ID: 1106269431

View in Genome Browser
Species Human (GRCh38)
Location 13:28138952-28138974
Sequence CCGCCGGGAGCCGTCGCGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106269419_1106269431 12 Left 1106269419 13:28138917-28138939 CCCTGGCTCTGGCTGGTGCACCC 0: 1
1: 0
2: 4
3: 25
4: 290
Right 1106269431 13:28138952-28138974 CCGCCGGGAGCCGTCGCGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 118
1106269426_1106269431 -9 Left 1106269426 13:28138938-28138960 CCGTGGCCGGCTTTCCGCCGGGA 0: 1
1: 0
2: 3
3: 3
4: 63
Right 1106269431 13:28138952-28138974 CCGCCGGGAGCCGTCGCGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 118
1106269413_1106269431 29 Left 1106269413 13:28138900-28138922 CCATAGCAACAGCGTCCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 96
Right 1106269431 13:28138952-28138974 CCGCCGGGAGCCGTCGCGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 118
1106269418_1106269431 13 Left 1106269418 13:28138916-28138938 CCCCTGGCTCTGGCTGGTGCACC 0: 1
1: 0
2: 5
3: 26
4: 290
Right 1106269431 13:28138952-28138974 CCGCCGGGAGCCGTCGCGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 118
1106269424_1106269431 -8 Left 1106269424 13:28138937-28138959 CCCGTGGCCGGCTTTCCGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1106269431 13:28138952-28138974 CCGCCGGGAGCCGTCGCGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 118
1106269417_1106269431 14 Left 1106269417 13:28138915-28138937 CCCCCTGGCTCTGGCTGGTGCAC 0: 1
1: 1
2: 0
3: 42
4: 359
Right 1106269431 13:28138952-28138974 CCGCCGGGAGCCGTCGCGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 118
1106269420_1106269431 11 Left 1106269420 13:28138918-28138940 CCTGGCTCTGGCTGGTGCACCCG 0: 1
1: 0
2: 1
3: 13
4: 170
Right 1106269431 13:28138952-28138974 CCGCCGGGAGCCGTCGCGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106269431 Original CRISPR CCGCCGGGAGCCGTCGCGGG CGG Exonic