ID: 1106273119

View in Genome Browser
Species Human (GRCh38)
Location 13:28173757-28173779
Sequence TTCTCTTTAGAGTTTAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106273119 Original CRISPR TTCTCTTTAGAGTTTAGGGT AGG (reversed) Intronic
902560388 1:17273546-17273568 TGCTCTTTAGGGATGAGGGTAGG + Intronic
905986498 1:42288065-42288087 TTCACTTTACAATTTAGGGGAGG + Intronic
908338078 1:63147806-63147828 TTCTCTTTTGAGTGGGGGGTGGG + Intergenic
909130398 1:71728598-71728620 TTCTCTTTTGATTTTCGAGTAGG + Intronic
909196893 1:72638284-72638306 TTCTATATCGAGTTTAAGGTAGG + Intergenic
910380368 1:86620874-86620896 TTCTCTGGGGAGTTGAGGGTTGG - Intergenic
910389381 1:86722912-86722934 CTCTCTATAGATTTTAGCGTTGG - Intronic
911888674 1:103338550-103338572 TTCAGTTTATAGTTTATGGTGGG + Intergenic
911983537 1:104595154-104595176 TTCTCTTTTGAGTATAGGGAGGG - Intergenic
912174136 1:107137664-107137686 TTCTCTTTAGAGATTTGGCAGGG - Intergenic
912555015 1:110509382-110509404 GTCTCTTTAGGGTATAGGGAGGG + Intergenic
916660569 1:166919825-166919847 TTTTCTTTAGTGTTTAGTATGGG - Intronic
917391014 1:174537094-174537116 TTATCTTTATAGTTTGGTGTGGG - Intronic
918286578 1:183061343-183061365 TTGTCTTTAGATTTTTTGGTTGG + Intronic
918667900 1:187174992-187175014 GTCACTTTAGAGTTGGGGGTGGG + Intergenic
919010181 1:191949989-191950011 TTCTCTTTACATTTTAGTTTAGG - Intergenic
919271182 1:195348337-195348359 TTCTCATTAGTTTTTGGGGTAGG - Intergenic
920540148 1:206772129-206772151 TTCTCTTAAGAATTTAAGTTTGG + Intronic
921554981 1:216587302-216587324 TTCTTTTTAAAGTTCAGAGTGGG - Intronic
921848700 1:219910729-219910751 TTCTCATTAGAGTGCAGAGTAGG + Intronic
922681874 1:227605180-227605202 TTCTCTTTAGAGTTTTTATTTGG + Intronic
923184060 1:231552346-231552368 TTCTATTTAGAGTTTACTGTTGG + Intronic
924043657 1:240007820-240007842 TTCAGCTTGGAGTTTAGGGTAGG + Intergenic
924126313 1:240856398-240856420 TTCTCTTTAGCCTTTAGTGTGGG + Intronic
924446505 1:244137601-244137623 TTCTCTGTAGAGTTGCAGGTTGG - Intergenic
924447829 1:244150205-244150227 TTCTCCTTAGAGTATGGGGAAGG - Intergenic
1063020330 10:2120551-2120573 TTCTCTCTACATTTTAGCGTAGG - Intergenic
1066823497 10:39528872-39528894 TTCTGTCTAGAGTTTATGTTAGG - Intergenic
1066823523 10:39529379-39529401 TTCTGTCTAGAGTTTATGTTAGG - Intergenic
1068077106 10:52270079-52270101 TTCTCTTTAAACTGTAGGGAGGG + Intronic
1070767218 10:79063687-79063709 TTCACTTTAGAGTTTGAGGGCGG - Intergenic
1072164564 10:92800618-92800640 TTCTGTTTACAGTTTAGGAGTGG + Intergenic
1073491133 10:103854462-103854484 TTCTCATTAAAGTTTGGGGGAGG + Intronic
1076109514 10:127850078-127850100 TTCCCCTTAGAGGTTAGGGAAGG + Intergenic
1076487466 10:130833972-130833994 TTCTCTTTAGAGTCTCAGGCAGG - Intergenic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1079983637 11:27177757-27177779 CTCTCTTGAGAGGTCAGGGTGGG - Intergenic
1080031378 11:27665097-27665119 TTTTCTTTAGAATTTCAGGTGGG + Intronic
1080107101 11:28522157-28522179 TTCTATTTAGAGTGAAGGGAGGG - Intergenic
1081155868 11:39689791-39689813 CACTCTTTAAATTTTAGGGTTGG - Intergenic
1082758135 11:57098404-57098426 TTCTATTTAGAGTGCAGAGTTGG - Intergenic
1083122677 11:60531306-60531328 TTCTCTGTTGAGTTTCTGGTTGG - Intronic
1083843798 11:65319572-65319594 TTCTCTTTAGATGCCAGGGTAGG + Intronic
1085330458 11:75645327-75645349 TTCTGTTTAGGGTTCTGGGTGGG + Intronic
1085413739 11:76306860-76306882 GTCTCTCTAGAATATAGGGTGGG + Intergenic
1087127354 11:94641028-94641050 TTCTCATTAGATTTCAGGGAAGG - Intergenic
1090824765 11:130376788-130376810 TTGTCTTTGGAGGTTACGGTTGG + Intergenic
1094165095 12:27435395-27435417 ACCTCTTTAGAGTTTAGAGTAGG - Intergenic
1098600157 12:72321807-72321829 TTTTGTTTAGTGTTTAGTGTTGG + Intronic
1098745687 12:74234498-74234520 TTCTGTTTGGAGTTTTTGGTAGG + Intergenic
1099075361 12:78101216-78101238 TTCACTTTGTAGTTTATGGTGGG - Intronic
1101138815 12:101773574-101773596 TTCTTTTTAGTGCCTAGGGTTGG + Intronic
1103265855 12:119629546-119629568 TCATCCTTAGAGTTTAGGGAAGG + Intronic
1103289191 12:119830196-119830218 TTCTCTTGAGCTTTTAGGGTTGG - Intronic
1104020188 12:124987052-124987074 TTCTCCTAAGAGTGTACGGTGGG + Intronic
1105800866 13:23902481-23902503 ATGTCTATAGAGTTTTGGGTAGG - Intronic
1106273119 13:28173757-28173779 TTCTCTTTAGAGTTTAGGGTAGG - Intronic
1106815833 13:33405812-33405834 TTCTATGTGGAGTTTACGGTTGG - Intergenic
1107063478 13:36187047-36187069 TTCTCTTTAGAGATTTGCCTGGG - Intronic
1107219202 13:37961190-37961212 TACTTTTAAGAGTTTAGGCTGGG + Intergenic
1107455019 13:40546812-40546834 TGCTCTTTAGTGTGTAGTGTGGG - Intergenic
1107540982 13:41388902-41388924 TTCTCTCTACAGTTTAATGTAGG - Intergenic
1108040329 13:46333869-46333891 CTTTCTATAGAGTTCAGGGTTGG + Intergenic
1108964812 13:56284803-56284825 CTTTCTTGAGAGTTGAGGGTGGG - Intergenic
1109344342 13:61096780-61096802 TTTTCTTTAGAAATTAGAGTGGG + Intergenic
1110657882 13:78022195-78022217 TGCACTTAAGAGTTTAGGGCAGG + Intergenic
1110793833 13:79614319-79614341 TTCTCATTACAGTATAGGGAAGG + Intergenic
1113218232 13:108068562-108068584 TTCTCTTAAGGGTAAAGGGTAGG - Intergenic
1113241084 13:108337960-108337982 TTCTTGTTAGAGTTTATGATGGG - Intergenic
1114295172 14:21322518-21322540 TTCTCTGTAGAGTTTCAAGTGGG + Intronic
1114972781 14:28055090-28055112 CTTTCTTTAGAGTTTGGAGTTGG - Intergenic
1115647462 14:35379157-35379179 TTGTCTTTAGATTTTATAGTGGG - Intergenic
1116855996 14:49952846-49952868 ATCTCTTTAGATTTGAGGATAGG - Intergenic
1117155059 14:52930968-52930990 TTCTCTTTCGATTTTAGAGTTGG + Intronic
1117428622 14:55628147-55628169 TTTCCTTTAGAGTTTTGGGAGGG + Intronic
1117547608 14:56805799-56805821 TTTTTTTTTAAGTTTAGGGTGGG - Intronic
1119114800 14:72009342-72009364 TTTTTTTTAGAGTTTGGGGTGGG - Intronic
1124329290 15:28795364-28795386 CTCCCTTTAGAGTTTTGGGAGGG + Intergenic
1124860428 15:33434751-33434773 TTCTCTTTAGTGTTTGCTGTAGG + Intronic
1127619184 15:60716725-60716747 CTCTCTTCAGAGTATAGGGTGGG - Intronic
1128448824 15:67789050-67789072 TTATCTCTAGAGATTAGGGCTGG - Intronic
1128556398 15:68634834-68634856 TTCTCATTTGAGTCAAGGGTGGG + Intronic
1129095623 15:73204483-73204505 TTCTCTTTGCATTTTAGTGTAGG + Intronic
1129316494 15:74748599-74748621 CTGTCTTTAGGGTTCAGGGTAGG - Intergenic
1134799479 16:17071340-17071362 TTCTTCTTAGAGTCTAGGCTGGG + Intergenic
1139000767 16:62506997-62507019 TAGACTTTAGAGTTTATGGTGGG + Intergenic
1139274202 16:65712147-65712169 TTCAATTTAAAGTTTTGGGTTGG - Intergenic
1140561199 16:75983962-75983984 TTTTCTTTGGAGTTTTGTGTAGG + Intergenic
1140835401 16:78789318-78789340 TTTTCTATATAGTTTAAGGTAGG + Intronic
1144970674 17:19107389-19107411 TTAGCTTTGGAGTTTAGGCTTGG + Intergenic
1144990977 17:19233551-19233573 TTAGCTTTGGAGTTTAGGCTTGG + Intronic
1146260982 17:31420785-31420807 TTCTCTTGAGACTTTGGGGCTGG + Intronic
1150832112 17:68532080-68532102 TTTTATTTACATTTTAGGGTGGG + Exonic
1153197187 18:2613562-2613584 TTCTGTGTAGAGTTTAAGGTAGG - Intronic
1154552705 18:15706912-15706934 TTCTCTTTATAGATTAGTTTTGG + Intergenic
1157370716 18:47109089-47109111 CTATCTTTAGAGCTGAGGGTAGG - Intronic
1158281368 18:55831937-55831959 TTCTCTTTAGAGTTTCTGAATGG - Intergenic
1162610417 19:11745800-11745822 TTCTCTTTAGAGGTGAGGTCTGG - Intergenic
926004803 2:9365489-9365511 TTGTTTTGAGAGTTTGGGGTGGG - Intronic
927017140 2:18976398-18976420 TTTTCTGTGGAGTTCAGGGTAGG - Intergenic
929096933 2:38272037-38272059 TTCTCTTCAGAGTAAAGGGTAGG - Intergenic
929809783 2:45180050-45180072 TTCTTTTGGTAGTTTAGGGTTGG - Intergenic
932562568 2:72886473-72886495 ATCTCTTTAGAGTTTAGCAAGGG - Intergenic
932751199 2:74372789-74372811 TTCTCTTCAGAGGAAAGGGTGGG - Intronic
944748497 2:202682950-202682972 TTCTCTTTCTAGATTAAGGTAGG - Intronic
945499552 2:210554367-210554389 TTCTCTCTAGACTTTAGAGTAGG + Intronic
947867450 2:233409079-233409101 TCTTCTTTAGAGTTTGGGGTGGG + Intronic
1169050010 20:2567936-2567958 TTCTCTCTATAGTTTAGATTGGG - Intronic
1169135426 20:3194388-3194410 TTTCCTTTGGAGTTTAGGGTGGG - Intronic
1170478270 20:16738626-16738648 TACTATTTAAAGTTTAGGGCTGG + Intronic
1172540725 20:35713751-35713773 AGCTATTTAGAGATTAGGGTGGG + Intronic
1174860706 20:54088530-54088552 TTCTATTTATAATTTATGGTTGG + Intergenic
1175131408 20:56792447-56792469 GTATCTTTAGAGTTTGGGGTTGG + Intergenic
1175526420 20:59637618-59637640 TTCACGTTAGGGTTGAGGGTAGG - Intronic
1177495392 21:21883561-21883583 TTCTGTTTAGGGTTTTGGGGTGG + Intergenic
949648212 3:6123556-6123578 TTCTCTTTGGGGTTTAGTGAAGG - Intergenic
949881676 3:8666220-8666242 TTCTTTTTAGTGTTTAGATTTGG - Intronic
953431729 3:42845676-42845698 TTCTTTTTATGGTTAAGGGTGGG - Intronic
953714081 3:45301084-45301106 TGCTCTATAGAGCTGAGGGTGGG - Intergenic
956689119 3:71859904-71859926 TTCTCTTTAGAGGTCAGGGAAGG - Intergenic
958130188 3:89409245-89409267 TTCTTTTTAGACTTTTGAGTTGG - Intronic
959086117 3:101852238-101852260 TTCTGTTTTGAGTATAGAGTTGG + Intronic
959102672 3:102030920-102030942 TACTCTTTCTATTTTAGGGTAGG + Intergenic
959166269 3:102782517-102782539 GTCTCTTTTGATTTTAAGGTTGG - Intergenic
959778157 3:110194960-110194982 TTATCTTTAGAATTTAAGGTTGG + Intergenic
960644159 3:119860024-119860046 TCCTCCTGAGAGTGTAGGGTAGG - Intronic
962031316 3:131603550-131603572 TTTTATTTAGAATTTAGGTTAGG + Intronic
962121607 3:132566265-132566287 TTCTCTCTTTGGTTTAGGGTGGG - Intronic
963665425 3:148179618-148179640 TTCTTTTTATTGTTTAAGGTAGG + Intergenic
963854292 3:150238110-150238132 TTCTCTGTAGAATGAAGGGTAGG + Intergenic
963901860 3:150740735-150740757 TTCTTTTGAGAGTTTAGGGTTGG + Intergenic
964428780 3:156581924-156581946 TTCTCCTTAGAGATTAAGGGAGG + Intergenic
967765628 3:193276405-193276427 GTCTCTTTGGGTTTTAGGGTTGG + Intronic
969988095 4:11232460-11232482 TTCTCTTTAGTGTGTAGTGAAGG - Intergenic
972123670 4:35738034-35738056 ATCTCTTAAGATTTGAGGGTTGG - Intergenic
973655054 4:53038373-53038395 TTGTCTTTACAATTGAGGGTGGG - Intronic
974548366 4:63341676-63341698 TTCTCTTTAGTGTTTATCATGGG + Intergenic
975028848 4:69587527-69587549 TTCTCTTCAGACTTTAGTGCTGG + Intergenic
976144410 4:82027737-82027759 TTCTCTTGCTACTTTAGGGTTGG - Intronic
976772053 4:88663831-88663853 TTCTCTTTGGAGTTTAGATAGGG + Intronic
979943038 4:126786848-126786870 ATCTCTATAGAGTTTGGGATGGG + Intergenic
979965743 4:127075174-127075196 ATATCTTTAGAGTTTATGGGAGG - Intergenic
981721457 4:147805951-147805973 TTCTTTTTAGCCTTCAGGGTTGG - Intronic
982485306 4:155958994-155959016 TTGTCTTTACAATGTAGGGTAGG - Intergenic
982560536 4:156924094-156924116 TTCTCTGTGGATTTTAGGCTAGG - Intronic
983527391 4:168773069-168773091 TTCTCTCAAGAGTTTAGAGTAGG + Intronic
984271227 4:177550740-177550762 TTCTCTTCTGAGTTTAGACTTGG + Intergenic
985175787 4:187199144-187199166 TGCTCTTTAGAGTTAGGAGTTGG + Intergenic
987167054 5:15210538-15210560 TTCTCTTTGGAATTTGGGGTGGG - Intergenic
989883149 5:46825680-46825702 TTCTTTTGAGAGATCAGGGTTGG + Intergenic
989897471 5:47110627-47110649 TTCTTTTGAGAGATCAGGGTTGG + Intergenic
989897692 5:47114715-47114737 TTCTTTTGAGAGATCAGGGTTGG + Intergenic
989897914 5:47118806-47118828 TTCTTTTGAGAGATCAGGGTTGG + Intergenic
989898037 5:47121192-47121214 TTCTTTTGAGAGATCAGGGTTGG + Intergenic
989898216 5:47124429-47124451 TTCTTTTGAGAGATCAGGGTTGG + Intergenic
989898437 5:47128519-47128541 TTCTTTTGAGAGATCAGGGTTGG + Intergenic
989898653 5:47132608-47132630 TTCTTTTGAGAGATCAGGGTTGG + Intergenic
989898871 5:47136696-47136718 TTCTTTTGAGAGATCAGGGTTGG + Intergenic
989899094 5:47140786-47140808 TTCTTTTGAGAGATCAGGGTTGG + Intergenic
989899311 5:47144703-47144725 TTCTTTTGAGAGATCAGGGTTGG + Intergenic
989899532 5:47148792-47148814 TTCTTTTGAGAGATCAGGGTTGG + Intergenic
989899757 5:47152883-47152905 TTCTTTTGAGAGATCAGGGTTGG + Intergenic
991157277 5:63453843-63453865 TTATCTTTTGACTTTGGGGTTGG + Intergenic
991188173 5:63835572-63835594 TTCTTTTTAGAGTTAAGGGCTGG - Intergenic
992136251 5:73749095-73749117 TTCTCTTAAGAGCTTCTGGTTGG - Intronic
996621910 5:125515435-125515457 TTCTTTTTAACGTTTAGGCTCGG - Intergenic
997912939 5:137894341-137894363 TTCTCTGTGGAGTTTATGGAAGG + Exonic
999565254 5:152852476-152852498 TTTTCATTATAGTTGAGGGTTGG - Intergenic
999614011 5:153402697-153402719 TTCACTTTAGAGGGTAGTGTGGG - Intergenic
999619508 5:153458335-153458357 TTCTCTGTAAAGTTGAAGGTTGG - Intergenic
1002117597 5:176975941-176975963 TTCTTATTAAATTTTAGGGTGGG - Intronic
1002298454 5:178244298-178244320 CTCTTTTTAAAGTCTAGGGTGGG + Intronic
1003135309 6:3430600-3430622 CGCTCTTTAGAGTTTGGGGCAGG + Intronic
1004300247 6:14451367-14451389 TTTTCATTTGAGTTTAAGGTTGG + Intergenic
1006407486 6:33853620-33853642 TGCTCCTTAGAGCTGAGGGTTGG + Intergenic
1006671569 6:35732517-35732539 TTTTCACTGGAGTTTAGGGTAGG + Intergenic
1010565312 6:77404327-77404349 TTCTTTTTAGTTTTTATGGTAGG - Intergenic
1010768845 6:79805775-79805797 TTCTCTTTCCCCTTTAGGGTTGG - Intergenic
1010866507 6:80982404-80982426 TTCCCTTTAACGTTTAGGCTAGG + Intergenic
1013111359 6:107067787-107067809 TTCTTGTTAGATTTAAGGGTGGG - Exonic
1013497815 6:110716085-110716107 TTCTCTTCTGAGCTTAGGGTAGG + Intronic
1014057623 6:117034657-117034679 TTGTTTTTAGAGTTTATTGTGGG + Intergenic
1014442693 6:121491715-121491737 TTCCCTAAAGTGTTTAGGGTTGG + Intergenic
1016529841 6:145045324-145045346 TTCACTGTAGAGGTGAGGGTTGG + Intergenic
1017264427 6:152426006-152426028 TTCTATTTAGAGTCTAGATTAGG + Intronic
1017287704 6:152695831-152695853 TTTTCTTTAGAGTTTTGACTGGG + Intergenic
1017574874 6:155791283-155791305 TTCTTTGTATAGTTTGGGGTTGG - Intergenic
1018225750 6:161626978-161627000 TTCTCTTAAGAGCTTAGGTTAGG - Intronic
1018528644 6:164740603-164740625 TTCTCTGTACAGTTTTGGATTGG - Intergenic
1020663680 7:11012611-11012633 TGCTCTTTACACTTTAGAGTAGG - Intronic
1023156355 7:37256397-37256419 TATTCTTTAGAGTTTGGAGTTGG - Intronic
1026447078 7:70494260-70494282 TTCCCTTCAGAGTCTAGGCTTGG + Intronic
1027747136 7:82091014-82091036 TTCTTTTCAGAGATTAGGGTTGG - Intronic
1028006712 7:85580569-85580591 TTCTCTTTAGGCTTTTGGATGGG + Intergenic
1029932163 7:104383932-104383954 TTCTCTTGAGAGCTGAGGGAAGG - Intronic
1030388152 7:108891452-108891474 TTAAATTTAGAGTTTTGGGTCGG - Intergenic
1031371816 7:120977352-120977374 TTGTCTTTAGACTTTAGGAATGG + Intergenic
1031403525 7:121354742-121354764 TTCTCTTTAAAGTCTAGGCTGGG - Intronic
1031666571 7:124491585-124491607 TTACCTTTAGTGTTTAGGTTTGG - Intergenic
1032143038 7:129351448-129351470 TTCTCTCTTGAGTGTAGAGTGGG - Intronic
1032184179 7:129709400-129709422 TTCTCTTTATAGTATAGTGATGG - Intronic
1032674150 7:134113084-134113106 TTCTCTTCAGAATTTTGAGTGGG - Intergenic
1032729444 7:134623707-134623729 TTCTCTTTAGATTTTATAGTTGG + Intergenic
1037526051 8:19725235-19725257 ATCTCTTTAGAATGGAGGGTGGG - Intronic
1038053916 8:23839712-23839734 TGCTCTTTAGATTTTACAGTAGG + Intergenic
1040320475 8:46293347-46293369 TTCTCTTTAGTTTTTATGGTGGG + Intergenic
1041097723 8:54366034-54366056 TTCTCTTTAGTTTTTAGAGCTGG + Intergenic
1042674540 8:71305385-71305407 TTCTCAATAGAGTTTGGGGTGGG + Intronic
1043211985 8:77531513-77531535 TTCTAGTGAGAGTTTAGGGTTGG + Intergenic
1044638555 8:94353737-94353759 TTCTATTTGAATTTTAGGGTGGG - Intergenic
1044958941 8:97510777-97510799 TTCTCTTTGGAGTTTATTCTTGG + Intergenic
1045692441 8:104773746-104773768 TTTCCTTTAGATTTTAGGGCAGG + Intronic
1045963539 8:107997488-107997510 TCATCTTTAGAATTTTGGGTGGG - Intronic
1046456964 8:114478565-114478587 TGCTCTTTAAAGTTGAAGGTAGG - Intergenic
1046684829 8:117213543-117213565 TCCACTTAAGAGTTTTGGGTAGG - Intergenic
1046926194 8:119791865-119791887 TTCTCTTTATATTTTGGGATGGG + Intronic
1048018791 8:130519943-130519965 CTCTGTTTAGGGTTTGGGGTGGG + Intergenic
1048907318 8:139100791-139100813 TCCTCTTGTGAGTTTAGGGTAGG + Intergenic
1050022253 9:1296476-1296498 GTCACTATAGGGTTTAGGGTTGG - Intergenic
1051066203 9:13106488-13106510 TTCTTTTTTTAGTTTGGGGTGGG + Exonic
1053565476 9:39245935-39245957 ATCTCTTTAGATTTTAGGCTAGG - Intronic
1053831244 9:42083791-42083813 ATCTCTTTAGATTTTAGGCCAGG - Intronic
1054131672 9:61373104-61373126 ATCTCTTTAGATTTTAGGCTAGG + Intergenic
1054599303 9:67103647-67103669 ATCTCTTTAGATTTTAGGCCAGG + Intergenic
1056876807 9:90341423-90341445 TTCTCTTTAGAGTATACAGGAGG - Intergenic
1058606488 9:106728962-106728984 TTCTTTTTCTAGTTTATGGTTGG - Intergenic
1059835563 9:118148224-118148246 TCCACTTTAGGATTTAGGGTAGG - Intergenic
1186603072 X:11059138-11059160 TTCTATTTACAGTGTAGGCTGGG + Intergenic
1187541002 X:20194725-20194747 ATCTCTTTGGCCTTTAGGGTTGG + Intronic
1193325284 X:80172765-80172787 TTCCCTTTAGGATTTGGGGTAGG + Intergenic
1196398694 X:115291538-115291560 TTCACCTTAGAGATGAGGGTAGG + Intronic
1198223212 X:134621977-134621999 CTCTCTTTTGAGTTCAAGGTGGG + Intronic
1200941104 Y:8782918-8782940 TTCTCTCTAAACTTTAGGCTGGG - Intergenic
1200954791 Y:8931977-8931999 TTCTATTTAGTATTTAGGTTTGG - Intergenic