ID: 1106280256

View in Genome Browser
Species Human (GRCh38)
Location 13:28261155-28261177
Sequence CCCCTTAAACACGGGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106280256_1106280261 8 Left 1106280256 13:28261155-28261177 CCCAGCTACCCGTGTTTAAGGGG 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1106280261 13:28261186-28261208 CTTAAACCCAATCTTAATTATGG 0: 1
1: 0
2: 0
3: 14
4: 120
1106280256_1106280265 28 Left 1106280256 13:28261155-28261177 CCCAGCTACCCGTGTTTAAGGGG 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1106280265 13:28261206-28261228 TGGCATGTCTAAGTCTGTCTGGG 0: 1
1: 0
2: 2
3: 19
4: 173
1106280256_1106280264 27 Left 1106280256 13:28261155-28261177 CCCAGCTACCCGTGTTTAAGGGG 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1106280264 13:28261205-28261227 ATGGCATGTCTAAGTCTGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106280256 Original CRISPR CCCCTTAAACACGGGTAGCT GGG (reversed) Intronic
902816573 1:18919690-18919712 CCCCTTAAACACCACCAGCTCGG + Exonic
905477018 1:38236122-38236144 CCCCTGAACCACAGGTAGGTGGG + Intergenic
908844918 1:68315290-68315312 CTCCTTAAACACAGTAAGCTGGG - Intergenic
921791601 1:219296568-219296590 CACCCTGAAGACGGGTAGCTGGG + Intergenic
1077364143 11:2154772-2154794 CCCGTTACACATGGGTGGCTCGG - Intronic
1090778587 11:129986500-129986522 CCTCAGAAACACGAGTAGCTGGG + Intronic
1095907682 12:47394520-47394542 CCCCTTAAAAACGTGTTTCTCGG + Intergenic
1097388996 12:58985958-58985980 CACCTAAAAGACTGGTAGCTTGG - Intergenic
1104974050 12:132544128-132544150 CCACTTAAACCCGGGTGCCTGGG - Intronic
1106280256 13:28261155-28261177 CCCCTTAAACACGGGTAGCTGGG - Intronic
1124605678 15:31168878-31168900 CCCCTTAAAAACGTGTAAATTGG + Intergenic
1132478141 16:152813-152835 CCCCTTATATACAGGGAGCTGGG - Exonic
1132480089 16:163025-163047 CCCCTTATATACAGGGAGCTGGG - Intronic
1135555896 16:23436431-23436453 CCCTTTAAAAACTGTTAGCTAGG + Intronic
1136618091 16:31410745-31410767 CCCCTTCCACAGGGCTAGCTCGG - Exonic
1139850561 16:69949671-69949693 CTCCATAAACACAGGTGGCTTGG + Intergenic
1139879545 16:70172583-70172605 CTCCATAAACACAGGTGGCTCGG + Intergenic
1140372979 16:74422965-74422987 CTCCATAAACACAGGTGGCTCGG - Intergenic
1143183473 17:4997844-4997866 CCCCTTTAACAAGAGTAGCCCGG + Intergenic
1161536723 19:4823946-4823968 CCCAGTAGACACAGGTAGCTGGG - Intronic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
935751147 2:106234997-106235019 CCCCTGATACCCGAGTAGCTGGG - Intergenic
947396261 2:229689643-229689665 CCCTTTAATCACGGGGTGCTGGG + Intronic
1172027849 20:31961379-31961401 CCCCTAAATCACGGGCAGCTAGG - Intergenic
1172805159 20:37606747-37606769 CCCCTTAAAAGCGGGTAATTTGG - Intergenic
953372991 3:42406035-42406057 CCCCTTAATCACAGGTACTTGGG + Intronic
961094796 3:124145030-124145052 CCCCTCAAACACTGGTCCCTAGG - Intronic
967709007 3:192684251-192684273 CCCCGTTAACACAGGCAGCTTGG - Intronic
968730681 4:2267931-2267953 CCCCTTGGACACAGGGAGCTTGG + Intergenic
972712249 4:41609102-41609124 CCCCTGAAACAGGAGTAGCCTGG - Intronic
976947820 4:90792115-90792137 CACCTTAAACACTGGTATCAGGG - Intronic
994557723 5:101325253-101325275 CTCCTTAAAAATGGGTGGCTTGG - Intergenic
1012201036 6:96406254-96406276 CCTCTTAAATACATGTAGCTTGG - Intergenic
1030609165 7:111669931-111669953 CCCCTCAGGCACAGGTAGCTTGG - Intergenic
1043127376 8:76416569-76416591 CCCCTTTAACATGGGTAGAAAGG - Intergenic
1045651184 8:104342826-104342848 CCCCTTAAACTCGGGCACCCCGG - Intronic
1048049389 8:130803036-130803058 CCCAGTAAACACAAGTAGCTTGG - Intronic
1048057494 8:130881984-130882006 CCCCTTAGACAAGGGTAGTGAGG - Intronic
1191661465 X:63656025-63656047 CCACATAAACACGGCTAGCAAGG + Intronic
1196062484 X:111425986-111426008 TTCCTAAAACACGGGTAGTTTGG - Intergenic