCAGTAAGG - Intergenic
1150900878 17:69275820-69275842 TGAGGGTGGGGTCCCCATGATGG + Intronic
1151700407 17:75739855-75739877 GCAGGATGGGGTCCTCAGCACGG - Intronic
1151768631 17:76145401-76145423 TCCAGATGGTGTCTCCAGCAGGG + Intronic
1152433428 17:80261437-80261459 TCCGGGAGGGGTGCCCACCCTGG - Intronic
1152749065 17:82054292-82054314 GCCGGGTGGGGAAACCAGCAGGG - Intronic
1156376208 18:36517403-36517425 TCCCTGTGGGGTCCCCTGCATGG + Intronic
1159911115 18:74147633-74147655 TGCGGGTGGGGTCCCCTGGCGGG - Intronic
1160681215 19:412436-412458 CCCAGGTGGGGGCCCCACCAGGG + Intergenic
1161316924 19:3621506-3621528 TCTGGGGGTGGTCCCCAGCCAGG - Intronic
1161684376 19:5695757-5695779 GCCAGGTGGGGGCCCCACCATGG + Intronic
1162068182 19:8138162-8138184 TGCGCGTGGGATCCCCAGCCTGG - Exonic
1162779951 19:13001879-13001901 CACGGGCGGGGCCCCCAGCAAGG - Intronic
1163025334 19:14507729-14507751 TGGGGGTGGGGTCCCTGGCAAGG + Intergenic
1164179725 19:22807727-22807749 TCGGGCTGGGGCCCCCTGCAGGG + Intergenic
1164918815 19:32073199-32073221 TCCAGGTTGGGTCGCCAGAAAGG + Intergenic
1165026981 19:32969439-32969461 AGGGGGTGGGGTCCCCAGTAAGG - Intronic
1166015990 19:39979860-39979882 TCTGGGTGAGGGCCCCCGCATGG + Exonic
1166387792 19:42391688-42391710 GCTGGGTGGGGTTCTCAGCACGG + Intergenic
1166800117 19:45451358-45451380 TGCGGTTGGGGTCCCCACCAGGG + Intronic
1167488794 19:49780066-49780088 TCAGGGCGTAGTCCCCAGCAGGG - Intronic
1168353163 19:55687826-55687848 CCCGTGTGGTGTGCCCAGCAGGG - Intronic
1202702079 1_KI270712v1_random:172187-172209 TGTGGGTGGGGTCTGCAGCAGGG + Intergenic
926296105 2:11569882-11569904 GCGGGGTGGGGTGCCCAGCTGGG + Intronic
927180355 2:20442032-20442054 TCTGGGTGGGGTCTCCAGCTAGG - Intergenic
932484997 2:72079475-72079497 TCCAGGTGGGCTCTCCAGCATGG - Intergenic
932893593 2:75617240-75617262 TCAGGGTGGGGCCCCCATCATGG - Intergenic
933219300 2:79669957-79669979 TGGGGTTGGGGTCCCCAGTAAGG - Intronic
934172991 2:89555633-89555655 TGCGGGTGGGGTCTGCAGCAGGG + Intergenic
934283305 2:91629990-91630012 TGCGGGTGGGGTCTGCAGCAGGG + Intergenic
937067728 2:119030534-119030556 TGCAGGTGGGATCCCCAGGAAGG - Intergenic
938842165 2:135174234-135174256 TCCGGATGGGGTCCCAAGTTGGG - Intronic
940859714 2:158759163-158759185 TCAGGGTGGGGCCCCCATGATGG + Intergenic
945067209 2:205957308-205957330 TCCCAGTGGGGTCCCCTGAAGGG + Intergenic
945972229 2:216242153-216242175 TCCTTGTTGGGTCACCAGCAAGG - Intergenic
947118432 2:226795544-226795566 TCCTTGTGGGCCCCCCAGCAGGG + Exonic
947908094 2:233780341-233780363 TCTGGGGGTGGTGCCCAGCAAGG - Intronic
948834623 2:240620144-240620166 GCCAGGTGGGGACCCCAGCGGGG + Intronic
948884250 2:240874994-240875016 ACGGGGTGGGGCCCCCAGGAGGG - Intronic
948936360 2:241167510-241167532 GCCGGGTGGGGTGCGCAGCAGGG + Intronic
1169021583 20:2334927-2334949 TCAGGGTGGGCTCCAGAGCAGGG - Intronic
1172590233 20:36112639-36112661 ACCAGGGAGGGTCCCCAGCATGG - Intronic
1172803799 20:37597118-37597140 TCCTGGTTGGGTCCCTGGCACGG + Intergenic
1175891968 20:62319687-62319709 TCAGGGTGCGGTCCACAGCCCGG + Exonic
1178584100 21:33858481-33858503 CCGGAGGGGGGTCCCCAGCAGGG - Intronic
1178980272 21:37257870-37257892 TCCGGGTGGGGCACCAAGCGGGG + Intronic
1179925015 21:44529521-44529543 TCTGCCTGGGGTCCCCAGGAAGG + Intronic
1180064463 21:45405528-45405550 GCCGGGCGGGGACCCCAGCCAGG - Intronic
1180105768 21:45617179-45617201 CCAGGGTGGGCTCCCCAGCAGGG + Intergenic
1180675210 22:17581782-17581804 TCCCTGCGGGGTCCCCAGCCAGG + Intronic
1180840124 22:18955238-18955260 TCCCTGTGGGGTCCCCACAAAGG + Intergenic
1181061783 22:20285251-20285273 TCCTTGTGGGGTCCCCACAAAGG - Intergenic
1182280377 22:29214858-29214880 TCCTCCTGGAGTCCCCAGCAGGG + Intronic
1182817537 22:33179083-33179105 TCAGGGTGGGGCCCCCATGATGG - Intronic
1184459358 22:44628331-44628353 CCCAGCTGAGGTCCCCAGCATGG - Intergenic
1184948455 22:47821475-47821497 TCAAGGTGGTGTCCCCATCATGG - Intergenic
1184983989 22:48116975-48116997 TGCGGGGGGCGTCCCCAGGAAGG - Intergenic
1185241397 22:49749445-49749467 TCCAGTTGGTGTCCCCAGGAGGG - Intergenic
1185316985 22:50183562-50183584 TCCGGCTGGGGTCCCCTGCAGGG - Intergenic
949855704 3:8459114-8459136 TCCAGGTGGGGAGACCAGCAAGG - Intergenic
949880020 3:8654227-8654249 TGAGGGTGGGGTCCCCAGGATGG - Intronic
950900580 3:16493674-16493696 GGCAGGTGGGGTCTCCAGCAGGG - Intronic
952287173 3:31980712-31980734 TCCAGGTGGGGTTCTCAGGATGG - Intronic
957965081 3:87311832-87311854 TCTGGGTGGGCTCCCAGGCAGGG + Intergenic
961126590 3:124424151-124424173 TCCCGGGGGGGTTCCCAGCAGGG + Intronic
967653555 3:192016926-192016948 TCAGGGTGGGGCCCCCATGATGG - Intergenic
982671155 4:158321108-158321130 TGAGGGTGGGGCCCTCAGCAGGG + Intronic
983213879 4:164984662-164984684 TGAGGGTGGGGTCCCCATGATGG + Intergenic
986685320 5:10271134-10271156 ACTGAGTGGGGGCCCCAGCAAGG - Intergenic
987296208 5:16554214-16554236 TCCAGGTGGGGGGCCCAGCCAGG - Intronic
990495575 5:56344444-56344466 TCCAGCTGTGGTCCACAGCATGG - Intergenic
991403164 5:66275203-66275225 TCGGGGTGGGGTTCAAAGCAAGG - Intergenic
993618026 5:90136869-90136891 TCCAGGTGGAGTCCACAGCCTGG - Intergenic
995116667 5:108488447-108488469 TCTTGGTGGGGTCCCAAGGATGG - Intergenic
995833593 5:116378904-116378926 TGGGGGTGGGCTCCCCAGCACGG + Intronic
998543388 5:143004618-143004640 TCAGGGTGGAGTCCCCAGGAAGG - Intronic
1001568049 5:172713249-172713271 TCCAGGGGGGTTCCCCAGCAAGG + Intergenic
1002567698 5:180120916-180120938 TCCTGGAGGGGTGCCCAGCCTGG + Intronic
1002678024 5:180935187-180935209 TCCGGGTGGAGTCCACTGCCTGG - Intronic
1004199303 6:13533004-13533026 TCCAGGTGGGGCCCCCAGTAAGG + Intergenic
1005871012 6:29974609-29974631 TCAGGGTGGGGTCCTCAAGAGGG + Intergenic
1006060391 6:31414510-31414532 TCCTGATGGGGTCCCCAGTTAGG + Intronic
1006072834 6:31509282-31509304 TCCTGATGGGGTCCCCAGTTAGG + Intronic
1019337880 7:493881-493903 TCCGCGAGGGGTCGCCAGCCGGG - Intergenic
1019340255 7:505513-505535 TTGGGGTGGGGTCCCCCGCAGGG - Intronic
1019482908 7:1274605-1274627 TGCGGGCAGCGTCCCCAGCATGG + Intergenic
1019550679 7:1600952-1600974 TCTGGGTGCTGTACCCAGCAAGG + Intergenic
1021167677 7:17360455-17360477 AAAGGGTGGGGTCCCCAACAAGG - Intergenic
1028104258 7:86858431-86858453 TCAGGGTGGGGCCCCCATGATGG + Intronic
1028731066 7:94148897-94148919 TCAGGGTGGGTTCCCCAGTAAGG - Intergenic
1028877957 7:95844685-95844707 TCTGGGTGGGGGCCCCAGGACGG + Intronic
1031327387 7:120418599-120418621 TCTGGGTGGGGACCCTGGCATGG + Intronic
1031712696 7:125068565-125068587 ACAGGGTGGGGTCCCTGGCAAGG - Intergenic
1035698890 8:1622907-1622929 ACAGGGTGAAGTCCCCAGCACGG - Intronic
1038089345 8:24236045-24236067 TCTGGCTGGAGTCCCCCGCAGGG - Intergenic
1040414123 8:47182060-47182082 TCTGGGTGGGGCAGCCAGCAGGG - Intergenic
1047491963 8:125382546-125382568 TCAGGGTGGGGTGCCCATGATGG - Intergenic
1049189077 8:141276588-141276610 TCCGAGTGAGGTCCCCGCCAAGG - Intronic
1049321719 8:142000349-142000371 TCAGCGTGGGGGCCCCAGCCTGG + Intergenic
1049404636 8:142446946-142446968 GCTGGGTGTGGTCCCCAGCAGGG + Intergenic
1055904119 9:81272942-81272964 TGAAGGTGGGGTCCCCAGGATGG + Intergenic
1057154527 9:92829554-92829576 TGCAGGTGGGGTAGCCAGCAGGG - Intergenic
1057975948 9:99606375-99606397 GCAGGGTGGGGTCCCCAGCTGGG + Intergenic
1059393145 9:114012408-114012430 TAAGGGTAGGGTCCCCACCATGG - Intronic
1059566298 9:115385828-115385850 AGGGGGTGGGGTCCCCAGTAAGG + Intronic
1061928868 9:133821993-133822015 TCCAGGAGGGGCCCCGAGCACGG + Intronic
1062277861 9:135739170-135739192 TCCAGGTGAGCTCCTCAGCATGG - Intronic
1062339864 9:136089221-136089243 TCTGGGTGGGGTCCCCAGCTGGG - Intronic
1062386265 9:136312680-136312702 TCCTGGTGGGGTTGCCCGCAGGG + Intergenic
1062437450 9:136552813-136552835 TCTGTGTGGCATCCCCAGCAAGG - Intergenic
1185467113 X:361729-361751 TACGTGTGTGGTCCCCCGCAGGG - Intronic
1185945157 X:4367600-4367622 AAAGGGTGGGGTCCCTAGCAAGG + Intergenic
1186523130 X:10223139-10223161 TCAAGGTGGGGTCCCCAGACCGG - Intronic
1191057302 X:56254942-56254964 TCAGGGTGGGGCCCTCACCAGGG + Intronic
1193425493 X:81337095-81337117 TCCAAGTGGGGCCCTCAGCAAGG - Intergenic
1197271068 X:124425446-124425468 TAAGGGTGGGGTCCCCATGATGG + Intronic