ID: 1106269371

View in Genome Browser
Species Human (GRCh38)
Location 13:28138732-28138754
Sequence GGCGGTGGTGGCCCCGCCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 475}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106269364_1106269371 -4 Left 1106269364 13:28138713-28138735 CCTCGCTGGCGGCGGCGGTGGCG 0: 1
1: 4
2: 30
3: 189
4: 547
Right 1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG 0: 1
1: 0
2: 0
3: 40
4: 475
1106269360_1106269371 2 Left 1106269360 13:28138707-28138729 CCTCCTCCTCGCTGGCGGCGGCG 0: 1
1: 0
2: 4
3: 38
4: 225
Right 1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG 0: 1
1: 0
2: 0
3: 40
4: 475
1106269349_1106269371 24 Left 1106269349 13:28138685-28138707 CCCTCGGCCGCCGCCTCCCCTTC 0: 1
1: 0
2: 10
3: 38
4: 509
Right 1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG 0: 1
1: 0
2: 0
3: 40
4: 475
1106269356_1106269371 7 Left 1106269356 13:28138702-28138724 CCCTTCCTCCTCCTCGCTGGCGG 0: 1
1: 0
2: 3
3: 18
4: 282
Right 1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG 0: 1
1: 0
2: 0
3: 40
4: 475
1106269346_1106269371 27 Left 1106269346 13:28138682-28138704 CCCCCCTCGGCCGCCGCCTCCCC 0: 1
1: 2
2: 18
3: 169
4: 1529
Right 1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG 0: 1
1: 0
2: 0
3: 40
4: 475
1106269353_1106269371 11 Left 1106269353 13:28138698-28138720 CCTCCCCTTCCTCCTCCTCGCTG 0: 1
1: 0
2: 27
3: 308
4: 2293
Right 1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG 0: 1
1: 0
2: 0
3: 40
4: 475
1106269348_1106269371 25 Left 1106269348 13:28138684-28138706 CCCCTCGGCCGCCGCCTCCCCTT 0: 1
1: 0
2: 9
3: 46
4: 416
Right 1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG 0: 1
1: 0
2: 0
3: 40
4: 475
1106269350_1106269371 23 Left 1106269350 13:28138686-28138708 CCTCGGCCGCCGCCTCCCCTTCC 0: 1
1: 0
2: 18
3: 219
4: 1795
Right 1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG 0: 1
1: 0
2: 0
3: 40
4: 475
1106269345_1106269371 30 Left 1106269345 13:28138679-28138701 CCGCCCCCCTCGGCCGCCGCCTC 0: 1
1: 0
2: 17
3: 184
4: 1583
Right 1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG 0: 1
1: 0
2: 0
3: 40
4: 475
1106269351_1106269371 17 Left 1106269351 13:28138692-28138714 CCGCCGCCTCCCCTTCCTCCTCC 0: 1
1: 39
2: 775
3: 5113
4: 13434
Right 1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG 0: 1
1: 0
2: 0
3: 40
4: 475
1106269352_1106269371 14 Left 1106269352 13:28138695-28138717 CCGCCTCCCCTTCCTCCTCCTCG 0: 1
1: 55
2: 877
3: 5046
4: 13488
Right 1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG 0: 1
1: 0
2: 0
3: 40
4: 475
1106269358_1106269371 6 Left 1106269358 13:28138703-28138725 CCTTCCTCCTCCTCGCTGGCGGC 0: 1
1: 0
2: 2
3: 65
4: 340
Right 1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG 0: 1
1: 0
2: 0
3: 40
4: 475
1106269355_1106269371 8 Left 1106269355 13:28138701-28138723 CCCCTTCCTCCTCCTCGCTGGCG 0: 1
1: 0
2: 7
3: 66
4: 693
Right 1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG 0: 1
1: 0
2: 0
3: 40
4: 475
1106269362_1106269371 -1 Left 1106269362 13:28138710-28138732 CCTCCTCGCTGGCGGCGGCGGTG 0: 1
1: 0
2: 3
3: 19
4: 162
Right 1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG 0: 1
1: 0
2: 0
3: 40
4: 475
1106269347_1106269371 26 Left 1106269347 13:28138683-28138705 CCCCCTCGGCCGCCGCCTCCCCT 0: 1
1: 1
2: 19
3: 207
4: 1712
Right 1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG 0: 1
1: 0
2: 0
3: 40
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106269371 Original CRISPR GGCGGTGGTGGCCCCGCCGG GGG Exonic