ID: 1106278766

View in Genome Browser
Species Human (GRCh38)
Location 13:28243117-28243139
Sequence CCTAGCCAGCACAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106278766 Original CRISPR CCTAGCCAGCACAAGATGGC AGG (reversed) Intronic
900266532 1:1759971-1759993 CACAGCAAGCACAGGATGGCGGG + Intronic
901817582 1:11803618-11803640 TCCAGCCAGCACAAGGGGGCGGG + Intronic
904951442 1:34243125-34243147 CCTAGGCAGCATAAAATGACAGG - Intergenic
909741843 1:79038628-79038650 CCTACCCAGCCCAAGTTGGAAGG - Intergenic
910581806 1:88836532-88836554 CCTAGACCTCAAAAGATGGCTGG - Intergenic
911720457 1:101185648-101185670 CCCAGCTAGCACAAGATAACAGG - Intergenic
911830599 1:102545935-102545957 TCAAGCCAGCCCAATATGGCTGG - Intergenic
912799922 1:112714376-112714398 CCAGGCCAGCACGAGTTGGCAGG + Intronic
913192666 1:116426596-116426618 CCTACCCAGCACCAGCTGGGAGG - Intergenic
915046362 1:153020422-153020444 ACCAGCCAGCACATGATGACAGG + Intergenic
924033170 1:239908055-239908077 TATTGCCAGAACAAGATGGCAGG - Exonic
1070011875 10:72483299-72483321 AATAGCCAGAACCAGATGGCTGG + Intronic
1072065486 10:91866095-91866117 ACTAGTCAGCACAAAAGGGCAGG - Intergenic
1074630718 10:115251988-115252010 GCTAGACAGCACATGTTGGCAGG - Intronic
1078804362 11:14682347-14682369 CCTAGCCAGTACAATAAAGCAGG - Intronic
1079983595 11:27177531-27177553 CCTAGCCACAAAAAGGTGGCTGG - Intergenic
1080017813 11:27525948-27525970 CCCAGCAAACACAGGATGGCAGG + Intergenic
1080392963 11:31865329-31865351 CCTAACCAGGAGAAAATGGCAGG + Intronic
1087762928 11:102121515-102121537 ACTGGACAGCACAAGATTGCAGG - Intronic
1091342809 11:134831521-134831543 ACTAGCCAGCACAATATTGAAGG + Intergenic
1091831412 12:3553336-3553358 CCTGGCCAGCAGAGAATGGCAGG - Intronic
1092993876 12:13929652-13929674 CCTAGGCAGCTCATTATGGCAGG - Intronic
1099351664 12:81578056-81578078 CATAGCCAGCACTAAATTGCTGG - Intronic
1102600324 12:114024918-114024940 CCCAGCCAGCAAGAGAAGGCTGG - Intergenic
1104881102 12:132071037-132071059 CCCAGCCAGCACAGTAAGGCAGG - Intronic
1106278766 13:28243117-28243139 CCTAGCCAGCACAAGATGGCAGG - Intronic
1106764302 13:32898467-32898489 CGTAACAAGCACAAGATGCCTGG + Intergenic
1108292655 13:48976426-48976448 CCTAGCCAGGACACGCTTGCGGG + Intronic
1111584058 13:90261604-90261626 CCTAGGCTGCACAGGATAGCAGG + Intergenic
1113683156 13:112259172-112259194 GCTAGAAAGCAAAAGATGGCAGG - Intergenic
1119569532 14:75658119-75658141 CCTGGCCATGACAAGATGGGAGG + Intronic
1121551391 14:94804930-94804952 CTTAGCCAGCGCAATAAGGCAGG + Intergenic
1122410877 14:101525622-101525644 CCTCGCCAGCACAAAAAGGTTGG + Intergenic
1123432173 15:20227433-20227455 CCTAACCAGCACCAGCTGGTTGG - Intergenic
1124234004 15:27971045-27971067 CCCAGCAAGCACAGTATGGCAGG + Intronic
1126773758 15:52082250-52082272 CCTGGGCATCTCAAGATGGCCGG - Intergenic
1132007801 15:98245716-98245738 CCTAGCCAGAACAATCAGGCAGG - Intergenic
1132213557 15:100045714-100045736 CTTAACCAGTAAAAGATGGCGGG + Intronic
1132234263 15:100207225-100207247 CCAAGTGAGCACAAGAGGGCAGG + Intronic
1132547118 16:538440-538462 CTGAGCCACCACAGGATGGCAGG + Intronic
1136852465 16:33623706-33623728 CCTAACCAGCACCAGCTGGTTGG + Intergenic
1142279771 16:89141730-89141752 CCCAGCCAGCACCACAGGGCCGG - Intronic
1203114065 16_KI270728v1_random:1472174-1472196 CCTAACCAGCACCAGCTGGTTGG + Intergenic
1144470784 17:15539193-15539215 CCTAGAGGGCACAAGATTGCTGG - Intronic
1147318376 17:39631903-39631925 CCTACCCAGCCCAAGGTGGGAGG - Intronic
1147854008 17:43464738-43464760 CCTAGGCAACCCAAGATGGTTGG + Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148238269 17:45983514-45983536 CCTCCCCAGCCCAAGATGGGCGG + Exonic
1149492248 17:57093408-57093430 GCTAGCCAGCATCAGATGGCTGG - Intronic
1150854165 17:68734610-68734632 CCTTGCCAGCTCAGGTTGGCTGG + Intergenic
1160395925 18:78572247-78572269 CCTACCCAGCACAGGTAGGCAGG - Intergenic
1165950510 19:39471699-39471721 CCCAGCCAGCACCAGGTGGCGGG - Exonic
926146636 2:10400472-10400494 CCTGGCCAGCACTAGAGGGGAGG - Intronic
927324284 2:21785169-21785191 CCTAGCTAGCCCAAGAGGGAAGG + Intergenic
935569523 2:104644287-104644309 GCTAGGCAGCAAAAGAAGGCAGG + Intergenic
938194689 2:129316676-129316698 CCTTGCCAGCACAATATGGCAGG + Intergenic
946119526 2:217497545-217497567 CCTAGCCATGACAAGATGGGAGG - Intronic
947476473 2:230452941-230452963 CCTAGCCAGAACAATTAGGCAGG - Intronic
948018044 2:234706233-234706255 CCTAGAAATCACAAGATGACTGG - Intergenic
1169941898 20:10946567-10946589 CCAACCCAGCAAAAGATGCCTGG - Intergenic
1172299196 20:33836916-33836938 TCTAGCCAAGACAGGATGGCAGG - Intronic
1172432677 20:34905638-34905660 CCTAGCAAGCAAAAGCTGACAGG + Intronic
1173720438 20:45253359-45253381 CCTAGTCAGCACTGGGTGGCTGG - Intronic
1176075358 20:63245739-63245761 CCTAGCGAGGACTAGCTGGCTGG + Intronic
1177098966 21:16875602-16875624 CCTAGCCAGAACAATTAGGCAGG + Intergenic
1182438937 22:30350205-30350227 CTCAGCCACCACAAGGTGGCTGG - Intronic
1183479566 22:38056164-38056186 CCTTGCCTGCACAATGTGGCTGG + Intergenic
1184685807 22:46095903-46095925 CCCAGCCAGCCCAGGGTGGCAGG + Intronic
951436451 3:22670549-22670571 TGGAGTCAGCACAAGATGGCAGG + Intergenic
962567894 3:136682015-136682037 CCTAGCCAGAACAACTAGGCAGG + Intronic
962710839 3:138084253-138084275 GCTGGCAGGCACAAGATGGCTGG + Exonic
963048868 3:141125335-141125357 GCTCACCAGCACAAGGTGGCAGG + Intronic
965557487 3:170033300-170033322 CCTGGCCATGACAAGATGGGAGG - Intergenic
966145607 3:176808473-176808495 TGTAGCCAGCACAAGAAGACAGG - Intergenic
966962351 3:184953044-184953066 CCCAGCCATGACAGGATGGCAGG - Intronic
969842425 4:9892224-9892246 CCCAGGCAGCACTACATGGCCGG - Intronic
974740757 4:66003957-66003979 CCTAGCCAGAACAATTAGGCAGG - Intergenic
976539946 4:86262809-86262831 GTTAGCCAGCACAAGATGTTAGG - Intronic
979597419 4:122549524-122549546 CCTAGGAAGTACAAGATGGACGG - Intergenic
980854632 4:138424588-138424610 CCAAGACAGCACACCATGGCTGG - Intergenic
985938575 5:3115487-3115509 CCTAGACAGGTCAGGATGGCAGG - Intergenic
986314505 5:6577545-6577567 CCTGGGCAGCCCAAAATGGCAGG - Intergenic
988488036 5:31683038-31683060 ACTAGCAAACACCAGATGGCAGG - Intronic
990320782 5:54628026-54628048 CCCAACCAGGAAAAGATGGCAGG + Intergenic
991049414 5:62256440-62256462 CCTAACCAGCACCAGCTGGTTGG - Intergenic
994872818 5:105375483-105375505 CCTAGCCAGAACAATCAGGCAGG - Intergenic
997679512 5:135739576-135739598 CCAAGCTTTCACAAGATGGCAGG + Intergenic
998233053 5:140373812-140373834 GCAAGCCAGGACAAGATGGAGGG + Intronic
998259162 5:140614942-140614964 CCTAGCCAGAACAAGTAGGCAGG + Intergenic
998818670 5:146038321-146038343 CCTGGCCAGCACAGTAAGGCAGG + Intronic
999597687 5:153223302-153223324 CCTATCCTCCTCAAGATGGCTGG + Intergenic
1000188034 5:158880051-158880073 CCCAGCCAGCACAAGAAAACAGG + Intronic
1001746667 5:174098000-174098022 CCTTCCCAGCAGAAGGTGGCTGG + Intronic
1004240152 6:13913991-13914013 CCTTACAAGCACAAAATGGCTGG - Intergenic
1004785016 6:18958433-18958455 CAGAGCCAGCAAAAGATGGTGGG - Intergenic
1006036002 6:31212627-31212649 CCTAGCCAGCACAATATAGAAGG + Intergenic
1010745180 6:79552580-79552602 CCTGGCCAGGACAGGATGGGAGG - Intergenic
1011256508 6:85427177-85427199 ACTAGGGAGCACAGGATGGCAGG + Intergenic
1017052780 6:150408941-150408963 CCTACCCAGCACTAGAGGGACGG + Intergenic
1018826881 6:167415238-167415260 CCTAGGCAGCAGAGTATGGCTGG - Intergenic
1022870024 7:34467722-34467744 CCTAGCCAGAACAATCAGGCAGG - Intergenic
1024999911 7:55307219-55307241 GCTAGCGAGAACAAGATGGGAGG + Intergenic
1027586373 7:80063536-80063558 CCTGAACAGCTCAAGATGGCAGG + Intergenic
1029896524 7:103989773-103989795 CCGAGCCAGCCCGAGAGGGCGGG - Intergenic
1029968188 7:104762511-104762533 CCTGGCAAGGACAAGATGGTGGG + Intronic
1035871447 8:3140049-3140071 ATTAGCCGGCACATGATGGCAGG - Intronic
1044115111 8:88326694-88326716 CCTAGGCAGCACATGATGCCAGG + Intronic
1047525209 8:125627213-125627235 CCTAACCAGCCCAGGATTGCAGG + Intergenic
1047858601 8:128939472-128939494 CCTCCCCAGCACAAGAAGTCTGG + Intergenic
1049005457 8:139852746-139852768 CCCAGCCAGCCCAAGGTAGCTGG - Intronic
1049824378 8:144658743-144658765 CCTAGCCAGTGCAATAAGGCAGG + Intergenic
1050702051 9:8351651-8351673 AAAAGCCAGCACCAGATGGCAGG - Intronic
1052990775 9:34518360-34518382 CCAAGCCAGCACCAGAGGGATGG - Intronic
1055939238 9:81634167-81634189 ACTAGACAGCGCAAGAAGGCCGG + Exonic
1058399215 9:104594327-104594349 CCTAGTCAGAACAAGAAGCCAGG - Intergenic
1059326551 9:113507337-113507359 TCAAGCCAGGACCAGATGGCGGG + Exonic
1060213587 9:121725052-121725074 CAAAGCCAGCACAAGAAGCCTGG - Intronic
1060406832 9:123376982-123377004 CCAAGCCAGCAGGAGGTGGCTGG + Exonic
1060536404 9:124392487-124392509 CCTTCCCCGCACAAGAGGGCAGG + Intronic
1062188726 9:135234520-135234542 CCTAACCAGTGCAAGAAGGCAGG + Intergenic
1062322646 9:135997992-135998014 CCTTGGGAGCACAAGAAGGCGGG + Intergenic
1195777133 X:108419746-108419768 ACTAAATAGCACAAGATGGCAGG + Intronic
1196503684 X:116414954-116414976 CCTAGCCAGTATAACAAGGCAGG + Intergenic
1198577911 X:138030626-138030648 CCTAGCCAGAACAATCAGGCAGG + Intergenic
1200374803 X:155768207-155768229 CAGAGACAGCACAGGATGGCTGG - Intronic