ID: 1106278340

View in Genome Browser
Species Human (GRCh38)
Location 13:28237430-28237452
Sequence CTGGTTCACAGGTTCTCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106278340 Original CRISPR CTGGTTCACAGGTTCTCTAG GGG (reversed) Intronic
901127874 1:6941918-6941940 CTGGTTCTCAGGCTCTTCAGTGG - Intronic
902775074 1:18669439-18669461 CTGGTTCTCAGACACTCTAGGGG - Intronic
907047892 1:51311160-51311182 ATGGGTCACAGTTGCTCTAGGGG + Intronic
911056251 1:93710871-93710893 CTGGTTCAGGGTTTCTCAAGAGG + Intronic
911214495 1:95177605-95177627 CAGGTTCCCAGGTGGTCTAGCGG - Intronic
912373800 1:109193958-109193980 CTGTTTCTCAGGTTCTCTGTAGG - Intronic
914681754 1:149943852-149943874 CTGGTGCACAGGTTCTGAACGGG - Exonic
915603146 1:156935156-156935178 CTGCTTCACTGGTTTTCTACAGG + Exonic
917621273 1:176798872-176798894 CTCCTTCACAGCTTCTCTAGAGG - Intronic
919329722 1:196155837-196155859 CTGGGGCACATGTTCTCTACAGG + Intergenic
920864915 1:209743912-209743934 CTGGATCAAAGACTCTCTAGAGG + Intergenic
1063728494 10:8667971-8667993 CTGGGTCAGGGGTTCTCAAGTGG + Intergenic
1065897046 10:30172634-30172656 CTGGTTCCAGGGTTCTCTGGAGG - Intergenic
1069917611 10:71797093-71797115 CTGGTCCACAGGATCTGTAATGG + Exonic
1070760542 10:79021569-79021591 CTGAATCACAGGTGCTCTAGGGG + Intergenic
1070774734 10:79103114-79103136 CTGTTTTACAGTTTCTCAAGGGG - Intronic
1073441879 10:103556988-103557010 CTGGAGCACAGGCTCCCTAGAGG + Intronic
1074566901 10:114587924-114587946 CCAGCTCACAGGTTCTTTAGGGG + Intronic
1076606881 10:131695049-131695071 CTGGATCACAGGGTGTCCAGTGG + Intergenic
1077808806 11:5616690-5616712 CTAGTTCTCAGGTTCTCATGGGG + Intronic
1079614265 11:22471300-22471322 CTGGTTCTCAGTTTCTTCAGTGG - Intergenic
1084214235 11:67638967-67638989 CTGGCTCCCAAGTCCTCTAGGGG + Intronic
1086246933 11:84764113-84764135 CTGTCTCACAGTATCTCTAGTGG - Intronic
1092910788 12:13143225-13143247 CTGGTTCAAGGGTTCCCTGGGGG - Intergenic
1096811043 12:54170234-54170256 CTGTTTCTCAGTTTCCCTAGCGG + Intronic
1099049512 12:77766412-77766434 TTGGCTCACACTTTCTCTAGTGG + Intergenic
1106278340 13:28237430-28237452 CTGGTTCACAGGTTCTCTAGGGG - Intronic
1108383566 13:49877482-49877504 CTGGTTCAGAAGTTATCTAAAGG + Intergenic
1113567577 13:111328103-111328125 CCGGTTCCCAGGTTCTTTAGCGG + Intronic
1113965416 13:114150350-114150372 CTGCTTAACAGGATCTCTGGCGG - Intergenic
1118058343 14:62106813-62106835 CTGTTTCACAGGTTCCACAGTGG - Exonic
1120008681 14:79388698-79388720 GTGGCTCACAGATACTCTAGAGG + Intronic
1124188373 15:27549914-27549936 CTGGTTCACGGGTGCTCCATGGG + Intergenic
1130133304 15:81161285-81161307 CTGCCTCTCAGGTTCTGTAGTGG - Intronic
1130202567 15:81845759-81845781 GTGGGTCACAGTATCTCTAGAGG + Intergenic
1131997625 15:98147388-98147410 CTGGTTCACAGGCTCAGTGGAGG + Intergenic
1136176683 16:28521958-28521980 CTGGTTCACCAGATCTCGAGAGG - Intergenic
1140762887 16:78127347-78127369 CTGGTTCCCAGATCCTCAAGAGG + Intronic
1142940555 17:3376993-3377015 CTGATTTTCAGGTTCCCTAGTGG + Intergenic
1143473105 17:7188445-7188467 CTGATTCTCAGGTGCTCCAGTGG - Intergenic
1145098574 17:20053785-20053807 CTGGCTCAGAGTTTCTCAAGAGG - Intronic
1148593540 17:48834690-48834712 ATGGTAGACAGGTTCTATAGTGG + Intronic
1148815260 17:50323288-50323310 CTGGTTAAAACGTGCTCTAGAGG - Intergenic
1151770058 17:76154913-76154935 CTGTGTCACAGGTGCTCTACTGG - Intronic
1152962480 18:88098-88120 CTGGGTCCCAGGATCTCTGGGGG + Intergenic
1153296823 18:3554348-3554370 CTGTTTCACAGGTCAGCTAGTGG - Intronic
1155640234 18:28005126-28005148 CTTGTCCACTGGTTTTCTAGCGG + Intronic
1160453932 18:78983258-78983280 CTGGCTCACAGGATTACTAGTGG - Intronic
1161084969 19:2330739-2330761 CTGGATGACAGGTTGTCTGGTGG + Intronic
1161968497 19:7561985-7562007 CGGGCTCACAGGTGCTCTTGGGG + Intergenic
1165377960 19:35456629-35456651 GTGATTCTCAGGTTCTTTAGGGG + Intergenic
1166299167 19:41904462-41904484 CTGGCTCCCTGGCTCTCTAGAGG - Intronic
1166953719 19:46447900-46447922 CTGGTTCCCCGGTTCTCTCGGGG + Intergenic
929520277 2:42643358-42643380 CTGGTTCAGATAATCTCTAGTGG + Intronic
933584078 2:84161148-84161170 CAGGGTCACAGGTCCTCTATGGG + Intergenic
933899527 2:86839685-86839707 CTTGTTCACAAGTTCTCATGGGG - Intronic
935781033 2:106509541-106509563 CTTGTTCACAAGTTCTCATGGGG + Intergenic
938846896 2:135219334-135219356 TTGGCTCACAGTTTCTCCAGAGG - Intronic
940932160 2:159445738-159445760 CTGGCTGACAGCTTCTCTACTGG - Intronic
944678314 2:202052993-202053015 CTGGCCCACAGGTTCCCTTGAGG + Intergenic
945909036 2:215625429-215625451 TTGGTACACAGGTTTTCTAGAGG + Intergenic
1170352794 20:15460356-15460378 CTGGTTCTCAGGTGCTACAGGGG - Intronic
1170479664 20:16753482-16753504 CTGGGTCACAGGTACTCAAGTGG - Intronic
1172659514 20:36558034-36558056 CTGGTTCTGATGTTCCCTAGCGG - Intergenic
1175058065 20:56216260-56216282 CTGGTTCCCAGGATCTCCTGAGG + Intergenic
1182512914 22:30831876-30831898 GTGGTTAACAGGTTCTCCTGTGG - Intronic
949268623 3:2188658-2188680 CTGGTTCACAGGTACCTGAGAGG - Intronic
949957407 3:9280229-9280251 CTGGTTCACAGGCTCTGAATCGG - Intronic
956523970 3:70136520-70136542 CTGGCTCACAGTCTCTCAAGAGG - Intergenic
961301455 3:125924692-125924714 CTGGTTCTCAGCCTATCTAGAGG - Intergenic
961397340 3:126604669-126604691 CTGGTTCAAAGTCTCTCAAGAGG + Intronic
961431366 3:126886233-126886255 CTGATTCACAAGTTCTCTTTTGG + Intronic
961697402 3:128715054-128715076 CAGGTTCTCAGGTTCTCTCAAGG + Intergenic
963204022 3:142614429-142614451 AAGGTTCACATGTTATCTAGAGG + Intronic
963654994 3:148036449-148036471 GTGGTTCACAGGTTTCCTGGTGG + Intergenic
963868744 3:150390666-150390688 ATGATTCACAGGGTCTCAAGGGG + Intergenic
965485896 3:169277964-169277986 CTGGTTCAAAGTTTCTAAAGTGG + Intronic
968377556 4:55599-55621 CTATTTCACAGTTTCTGTAGGGG + Intronic
971118882 4:23681545-23681567 CTGGTTCACAGTGTGTCCAGTGG - Intergenic
975647364 4:76558484-76558506 CTGGTTCCCTGGTTATCTGGAGG + Intronic
975873283 4:78806039-78806061 CATGTTCTCAGGATCTCTAGAGG - Intronic
979862489 4:125711015-125711037 ATGGTTCACAGCTTCCCTGGTGG - Intergenic
982755390 4:159212158-159212180 CTGGTTCACAGGGTCACTCTAGG - Intronic
983767267 4:171499814-171499836 CTGGTTCTCAGGCTCTGGAGAGG - Intergenic
985287801 4:188354698-188354720 CTGGTCCACAGTTTCTAAAGTGG - Intergenic
986176253 5:5354553-5354575 GTGGTTGACAGGTTCACCAGAGG - Intergenic
990906802 5:60812585-60812607 CTGGATCACAGCATCTCTAAAGG + Intronic
992588866 5:78272329-78272351 CAGGTTCTCAGGATCTCTTGAGG + Intronic
992752761 5:79876003-79876025 CTGGAGCACAGGTCCTCTGGGGG - Intergenic
996103080 5:119465053-119465075 CTGGTTCCCTGGTTGTCTAGTGG + Intronic
996282040 5:121741740-121741762 CTGGCTCAGAGTTTCTCGAGAGG + Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1000254865 5:159527830-159527852 TTGGATCACAGGGTCCCTAGTGG + Intergenic
1000373796 5:160560876-160560898 CTGGGTCCCAGGTTCCCTTGGGG + Intergenic
1006510070 6:34516719-34516741 CTGCTTCACAGGTTGGCTCGGGG + Intronic
1006809998 6:36813836-36813858 TTGGTTCACAGGATCTCCAAGGG + Intronic
1007179626 6:39920413-39920435 TTGGTATACAGTTTCTCTAGCGG - Intronic
1007346167 6:41230588-41230610 CTAGGTCACAGGTGCTCTAGGGG + Intronic
1007990372 6:46249089-46249111 CTTGGTCCAAGGTTCTCTAGAGG + Intronic
1009736743 6:67686140-67686162 CTAGTTCAAAGGTTATTTAGAGG + Intergenic
1011765946 6:90619812-90619834 CATGTTCACAGATTCTCTGGAGG - Intergenic
1015477166 6:133666931-133666953 CTGGGTGACAGGTTCAATAGAGG + Intergenic
1021488390 7:21191848-21191870 CTGATAAACAGGTTCTCTGGTGG + Intergenic
1025262119 7:57426433-57426455 CAGGTTCACAGGTTGTTTTGTGG - Intergenic
1026661503 7:72306820-72306842 CTGGTTCTCAGGACCTCTTGAGG + Intronic
1029532627 7:101135528-101135550 GTCATTCCCAGGTTCTCTAGGGG - Exonic
1034355048 7:150444978-150445000 CTGGTTCCCTGGTCCTATAGTGG - Intergenic
1035156245 7:156915664-156915686 ATGCTTCACAGGGTCTCTCGAGG + Intergenic
1038678212 8:29642959-29642981 CTGGTTCTCTGGATCTTTAGAGG - Intergenic
1039024470 8:33242582-33242604 CTGAGTGACAGGTTCACTAGTGG + Intergenic
1041484484 8:58359317-58359339 CAGGTTCACTGGTTCTCTGGGGG - Intergenic
1042324056 8:67509554-67509576 CTCATTCACATGTTCTCTATTGG - Exonic
1042347932 8:67746852-67746874 CTGTTTCAGAGGTTCTCGTGGGG + Intergenic
1044523735 8:93228340-93228362 CTGGATTACATGTTTTCTAGTGG - Intergenic
1046736657 8:117783267-117783289 CTGGATCACAGATTATCTAAGGG - Intergenic
1051658856 9:19408036-19408058 CTGGTTCCCAGGATCCCTAGAGG - Intergenic
1053052477 9:34973120-34973142 CTAGCTCAGAGGTTCTCTACCGG - Intronic
1056984984 9:91354796-91354818 ATGGTTGAGAGGTTCTCTAAAGG - Intronic
1058241607 9:102569271-102569293 CTTTTTCACATGTTCTTTAGTGG - Intergenic
1060051631 9:120382557-120382579 CTGGGTCACTGGCTCACTAGAGG + Intergenic
1062133446 9:134912604-134912626 CTTCTTCACAGGTTTTCCAGCGG - Exonic
1062735660 9:138136019-138136041 CTGGGTCCCAGGATCTCTGGGGG - Intergenic
1203571681 Un_KI270744v1:138648-138670 CTATTTCACAGTTTCTGTAGGGG - Intergenic
1187789621 X:22935535-22935557 CTGTTTCTAAGGTTCTCCAGAGG - Intergenic
1189191725 X:39114829-39114851 CTGGTTTCCAGTTTCTATAGTGG + Intergenic