ID: 1106275126

View in Genome Browser
Species Human (GRCh38)
Location 13:28197300-28197322
Sequence GTTCCACCAAACCATATTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106275126_1106275127 2 Left 1106275126 13:28197300-28197322 CCATCAATATGGTTTGGTGGAAC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1106275127 13:28197325-28197347 AGTCACAGAAAACAATTTACAGG 0: 1
1: 0
2: 3
3: 31
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106275126 Original CRISPR GTTCCACCAAACCATATTGA TGG (reversed) Exonic
905237459 1:36560053-36560075 GTTTCTCCAAACCTTTTTGAAGG - Intergenic
908578244 1:65484811-65484833 ATTCTAGTAAACCATATTGAAGG - Intronic
912584326 1:110748607-110748629 TTTCCACCAAAATATAATGAGGG + Intergenic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
1064669435 10:17695489-17695511 GTTCCACCTAATAATATAGATGG + Intronic
1066275288 10:33862790-33862812 GTTCCACCAAGGCAGATTGCGGG - Intergenic
1071091100 10:81919661-81919683 GTTCCCCCAAAAATTATTGAGGG + Intronic
1072255328 10:93615304-93615326 AATCCACAAAACCATATTGGTGG + Intronic
1076123301 10:127953488-127953510 GACCCACCAAACCATAAAGATGG + Intronic
1076657549 10:132035078-132035100 GATCCACCAAGCCATAGAGATGG + Intergenic
1079400007 11:20099121-20099143 CTTCCACCAACCCAAATGGATGG - Intronic
1085170964 11:74449587-74449609 GTTCCAGCAAACCAAAAAGATGG - Intergenic
1088015446 11:105053460-105053482 GTACCATAAAAACATATTGAAGG + Intronic
1092797422 12:12126493-12126515 TTTCTACCAAACCATATCTAAGG + Intronic
1094426716 12:30323761-30323783 GTTTCACCAAGCAATAATGAAGG - Intergenic
1096181356 12:49552416-49552438 GTTCACCCAAAACATATAGAAGG - Intronic
1097397901 12:59098296-59098318 CTTCCCCCACACCATACTGATGG - Intergenic
1097633410 12:62092337-62092359 TTTCCACCAAACCTCCTTGAAGG + Intronic
1105485316 13:20823971-20823993 GTTCCAGTAAAGCTTATTGATGG - Intronic
1106275126 13:28197300-28197322 GTTCCACCAAACCATATTGATGG - Exonic
1107173319 13:37369740-37369762 GTCCCACAAATCCAAATTGAAGG - Intergenic
1109204695 13:59468366-59468388 GTTAAACCAGCCCATATTGAAGG + Intergenic
1109557232 13:63994121-63994143 TTTCCACAAAGCCATATCGATGG + Intergenic
1112265853 13:97922624-97922646 GTTCCACTATATCATTTTGATGG - Intergenic
1120455567 14:84725720-84725742 CTTTATCCAAACCATATTGATGG - Intergenic
1122057297 14:99110683-99110705 GTTCCAGCCAACCAGAGTGAAGG - Intergenic
1125076267 15:35622538-35622560 GTTCCACTAATCCATATAAATGG + Intergenic
1133439119 16:5805869-5805891 GTGCCCTGAAACCATATTGATGG - Intergenic
1135061626 16:19275888-19275910 GATCCACCAAACCATAAAGTTGG - Intergenic
1155161984 18:23203570-23203592 GTTGCACCAAAACATTTTGGAGG + Intronic
1156218557 18:35027750-35027772 GGTCCACAAAACCATAATGTAGG - Intronic
1164946243 19:32295445-32295467 GTTCCACCCATCCACATAGAAGG + Intergenic
928774046 2:34737349-34737371 GTTCCACAAAACCTAATTGTTGG - Intergenic
930006710 2:46903656-46903678 GTTCCACAAATCCCTATGGAAGG - Exonic
930308307 2:49704646-49704668 TTTCAACCTAACCATATTAAAGG - Intergenic
937006964 2:118525689-118525711 GATCCACCAAACCATACTGTTGG + Intergenic
940122664 2:150284398-150284420 ATTCCACCATACCCTATTGAAGG + Intergenic
942113967 2:172709405-172709427 TTTTCAACAAAACATATTGATGG - Intergenic
948287098 2:236794471-236794493 TTTCCAACAAAACATCTTGAAGG - Intergenic
949764445 3:7510805-7510827 GTTCCAATAAACCTTATTTATGG - Intronic
955025074 3:55159804-55159826 GTTCTACCAAAATGTATTGAAGG - Intergenic
957976691 3:87454773-87454795 ATTCTGCCAAACCATAATGATGG + Intergenic
958600171 3:96287521-96287543 GTTTCAGCGAACCATATTCAAGG - Intergenic
959305495 3:104659523-104659545 GTCCCACCCAACCATAGTGGTGG - Intergenic
968443806 4:638104-638126 GTTCCACCAAACGCTGGTGAGGG - Intronic
970617680 4:17782630-17782652 GTTCCACCCATCCATACTGAAGG + Intergenic
970887704 4:21005666-21005688 GTTGTGCCAAACCATATTTATGG - Intronic
971678723 4:29669116-29669138 TCTTCACCAAACCATATTAAAGG - Intergenic
973224090 4:47762970-47762992 GTTCCACCACCCAAGATTGAAGG - Intronic
974773554 4:66448581-66448603 GTTCCAAAAAACCATACTGCTGG - Intergenic
978843160 4:113238957-113238979 GTTTCAGAAAAACATATTGAGGG - Intronic
981667091 4:147241307-147241329 GTTCCATATAACCATAATGATGG - Intergenic
982423018 4:155220385-155220407 ATCCCATCAGACCATATTGAGGG + Intergenic
984495447 4:180491453-180491475 GTGCCTCTAAAGCATATTGATGG - Intergenic
991960722 5:72041316-72041338 ATTCCAACAAAAAATATTGATGG - Intergenic
993234234 5:85282089-85282111 GTTTCACCACATCATATTAAGGG - Intergenic
1000709491 5:164553867-164553889 ATTCCTCCAAACCATCATGATGG - Intergenic
1003828919 6:9984142-9984164 GTTCCACCACAACGTATAGAGGG + Intronic
1011862672 6:91779986-91780008 GTTTCACCCAGACATATTGAAGG + Intergenic
1012557996 6:100539944-100539966 ATTCTACTAAAACATATTGAAGG - Intronic
1013561631 6:111310762-111310784 GTTCTACCAAAGCATTTAGATGG - Intronic
1015740191 6:136445723-136445745 GTTCCAAGAAGCCATATTCATGG + Intronic
1018202476 6:161408565-161408587 TTTCCACTTAACAATATTGAGGG + Intronic
1022669192 7:32440083-32440105 GGTCCACCAAGCCTTATGGATGG + Intergenic
1027332330 7:77110968-77110990 TTTCCACCAAACTAAATGGAAGG + Intergenic
1029783453 7:102760359-102760381 TTTCCACCAAACTAAATGGAAGG - Intronic
1032466008 7:132145536-132145558 GTTCAACCAAACCGTGTTGTTGG - Intronic
1038081411 8:24141007-24141029 GTTCCAGCCAAACATTTTGAGGG + Intergenic
1046686807 8:117236895-117236917 GTTCAACCAAATCATCTTCAGGG - Intergenic
1186000552 X:5004744-5004766 CTTCCACAAACCCATTTTGAGGG - Intergenic
1186572892 X:10734887-10734909 GAATCACCAAAACATATTGAGGG - Intronic
1190454607 X:50615509-50615531 CTTCCACATAACCATATTGAGGG + Intronic
1191184780 X:57598172-57598194 ATTACACCATAACATATTGAAGG + Intergenic
1193994805 X:88352560-88352582 GTTCCAGCAAAGCCAATTGAAGG - Intergenic
1195330929 X:103799538-103799560 GTTTCTCCAAAACATTTTGAGGG + Intergenic