ID: 1106269262

View in Genome Browser
Species Human (GRCh38)
Location 13:28138394-28138416
Sequence TTTTCTTAAAGGGGCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 41}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106269262 Original CRISPR TTTTCTTAAAGGGGCCGCGC GGG (reversed) Intergenic
902400903 1:16156141-16156163 TGTCTTTAAAGGGGCCGGGCTGG + Intergenic
911638828 1:100266130-100266152 TCGGCTTAAAGGAGCCGCGCTGG - Intergenic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
1066819187 10:39463484-39463506 TTTTCCTAAATAGGCCGCACAGG + Intergenic
1072881867 10:99236112-99236134 ATCTCTTAAAGGGGCGGTGCCGG - Intergenic
1097761256 12:63467514-63467536 TTTACTTACAGGGGCTGCTCTGG - Intergenic
1103854893 12:123960189-123960211 CTTTCTTAAAGGGCCAGCCCAGG - Intronic
1105766603 13:23566341-23566363 TTTTCTTAAAGGGCCAGTTCAGG - Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1109868660 13:68301947-68301969 TTTTCTTGAAGTGGCCGTGGAGG - Intergenic
1121342971 14:93115961-93115983 GCCTCTTAAAGGCGCCGCGCCGG + Intronic
1129463856 15:75712958-75712980 CCTTCTTAAAGGGCCCGTGCGGG + Intergenic
1138467458 16:57202028-57202050 TTATCTCAGAGGGGCCGAGCAGG + Intronic
1140168239 16:72576816-72576838 TTTTCTTAAAGTTGCCATGCGGG + Intergenic
1143876729 17:9997224-9997246 ATATTTTAAAGGGGCCGGGCGGG + Intronic
1144489908 17:15699869-15699891 GTTTGTTAAAGGGGCCTCGAGGG + Exonic
1144911054 17:18682090-18682112 GTTTGTTAAAGGGGCCTCGAGGG - Intronic
1145243650 17:21253533-21253555 ACCTCTTAAAGGGGCCGCGCCGG + Intergenic
1148826647 17:50398805-50398827 TTATCTCAGAGGGGCCGAGCAGG + Intergenic
1160791020 19:923815-923837 TTCCCCCAAAGGGGCCGCGCAGG - Intergenic
1162555435 19:11383314-11383336 TTTTCTTATCGGGTCCGCCCAGG - Intronic
1163507936 19:17719436-17719458 GCCTCTTAAAGGGGCCGCACCGG - Exonic
1163783581 19:19262876-19262898 GTGTATTAAAGGGGCCGCGGGGG + Intergenic
1166197917 19:41219055-41219077 CTTTCTTAAAGGGGCCAGGGAGG - Intergenic
931484516 2:62676714-62676736 TTTTTTTAAAGGGCCTTCGCCGG + Intronic
933833420 2:86228049-86228071 TTTGCTTAAAGGGTCAGGGCAGG - Intronic
934714818 2:96537346-96537368 TTTCCTGAAAGGGGCTGCGCGGG + Intronic
936265063 2:110998439-110998461 TTCACTTAAAGGAGCCGCACTGG - Intronic
1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG + Intronic
1170576587 20:17667247-17667269 TTTTCTTAAAGGGGGAAGGCTGG + Intronic
1173210561 20:41028788-41028810 TTGTTTAAAAGCGGCCGCGCAGG + Intergenic
1182691322 22:32165574-32165596 TTTACTAAATGGGGCAGCGCAGG + Intergenic
1183607158 22:38872431-38872453 GGCTCTTAAAGGGGCCGCGCGGG + Intergenic
951080199 3:18444253-18444275 TTTTCTAAAAGGGGCCATACCGG + Intronic
953004469 3:38965360-38965382 TTGTCTTACAGGGGCCTGGCAGG - Intergenic
954822927 3:53347317-53347339 GTCTCTTAAAGGGGCCGCGCGGG - Intronic
955007590 3:54984058-54984080 TTCTGTTAAAGGGGCCCCTCAGG - Intronic
962305033 3:134278451-134278473 TTATCTTCCAGGGGCCACGCTGG + Intergenic
966594701 3:181715168-181715190 ATTTCTTAAATTGGCAGCGCGGG + Intergenic
989448473 5:41559090-41559112 TTTTGGTAAAGGGGCCACTCAGG + Intergenic
998157597 5:139795574-139795596 CTTTCTTAAAGGGCCCGCGCGGG + Intergenic
1001035322 5:168292568-168292590 TCTTCCTAAAGGGGGCGGGCGGG - Intronic
1013283026 6:108656479-108656501 TTTCCTGGAAGGGGCCGCCCTGG + Intronic
1026421468 7:70241588-70241610 TTTTCTTACAGGGGTCCCACAGG - Intronic
1032064646 7:128757576-128757598 TATTCTTAAAGGGGCCCTGTGGG + Intronic
1034004508 7:147454823-147454845 TTTTCTTAAAGTTGCAGTGCTGG - Intronic
1037527349 8:19740010-19740032 TTTGGTTAAAGGGGCCCAGCAGG - Intronic