ID: 1106265620

View in Genome Browser
Species Human (GRCh38)
Location 13:28107025-28107047
Sequence ATATGAAATGGGAAGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106265615_1106265620 21 Left 1106265615 13:28106981-28107003 CCTATCTTTGCAGAGGTACACAT 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1106265620 13:28107025-28107047 ATATGAAATGGGAAGGTTGAGGG 0: 1
1: 0
2: 1
3: 19
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106265620 Original CRISPR ATATGAAATGGGAAGGTTGA GGG Intergenic
904649798 1:31996415-31996437 TTATGAAATGGGAAGCATTAGGG - Intergenic
904935544 1:34127374-34127396 AAATAAAATGGGAGGGTAGAGGG + Intronic
906985351 1:50677363-50677385 AAATGAAATGGCAGGGTTGAAGG - Intronic
907679097 1:56547130-56547152 TTAATAGATGGGAAGGTTGAGGG + Intronic
908879517 1:68715007-68715029 ATATGAAATAGGAAAGAAGATGG + Intergenic
910461304 1:87450732-87450754 TTATGAAATGGAAAGTTTGTGGG - Intergenic
911307507 1:96248986-96249008 TTATGAGAGGGGAAGGATGAGGG - Intergenic
911779089 1:101852752-101852774 AACTGAAATGGGAAGATTGCAGG - Intronic
913019666 1:114776099-114776121 TTATCATATGGGAAGGTAGAGGG - Intronic
913553949 1:119945122-119945144 ATATGAAGTGGTACGATTGAAGG + Intronic
914222100 1:145690307-145690329 CTATGAAATGGAAAGGTGTAGGG - Intronic
915248138 1:154570370-154570392 AGGTGCAATGGGAAGGTTGGGGG + Intronic
916677304 1:167074763-167074785 AGATGAAATGGAAAAGTTGTGGG + Intronic
919022207 1:192121132-192121154 ATATTATATGGCAAAGTTGATGG - Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
922098146 1:222460169-222460191 TTATAAAATGGGAATGATGATGG - Intergenic
922893587 1:229081759-229081781 ATATGAATTTTGAAGGTTGGGGG - Intergenic
923513216 1:234671649-234671671 ACATGAAATAGGAAAGCTGAGGG - Intergenic
923841183 1:237672063-237672085 ATCATAAATGGGAAAGTTGAGGG + Intronic
1067009757 10:42699999-42700021 AAATAAAATCTGAAGGTTGAAGG + Intergenic
1067960430 10:50841959-50841981 TTATGAAATGAGAATGATGATGG - Exonic
1068177129 10:53475811-53475833 ATCTGAAAGGAGAAGGGTGAGGG - Intergenic
1068780879 10:60918064-60918086 GTATGAAATGGGCACTTTGAAGG - Intronic
1070771837 10:79087104-79087126 ACAAGCAATGGGAAGGTGGAGGG - Intronic
1071432109 10:85614332-85614354 ACATGTAAGGGGAAGCTTGAAGG + Intronic
1071913157 10:90258516-90258538 ATATGGAATGGGAAGGAGAAGGG + Intergenic
1073197083 10:101700595-101700617 ATATGCAAAGGGAAGGTTTGTGG + Intergenic
1075559077 10:123455556-123455578 AGAGGAAATGGGAAGGTGCATGG + Intergenic
1078156055 11:8801073-8801095 ATGGGAATTGGGAAGGCTGATGG - Intronic
1078331878 11:10429090-10429112 CCATGAAATGGGAAGGTGGGAGG - Intronic
1078366839 11:10714025-10714047 ATTTTAAATGGGAAAGTTCAAGG - Intergenic
1079355738 11:19729174-19729196 AGATGAAATTGGAAGACTGAGGG + Intronic
1084293105 11:68188995-68189017 ATCTGAAATGGAAAGGTTAAGGG + Intronic
1085811335 11:79684663-79684685 AAATGAAATGGGATGATTGAAGG - Intergenic
1085816133 11:79739198-79739220 AGATGAAATGAGAAGGAGGAGGG - Intergenic
1087743639 11:101917676-101917698 GGATAAAATGGGAGGGTTGAAGG - Intronic
1089834727 11:121359953-121359975 ACCAGAAATTGGAAGGTTGAGGG - Intergenic
1089881720 11:121780510-121780532 AGGGGAAATGAGAAGGTTGAGGG - Intergenic
1090884903 11:130867332-130867354 AGATGAAATGAGATGGCTGATGG + Intergenic
1091673796 12:2472915-2472937 AAATTAAATGTGGAGGTTGAGGG - Intronic
1092775877 12:11944823-11944845 ATAAGAAATTGGAGGGTTGCTGG + Intergenic
1093021972 12:14212375-14212397 GTAGGAAAGGGGAAGGTTGAAGG + Intergenic
1093797987 12:23336806-23336828 ATATGGAATCTGAAGGTTGGTGG - Intergenic
1093987456 12:25552316-25552338 ATATTAAATGGGAACTTTGGAGG + Intronic
1094246575 12:28303346-28303368 AGATGAAAGGGAGAGGTTGAAGG - Intronic
1097496202 12:60339107-60339129 ATCTGAAATGGGAAAGTGAAAGG - Intergenic
1097836684 12:64280579-64280601 ACATGAAATGGGAAAGATGAAGG + Intronic
1099068196 12:78010789-78010811 TTATATAATGGGAAGATTGATGG + Intronic
1099080404 12:78172103-78172125 ATAAGAAATTTGAAAGTTGAAGG + Intronic
1099177930 12:79443262-79443284 AGCTGAGATGTGAAGGTTGAAGG - Intronic
1099653174 12:85456080-85456102 AGATAAATTGGGAAGGTGGAAGG - Intergenic
1099983430 12:89634041-89634063 ATATGAAATGGAAGGGGTGGTGG - Intronic
1100455830 12:94750739-94750761 AGATGAAATAAGAAGGGTGATGG - Intergenic
1100663205 12:96722890-96722912 AACTGAAATGGGGAGGTTGTAGG + Intronic
1102956402 12:117061782-117061804 ATATCAAAGGGGATGGTTCAGGG + Intronic
1106265620 13:28107025-28107047 ATATGAAATGGGAAGGTTGAGGG + Intergenic
1106940542 13:34774009-34774031 CTATAAAATGGGAATGATGAAGG + Intergenic
1107988949 13:45800550-45800572 ATCTGAACAAGGAAGGTTGAGGG - Intronic
1108011824 13:46023076-46023098 ATATGAAATAGGAAGTGTCAAGG + Intronic
1108426829 13:50310759-50310781 ATATGAAGAAGGAAAGTTGATGG + Intronic
1108812428 13:54244625-54244647 ATACAAGATGTGAAGGTTGAAGG - Intergenic
1110293717 13:73838094-73838116 ATCTGAAATGGGAAGTTCCATGG + Intronic
1112452375 13:99524279-99524301 ATCTGACTTGGGAAGGGTGAGGG + Intronic
1112548399 13:100394803-100394825 TAATGAAATGTGAAGGTTTAGGG - Intronic
1113145909 13:107207189-107207211 AAAAGAAATGGGAAGGGAGATGG - Intronic
1116647813 14:47552089-47552111 ATATGAAATGGCAAGGGAGGAGG - Intronic
1116950791 14:50876830-50876852 TAATCAAATGGTAAGGTTGAGGG - Intronic
1117472482 14:56060100-56060122 ATTTCAAATGGGGAGGATGAAGG - Intergenic
1117759236 14:59009477-59009499 AAATGAAATTAGAAGGTTAATGG + Intergenic
1117779550 14:59218166-59218188 ATATGAGATGGCTAGTTTGACGG - Intronic
1118159839 14:63277220-63277242 CTATGAAATGTGAATGTTGATGG + Intronic
1118610510 14:67535843-67535865 ATATGAAATGGCCATTTTGAAGG + Intronic
1120388146 14:83871411-83871433 ATTTTAAATGGGAAGGAAGAAGG + Intergenic
1120635538 14:86946171-86946193 ATATGAAATGAGATTGATGATGG - Intergenic
1123965665 15:25454442-25454464 ACATGAGATGGAAAGGTGGACGG - Intergenic
1124872057 15:33553078-33553100 ATAGGAGTTGGGAAGGCTGAGGG + Intronic
1125109798 15:36018852-36018874 ACATAAAATGGGAATGTTGCGGG + Intergenic
1125133097 15:36307517-36307539 GTTTTCAATGGGAAGGTTGAGGG + Intergenic
1127278698 15:57470203-57470225 AAGTGAAATGGGAAGATTCAAGG + Intronic
1130125361 15:81089434-81089456 AGATGAGATGAGAGGGTTGAGGG + Intronic
1130456879 15:84119866-84119888 ACATGAAATAGAAAGGTAGAAGG + Intergenic
1133729356 16:8566684-8566706 AAATGAAGAGGGAGGGTTGATGG - Intergenic
1134100733 16:11449732-11449754 CTAGGAAATGGGGAAGTTGATGG - Intronic
1135882361 16:26270419-26270441 TTATGAAATGGGAATAGTGACGG - Intergenic
1136507762 16:30716498-30716520 ATATGAAATGTAAAGGTTATCGG + Intronic
1138777196 16:59737420-59737442 ATATAAAATGGGATGCTTGCAGG - Intronic
1141416922 16:83882836-83882858 ATGTGAAATGGGAAGTTTTGGGG + Intergenic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1143152295 17:4815150-4815172 ATATGAGTTGGAAAGGTGGAGGG + Intronic
1143353388 17:6306399-6306421 ATGTGAGATGTGAAAGTTGATGG + Intergenic
1144291665 17:13832577-13832599 GTAAGAAATGGGAAGGAAGAAGG + Intergenic
1144604996 17:16657243-16657265 AAATGAAATGTGATGGTGGATGG - Intergenic
1145185059 17:20786938-20786960 ACATGAGATGGGGAGGTTGAGGG + Intergenic
1147342111 17:39759047-39759069 ATTTGAAATAGGAATGTTAATGG - Intergenic
1147571998 17:41577079-41577101 GTCTGAATTGGGAAGGGTGATGG - Intergenic
1148353514 17:46958237-46958259 CTGTAAAATGTGAAGGTTGACGG - Intronic
1149041317 17:52192531-52192553 ATGTGAAATGGCATGGTTCATGG + Intergenic
1149728140 17:58918066-58918088 AAAAGAAATGGGAATGCTGATGG - Intronic
1150707082 17:67496756-67496778 AATAGAAATGAGAAGGTTGAGGG + Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152361075 17:79833160-79833182 ATATTAAATGGAGATGTTGAAGG - Exonic
1153895012 18:9550870-9550892 AGATGTGATGGGAAGGTTGCTGG - Intronic
1155071524 18:22321046-22321068 AGATCAGATGGGAAGTTTGAGGG + Intergenic
1156107819 18:33687076-33687098 CTATGAAATGGGATTGTTAAAGG + Intronic
1156365998 18:36427753-36427775 TTATGAAATGGGTAGATGGATGG + Intronic
1156809172 18:41225668-41225690 ATATGAAATTTGGAGGTTGCAGG + Intergenic
1157384518 18:47249804-47249826 ATATCTAATGGCAAGGGTGAGGG - Intergenic
1159187414 18:64993473-64993495 AAATAAAATAGTAAGGTTGAAGG - Intergenic
1159258250 18:65976755-65976777 AAATGGAATGGGAAGGTGGCAGG + Intergenic
1159361109 18:67403885-67403907 AAATGAAATGGTAAGACTGAAGG + Intergenic
1159965096 18:74587431-74587453 ATGTGAAATGGGCAGGAAGATGG - Intergenic
1160668086 19:342842-342864 CTCTGAAATGGGAAGTTTAATGG - Intronic
1160941907 19:1624076-1624098 ATATGAAACGGGAATTGTGAGGG - Intronic
1164821007 19:31251266-31251288 CTCTGAAATGGGAAGGATGCAGG - Intergenic
1167245890 19:48373093-48373115 AGATGAAATTGGAAGAGTGAGGG + Intronic
927037151 2:19189764-19189786 ATTGGGAATGGGAAGGTGGAAGG + Intergenic
928271263 2:29857184-29857206 GTATAAAATTGGGAGGTTGATGG + Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929625233 2:43399827-43399849 ATAGGAAATGGTAAGGGTGGGGG + Intronic
930187685 2:48426697-48426719 ACATGAAATGGGGAGGTTTGAGG + Intergenic
930546466 2:52773575-52773597 ATATGAAATAGTAAGATTGCTGG - Intergenic
932788839 2:74634252-74634274 ATTTGTAATGAGAAGGTTGGTGG + Intronic
934944777 2:98532184-98532206 ATATGAATTTGGAAGGGTGGGGG - Intronic
935461561 2:103341921-103341943 AAATAAAATGGGATGGATGACGG - Intergenic
935795546 2:106637606-106637628 CTATGAAGTATGAAGGTTGAGGG + Intergenic
936693414 2:114919901-114919923 ATATGAAAAGGCCAGGTGGAGGG - Intronic
936928008 2:117757818-117757840 GTCTGCAATGAGAAGGTTGAAGG + Intergenic
937077242 2:119116144-119116166 AAATGAAATGGGAGGTTTGGGGG + Intergenic
937387805 2:121452948-121452970 TTGTGAATTGGGAAGGTTGTAGG - Intronic
937518013 2:122677563-122677585 ATATAAAAAGGAAAGGGTGATGG + Intergenic
937770239 2:125712384-125712406 CTGTGAAATGGGAATGTTAATGG + Intergenic
937773409 2:125747918-125747940 AAAAGCAATGGGAAGGTGGAAGG + Intergenic
938030987 2:127993043-127993065 AGATAAAATGTGAAGCTTGAAGG - Intronic
939970551 2:148654331-148654353 ATAACAAATATGAAGGTTGATGG + Intronic
940391597 2:153138912-153138934 ATATGCAAAGAGAAGATTGAGGG - Intergenic
940701615 2:157051402-157051424 ATAGGAAAAGGGAAGGTCGGAGG - Intergenic
940917732 2:159275688-159275710 ATAAGAAATGGGAATTTTGGGGG - Intronic
941897574 2:170644924-170644946 ATATGAAATCAGAAGGTGCAGGG + Intronic
943404643 2:187465087-187465109 AAATTAAATGGTGAGGTTGAAGG + Exonic
943522245 2:188966861-188966883 TTAGGAAATGGGAAGGGTCAGGG + Intergenic
943996115 2:194767683-194767705 ATAAGAAATGGGATTGTTGGTGG + Intergenic
944938027 2:204590005-204590027 ATATGAAATGGGAAGGATAATGG + Intronic
945183570 2:207116566-207116588 ATATAATATAGGAAGGTTCAAGG - Intronic
946104369 2:217356185-217356207 ATATGATATGGCCAGGGTGATGG + Intronic
1172261086 20:33566093-33566115 AGATAAAATAGGAAAGTTGAGGG + Intronic
1172926832 20:38545267-38545289 ATATGAAATGGGAATAATAATGG + Intronic
1175603758 20:60295979-60296001 ATTTAAAATGGGAAGTTTGAGGG + Intergenic
1176306531 21:5126491-5126513 ATCTGTGATGGGAAAGTTGAGGG - Intronic
1177727257 21:24985849-24985871 AGAGGAAATGGGAAGGGTGAAGG - Intergenic
1179429104 21:41306899-41306921 ATGTCAAATGGGAAGGAGGAAGG - Intronic
1179623804 21:42636097-42636119 ATCTTAAATGGGCAGGTTAATGG - Intergenic
1179850528 21:44135539-44135561 ATCTGTGATGGGAAAGTTGAGGG + Intronic
1181536769 22:23550335-23550357 GGATGAAATGGGAAGGTCGATGG - Intergenic
1181917332 22:26291863-26291885 ATATGTACTGGGAAGGGGGATGG - Intronic
1182763601 22:32742712-32742734 AGGTGAAATGGGAAGGCTGTAGG - Intronic
1182879886 22:33724295-33724317 ACATCAGATGGGAAGGGTGAAGG + Intronic
1183467869 22:37988920-37988942 CTATGCACTGGGAAGGTGGAGGG + Intronic
1184488172 22:44793927-44793949 TTAATAAGTGGGAAGGTTGAAGG + Intronic
1185071172 22:48657215-48657237 ATATGAAATAAAAAGGTTAAAGG + Intronic
949272592 3:2236921-2236943 GTATGAAATGGGAAGGAACATGG + Intronic
949748090 3:7318543-7318565 TTATAAATTTGGAAGGTTGAAGG + Intronic
950626618 3:14252165-14252187 ATCTTAAATGTGCAGGTTGATGG - Intergenic
950816097 3:15704010-15704032 ATAAGAGAAGGAAAGGTTGAGGG - Intronic
950891446 3:16408240-16408262 AGCTGAGATGGGAAGGATGACGG - Intronic
951062905 3:18231236-18231258 ATATGGAATGGGAAAGTTAAAGG - Intronic
951093485 3:18601507-18601529 ATATCAAATTGGAAGGAAGAGGG + Intergenic
951517493 3:23577555-23577577 ACATAAAATTGCAAGGTTGAGGG + Intronic
953516967 3:43602825-43602847 ATTTGAAAGGGAAAGGTTAATGG - Intronic
957548778 3:81676985-81677007 ATTTGAAAAGGAAAGGTTGTTGG - Intronic
958548324 3:95586771-95586793 ACATGACATGGGAAGGATAAAGG - Intergenic
958960673 3:100506659-100506681 TAATGCAATGGCAAGGTTGAAGG - Intronic
959317461 3:104825626-104825648 AAATGAAATTGGACGCTTGAGGG - Intergenic
959969518 3:112393564-112393586 ATAGGAGATGGCAAGGTGGAGGG + Intergenic
962525767 3:136236277-136236299 ATGTGAAAAGAGAAGGCTGAAGG - Intergenic
963940562 3:151092261-151092283 AAATGAACTGGCAAGGATGAGGG - Intronic
964352285 3:155815072-155815094 ATATGGAAAGGGAAGGTGGTTGG + Intergenic
965301826 3:167014483-167014505 ATGAGAAATGGGAAGGTAGTAGG - Intergenic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
967663024 3:192136276-192136298 AAATTAAATTGGAAGGTTGTGGG - Intergenic
967919675 3:194605062-194605084 GGATGAAATAGGAAGGTTTAAGG + Intronic
968264304 3:197350843-197350865 ATATGAAATGGGAAGTGAGTGGG - Intergenic
971754341 4:30688053-30688075 ATATGGAATGGAAAAGTTGATGG - Intergenic
972283281 4:37623652-37623674 ATCTGAAATGTGGAGGTGGAGGG - Intronic
974329540 4:60459901-60459923 ATATGACATGGGTAGATGGATGG + Intergenic
974449891 4:62040754-62040776 ATATCAAATGGGAGAGCTGACGG + Intronic
974528960 4:63082059-63082081 CTATAGACTGGGAAGGTTGAGGG + Intergenic
974660687 4:64884526-64884548 AGCTAAAATGGGAAGGATGAAGG - Intergenic
977667211 4:99654785-99654807 AGATGAAAAGAGAAGGTTGGGGG + Intergenic
979284830 4:118910641-118910663 CTATGAAATGTGAAGGTAGTTGG - Intronic
982299686 4:153866273-153866295 AGATGAAAGGGAAAGGGTGAGGG + Intergenic
984274187 4:177589234-177589256 ACATGAATTGGTAAGGATGAGGG - Intergenic
984797110 4:183672178-183672200 ATGTGACCTGGGAAGGTTTAAGG + Intronic
986415451 5:7523586-7523608 ATTTGAAATGGGAGGTTTGTAGG + Intronic
988211190 5:28206349-28206371 AAATGAAATGAGAACCTTGATGG - Intergenic
989093830 5:37762557-37762579 ATGTAAAATGGAAAGGTTTATGG - Intergenic
991526137 5:67560267-67560289 ATTTAAAATGTGAAGTTTGATGG + Intergenic
992269015 5:75046907-75046929 AAGTGAAATGAGAAAGTTGACGG + Intergenic
992273560 5:75090952-75090974 AGATCAAATGGGAAGATTAAAGG + Intronic
994330521 5:98500195-98500217 TTATGAAATGGGGATGTTTAAGG - Intergenic
994632022 5:102297644-102297666 ATTTGAACTCGGAAGGTGGAGGG + Intergenic
994740871 5:103617109-103617131 ATATGAAATTAGAAGGTAAATGG + Intergenic
995635826 5:114188957-114188979 ATATGAAAAATGAAGGTTCAAGG + Intergenic
996060922 5:119032352-119032374 ATATAAAATGTGAAGGGTGGGGG - Intergenic
996330924 5:122327902-122327924 ATGTGAAATGGGGAGGAAGATGG + Intronic
996450785 5:123621754-123621776 ATATGTAAAGGAAAGGCTGAGGG - Intergenic
996721551 5:126635426-126635448 ATATAAAATGGGAATATTAAAGG - Intronic
998050143 5:139025629-139025651 AGATGAAGTGGGAAGGTTCGGGG - Intronic
998302334 5:141035879-141035901 ATATGAATTGCTAAGATTGATGG - Intergenic
999292559 5:150436147-150436169 ATAAGAAATGGATAGGCTGAGGG + Intergenic
999494526 5:152084079-152084101 ATATGGAATGGGAACATCGAAGG - Intergenic
1000422212 5:161051273-161051295 ATATGAGCTGGGAAGAGTGAAGG + Intergenic
1002138406 5:177122821-177122843 AATTGAGAGGGGAAGGTTGAAGG - Intergenic
1002492083 5:179585680-179585702 GTATGAAATGGAAAGGCAGAGGG - Intronic
1003518524 6:6837563-6837585 ATATGGATTGGGAGGGTTGTGGG - Intergenic
1004996376 6:21197506-21197528 ATATGAAATGTGGAGGTGCAAGG + Intronic
1005813733 6:29534046-29534068 AGATGAGATGGAAAGGATGAGGG - Intergenic
1005902885 6:30233974-30233996 AAATGAAATTGAAAGGTTTAAGG - Intergenic
1006099487 6:31677316-31677338 ATATGAAATGTAATGGTTGGAGG + Intronic
1006539082 6:34724802-34724824 AGCTGAAATGGGAAGATTGCTGG - Intergenic
1006817971 6:36866179-36866201 TTATAATATGGGAAAGTTGAAGG + Intronic
1009809050 6:68637281-68637303 TTATGCAATGGGAAGGAAGAGGG + Intronic
1010173033 6:72994748-72994770 ATATGAGATGGGAAAATTGTTGG + Intronic
1010683824 6:78828545-78828567 TTATTATCTGGGAAGGTTGATGG - Intergenic
1013545646 6:111154482-111154504 ACATGAAAAGGGAAGCATGATGG + Intronic
1013699233 6:112743534-112743556 ATGGGAAATGGGAAGATAGAAGG - Intergenic
1014398431 6:120955964-120955986 GAATTAACTGGGAAGGTTGAAGG + Intergenic
1016653173 6:146486292-146486314 ATAAGGAATGGGACAGTTGATGG - Intergenic
1017309348 6:152957807-152957829 TTTTGGAATGGGAATGTTGATGG + Intergenic
1018616842 6:165694762-165694784 AGATGAGAAGGGAATGTTGATGG + Intronic
1018840371 6:167512252-167512274 AAATGAAATGGGAAGATTTCAGG + Intergenic
1019886099 7:3906978-3907000 AAATGAAAAGGTAAGCTTGATGG - Intronic
1021579159 7:22133859-22133881 ATAAGAAAGAGGAAGATTGAGGG + Intronic
1023094541 7:36646955-36646977 ATATGAACTTGGAGGGTGGAGGG + Intronic
1023684057 7:42717179-42717201 ATATCAAAGGGGAAGGCTAAGGG - Intergenic
1024022633 7:45385828-45385850 GTAGGGAATGGGAAGGTGGAAGG + Intergenic
1024030660 7:45456984-45457006 AGATGAGATGGGAAAGTTGAGGG - Intergenic
1027752321 7:82165160-82165182 TTAGGAAATGGGGAGGTAGAAGG - Intronic
1028267698 7:88748023-88748045 ATATGACATGGGAAGGGTCCAGG + Intergenic
1028742947 7:94297388-94297410 AGATGAAAGGGGATGGCTGAAGG - Intergenic
1032927086 7:136619536-136619558 ATATGAAACCTGAAGTTTGAGGG - Intergenic
1032978620 7:137254720-137254742 TTTTGAAAAGGGAAGATTGAAGG + Intronic
1034001961 7:147424155-147424177 AGAAGAAATGGGTAGATTGAAGG - Intronic
1034315229 7:150124703-150124725 ACATGGACTGGGAAGGGTGAAGG - Intergenic
1034479079 7:151306032-151306054 AGATGTAATAGGAAGGCTGAAGG - Intergenic
1034791662 7:153976096-153976118 ACATGAACTGGGAAGGGTGAAGG + Intronic
1035333048 7:158108560-158108582 ATATGCAATGAGCAGGTTCAAGG - Intronic
1037153108 8:15663419-15663441 AAATAAAATGGGAAGGATGAAGG - Intronic
1038067188 8:23975310-23975332 ATAGGAAATGGGGAGTTAGAGGG + Intergenic
1038098782 8:24348188-24348210 AAATGAATTGGGAAGTTTTAGGG - Intronic
1041379025 8:57233036-57233058 TAATGAAATGGGAATGTGGATGG + Intergenic
1041623099 8:59996360-59996382 ATATTAAATTGGAATTTTGAGGG + Intergenic
1041716174 8:60934408-60934430 CTATGAAATGGGAATGTTATAGG - Intergenic
1042386610 8:68183045-68183067 AGATGGAATGGGAAGTTTGTTGG + Intronic
1042509602 8:69597505-69597527 ATATTAAAAGGGAAAGTTCAGGG - Intronic
1042588352 8:70368360-70368382 ATAAGACATGGAAAAGTTGAGGG + Intronic
1045312555 8:101015743-101015765 ATATGAAATGCCAAGTCTGATGG - Intergenic
1045940828 8:107736138-107736160 AAATGGAATGGGAACGTAGAAGG + Intergenic
1046057742 8:109098540-109098562 ATAGAAAATGCGAAGATTGAAGG - Intronic
1046535537 8:115504086-115504108 GTAGGAAATGAGAAGGTTTAGGG - Intronic
1046681494 8:117175422-117175444 ATGGGAAATGGGAATGTTGAAGG + Intronic
1047673120 8:127170589-127170611 ATATGAAATTGGAAAGTTACAGG + Intergenic
1049906920 9:226391-226413 ATATCAAATGGGATGGTTTATGG + Intronic
1050195646 9:3080342-3080364 ATTTTAAATGAGAAAGTTGAAGG - Intergenic
1052367812 9:27632802-27632824 GTAAGATATGGGAAAGTTGATGG - Intergenic
1055444858 9:76372355-76372377 AAATGATATGGGAGGGGTGAGGG - Intergenic
1056029073 9:82532760-82532782 ATATGAAAAAAGAAGATTGAAGG - Intergenic
1058426074 9:104876219-104876241 ATAAGCAATGGCAAGGCTGAGGG + Intronic
1059009907 9:110445744-110445766 ATGGGAAATGGGAAAGTAGAGGG - Intronic
1059101372 9:111475247-111475269 ATATAAAATGGGAAGCATCAAGG + Intronic
1059343209 9:113611345-113611367 ATTAGAAATGAGAAGGGTGAGGG + Intergenic
1059520725 9:114939289-114939311 CTATGAAATAGGAAGCTTGGTGG + Intergenic
1059682500 9:116599797-116599819 ATCTGACATGGGGAGGTGGAAGG - Intronic
1059747607 9:117218253-117218275 ATATCAAATGGCAAGGTCAAGGG - Intronic
1060102545 9:120853202-120853224 ATAGGAAATGGGAGGGGAGAGGG + Intergenic
1061245050 9:129397315-129397337 GGCTGAAATGGGAAGGTCGACGG + Intergenic
1186197993 X:7129235-7129257 ATATAAAATGGAAAGGAAGAAGG - Intronic
1186695714 X:12029800-12029822 ATATTAAATGGCAGGGATGAAGG - Intergenic
1186791828 X:13007218-13007240 AGAAGAAATGGGAGGGTGGAGGG + Intergenic
1187224592 X:17363129-17363151 ATAAGGGATGGGAAGGATGACGG - Intergenic
1187801115 X:23064002-23064024 ATAGGAAATAGGAGAGTTGAGGG + Intergenic
1188607321 X:32047772-32047794 ATAACAAATTGGAAGGCTGAGGG + Intronic
1189150030 X:38697162-38697184 AAAAGAAGTGGGAATGTTGATGG + Intergenic
1191842964 X:65526071-65526093 ATATCAAATGGCAAGGTGGAGGG - Intronic
1195758296 X:108220793-108220815 ATAAGAGATGGGATGGGTGATGG - Intronic
1195886112 X:109639342-109639364 AGAGGAAATGGGGAGGATGAAGG + Intronic
1195950821 X:110270792-110270814 AAATGAAGTGAGAAGGCTGAGGG - Intronic
1197830890 X:130641154-130641176 ATATGATATGCGTAGGCTGAAGG - Intronic
1198798923 X:140430119-140430141 TTATGAAAAGGGAAAATTGAAGG - Intergenic
1199535642 X:148899671-148899693 ATATGAAATGGAAATGTAAAAGG + Intronic
1201571597 Y:15421305-15421327 ATATAAAATGGAAAGGAAGAAGG - Intergenic