ID: 1106269262

View in Genome Browser
Species Human (GRCh38)
Location 13:28138394-28138416
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 41}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106269262 Original CRISPR TTTTCTTAAAGGGGCCGCGC GGG (reversed) Intergenic