ID: 1106283069

View in Genome Browser
Species Human (GRCh38)
Location 13:28294633-28294655
Sequence CCTTGCACAGGGAAGTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106283069 Original CRISPR CCTTGCACAGGGAAGTTTGC TGG (reversed) Intronic
902137918 1:14326674-14326696 CCAAGCACAGGGAAGGATGCAGG - Intergenic
903538437 1:24082548-24082570 CCCAGCCCAGGGAGGTTTGCAGG + Intronic
911660609 1:100497594-100497616 CCTCGCCTAGGGTAGTTTGCAGG + Intronic
913616779 1:120568121-120568143 CCTTGCAAAGGGAGGTCTGGAGG - Intergenic
914213308 1:145601956-145601978 CCTTGCCCAGGGAAAATTGTAGG + Intergenic
914465250 1:147922401-147922423 CCTTGCCCAGGGAAAATTGGAGG + Intergenic
914573496 1:148942789-148942811 CCTTGCAAAGGGAGGTCTGGAGG + Intronic
915855083 1:159374659-159374681 CCATGCTCAGGGAAGGGTGCAGG + Intergenic
921047470 1:211487742-211487764 CCTTGCACAGTGGCGTGTGCGGG + Intronic
924565678 1:245196248-245196270 CATTGCAAAGGGAAGTTCACAGG - Intronic
924947169 1:248854339-248854361 CTTTGTACAGGGAACATTGCAGG - Intronic
1066322815 10:34322126-34322148 CCTTGGACTGGCAAGTCTGCAGG - Intronic
1067766553 10:49091590-49091612 CCCTCCCCAGGGAAGTTGGCAGG - Intronic
1071506226 10:86233508-86233530 CCTGGGTGAGGGAAGTTTGCTGG - Intronic
1073026408 10:100490079-100490101 TATGGCACAGGGAAGCTTGCAGG + Exonic
1073639590 10:105237703-105237725 CCTTTTACAGGTCAGTTTGCTGG - Intronic
1075777416 10:124997654-124997676 CCCTGCCCAGGGAAATTTACTGG + Intronic
1080857336 11:36123658-36123680 TCTTTCACAGTGAAGTTTGGAGG + Intronic
1084459175 11:69286764-69286786 CCTTTCCCTGGGGAGTTTGCTGG + Intergenic
1085033366 11:73286044-73286066 CCCTGCAATGGGAAGTATGCAGG + Intronic
1086067163 11:82757642-82757664 CCTGTCACAGGGAAGCTTCCTGG - Intergenic
1089498743 11:118920844-118920866 CCTTTGATAGGGAAGTTTCCTGG - Intronic
1093181538 12:15972498-15972520 CCTTGCCCAGGAAGTTTTGCGGG + Intronic
1096476714 12:51913249-51913271 ACTTGCACAGGGAGCTCTGCAGG + Exonic
1096648513 12:53050608-53050630 CCTGGCCCAGGGAAGTTTGAGGG + Intronic
1098690046 12:73475536-73475558 GCATGCACATGGCAGTTTGCAGG - Intergenic
1099075147 12:78097215-78097237 ACTTGAAAAGGGAAGTGTGCTGG - Intronic
1102793367 12:115667190-115667212 CCTTGCACAAGGCAGTCTGGGGG - Intergenic
1106283069 13:28294633-28294655 CCTTGCACAGGGAAGTTTGCTGG - Intronic
1106972646 13:35161572-35161594 CCTTGCACAGGAAACTTTTTGGG - Intronic
1110428039 13:75391547-75391569 CCTAGCACAGTGAAGTGTCCTGG - Intronic
1111987346 13:95078512-95078534 CTTTGCACTGGGAAGGTGGCAGG + Intronic
1115941709 14:38617665-38617687 CCATGCACAGGCATGTTTCCAGG + Intergenic
1115993047 14:39169529-39169551 GTTTGCAAAGGAAAGTTTGCAGG - Intronic
1116775464 14:49175405-49175427 GTTTCCACTGGGAAGTTTGCTGG - Intergenic
1117285674 14:54283589-54283611 CCTTGCAAAGGGAAAATTACAGG - Intergenic
1131728325 15:95251621-95251643 CTTTGCACAGAGACCTTTGCTGG - Intergenic
1135134520 16:19877737-19877759 CCTGGCACAGGGAAGACAGCAGG + Intronic
1138520972 16:57570658-57570680 GCTTAGACAGGGGAGTTTGCAGG + Intronic
1138528097 16:57620373-57620395 CCTAGCACCGGGAAGCTGGCAGG + Intronic
1139656446 16:68389879-68389901 CCTTGCACAGGAAAGAGTTCAGG + Intronic
1140064000 16:71594457-71594479 CTTTGTACAAGGAACTTTGCAGG - Intergenic
1140626496 16:76801032-76801054 CTTTGCCCAGGTAAGTTTGTGGG + Intergenic
1145256238 17:21323978-21324000 CCTTGCGCAGGCAGCTTTGCTGG + Intergenic
1149429928 17:56589507-56589529 CCTTGCCCAGAGAATTTTGCAGG + Intergenic
1150410902 17:64939893-64939915 ACTTGCACAGCGTAGTTTTCAGG + Intergenic
1150657135 17:67046641-67046663 CCCTGCCCAGGGGAGTTGGCTGG - Intronic
1152526381 17:80890387-80890409 TCTTGCACAGGGAAGGCAGCGGG + Intronic
1155680349 18:28479337-28479359 CCTTGCTCAAGTAAGTTTACTGG + Intergenic
1156931266 18:42646853-42646875 CTTTGCACAGGTAAGTTAGAAGG - Intergenic
1157562338 18:48657140-48657162 CATTCCACAGAGAATTTTGCAGG - Intronic
1158227414 18:55215404-55215426 ACTTGCCCAGGGAACTTTCCAGG - Intergenic
1160440140 18:78883517-78883539 ACTGTCACAGGGCAGTTTGCAGG - Intergenic
1164737423 19:30552114-30552136 CCTTGCAAAGGGAAGCTAGTGGG - Intronic
1166140140 19:40800964-40800986 CCTGGCCCAGGGCCGTTTGCTGG - Exonic
1166315599 19:41987906-41987928 CCTTGCACAGGGCAGGGTCCAGG + Intronic
925479534 2:4254646-4254668 CATTGCACAGGCAAATGTGCAGG - Intergenic
928789238 2:34931583-34931605 CCTTGCTCAAGTAAGTTTACTGG - Intergenic
928964992 2:36966852-36966874 CCTCGCACGCGGAAGTTCGCGGG + Intergenic
929865366 2:45712829-45712851 CCAAGGACAGGGAAGTGTGCTGG - Intronic
931907605 2:66859249-66859271 CATTGGGCAGGGAAGTTTGTGGG - Intergenic
933551669 2:83785346-83785368 TCTTTCACAGGGAAGTTTCTAGG + Intergenic
934077324 2:88439270-88439292 CCTTGATCAGGGAAGTGTGGGGG - Intergenic
935113950 2:100118294-100118316 CCATTCACAGGATAGTTTGCAGG - Intronic
935201611 2:100861500-100861522 CCTTGGACAGGGAAGATGGAAGG + Intronic
935561747 2:104567119-104567141 CCTTTGACAGAGAAGTCTGCGGG + Intergenic
935935888 2:108182599-108182621 CCTTTCATAGGGAAGTTTTCTGG + Intergenic
936155812 2:110046891-110046913 CCCTGCACATGGAAGTGAGCAGG + Intergenic
936188876 2:110324537-110324559 CCCTGCACATGGAAGTGAGCAGG - Intergenic
936349760 2:111703779-111703801 CCTGGCACAGGGAAGGTGCCGGG - Intergenic
936433452 2:112483064-112483086 CCTAGCCCAGGGAAGTGTGGAGG + Intronic
937220033 2:120337399-120337421 CCTGGCACAGTGGAGCTTGCAGG - Intergenic
939175920 2:138747262-138747284 CCTTGCCCAGTGAACCTTGCTGG + Intronic
939574504 2:143879950-143879972 TCCTGCACGGGGAAGTTTGGAGG + Intergenic
942117384 2:172741426-172741448 CCTTGCACTGGGCCCTTTGCTGG + Intronic
943002498 2:182345927-182345949 CCTTGCAGAGGTAACATTGCAGG - Intronic
944820799 2:203428845-203428867 CCTAGCACAGGGCAGTTACCTGG - Exonic
946346342 2:219113987-219114009 CCTTAGACAGGGAAGTTTCTAGG + Intronic
946857749 2:223969605-223969627 TCCTGCTCAGGGGAGTTTGCAGG + Intergenic
947631439 2:231656004-231656026 CATTTCCGAGGGAAGTTTGCAGG - Intergenic
948951573 2:241255734-241255756 CCTTGAACAGTGAAGTTTCTGGG - Intronic
1169140087 20:3222886-3222908 TCTTGCACAGAGCAGTCTGCAGG + Intronic
1170148935 20:13207513-13207535 GCTTGCACATGGCAGATTGCAGG - Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1175765614 20:61590615-61590637 CCTGGCAGAGGGAAGGTTCCAGG - Intronic
1176236354 20:64055544-64055566 CCTGGGGCAGGGAAGTCTGCTGG + Intronic
1177538692 21:22463586-22463608 CCATGGACAGGGAATTTTGGGGG + Intergenic
1178695440 21:34789064-34789086 ATTTGCCCAGGAAAGTTTGCTGG + Exonic
1178973226 21:37199547-37199569 CCCTGCCCATGGATGTTTGCCGG + Intronic
1180974856 22:19842711-19842733 CCTTGCCCAGGGAGGGTTTCTGG - Intronic
1181090846 22:20471501-20471523 CTTTGCAGAGGAATGTTTGCTGG - Exonic
1183779642 22:39990548-39990570 CATTGCACAGAGTATTTTGCTGG + Intergenic
950887095 3:16372112-16372134 ACTTGCACAGGAAAGCTTGCAGG - Intronic
951168921 3:19516131-19516153 CCTTGCATTAGGTAGTTTGCTGG - Intronic
951708427 3:25566768-25566790 CCATCCACAGGGAAGTCTGCAGG - Intronic
953193241 3:40709188-40709210 CCCTTCACAGGGAAGCTTCCTGG + Intergenic
953417026 3:42728392-42728414 CCTTGCACAGGGGAGGGTGGGGG - Intronic
957037728 3:75310673-75310695 TGTTGCACAGGAAATTTTGCAGG + Intergenic
957530978 3:81440609-81440631 CTTTGCATATGGAAGTATGCTGG - Intergenic
960737983 3:120801391-120801413 CCCTGGACAGGGAAGTTGGGTGG + Intergenic
961085762 3:124066225-124066247 TGTTGCACAGGAAATTTTGCAGG + Intergenic
961662215 3:128475465-128475487 CCTTGCACAGGGACACTTCCAGG - Intergenic
962731636 3:138289168-138289190 TCTTGCACAGGGAAGCTAGCAGG + Intronic
964341100 3:155709232-155709254 ACTTGCACATGGATGTTTGCAGG - Intronic
964366549 3:155956658-155956680 CCTAGGGCAGGGAAGTTTGAGGG - Intergenic
968794924 4:2697005-2697027 CTTGGCACAGGGAAGTCTTCTGG + Intronic
970900204 4:21150151-21150173 CTTTTCACAGGGCAGTGTGCAGG + Intronic
970983817 4:22131847-22131869 CCTTGAACAGGTAAGTTTTGAGG + Intergenic
972493287 4:39608831-39608853 CCTAGAGCTGGGAAGTTTGCAGG + Intronic
974676049 4:65090551-65090573 CCTTGCTCAGGAAAGCTTTCAGG - Intergenic
974906910 4:68069156-68069178 CCTTGAAGAGGGAACATTGCTGG + Intronic
976285724 4:83369445-83369467 CCATGCAAAGGGAATTGTGCTGG - Intergenic
978648980 4:110977100-110977122 CCTTACATAGAGAATTTTGCTGG + Intergenic
980949773 4:139363342-139363364 CCTTTCACAGGGATAATTGCTGG - Intronic
984067121 4:175062366-175062388 CCTTGGACAGGCAGGTCTGCAGG - Intergenic
988693140 5:33592801-33592823 CCTTGCACAGGAAATTTTTTGGG + Intronic
991149281 5:63347475-63347497 CCTTGAACAGAGCAGCTTGCAGG + Intergenic
992565308 5:77990280-77990302 CCTTGCACAGGGAACCTGCCAGG + Intergenic
996310979 5:122104973-122104995 GCTTGCAGAGGAAAGATTGCAGG - Intergenic
996853558 5:127979433-127979455 CTTTGCACACCGAAATTTGCAGG - Intergenic
997265727 5:132494268-132494290 CCTTGCACAGTGCAGGGTGCTGG - Intergenic
1002404111 5:179015684-179015706 CCTCTCCCAGGGAAGTTTTCTGG - Intergenic
1002452593 5:179327443-179327465 GCATGCACAGGGTTGTTTGCAGG - Intronic
1002630967 5:180578087-180578109 CCTTCCAAAGGGAAGAGTGCAGG + Exonic
1004150391 6:13114034-13114056 CCATGCACAGGGCAGATTTCTGG + Intronic
1007245290 6:40457325-40457347 CATTCCACAAGGAAGTTTGGGGG + Intronic
1010116851 6:72322915-72322937 CTATGCACAGGGAAGTTTCCAGG + Intronic
1013431512 6:110060628-110060650 CCTTGACCAGAGAAGTTTTCTGG - Intergenic
1014592370 6:123289987-123290009 TCTTGCTCAGGTAAGTTTACTGG + Intronic
1017975458 6:159353145-159353167 CCTAGTACAGGGAAGTGTGGTGG - Intergenic
1018003977 6:159603248-159603270 TCTTTCACTGGGAAGTTTCCAGG - Intergenic
1018567316 6:165168443-165168465 GCCTCCACTGGGAAGTTTGCTGG - Intergenic
1021497016 7:21286585-21286607 CCTAGGACTGGGAAGTTTGTGGG + Intergenic
1026302017 7:69106351-69106373 CCTTGCACAGGAAAGAATTCGGG + Intergenic
1028810588 7:95081892-95081914 CATGGCACTGGGAAGTTTGTTGG - Intronic
1034291770 7:149938062-149938084 TCTTGCCCAGGGAAGATAGCTGG - Intergenic
1036710049 8:11072480-11072502 CATTGCACAAGGAAATGTGCAGG + Intronic
1038643734 8:29347616-29347638 CCTTGCAGATGGAGGTGTGCAGG - Intronic
1043130937 8:76460349-76460371 GCTTTCAGAGGGAAGTATGCAGG - Intergenic
1043859180 8:85296159-85296181 CCTTGGGAAGGGAAGGTTGCAGG - Intergenic
1046933031 8:119859914-119859936 CCTTGAATAGGGAGGTTTGGTGG - Intergenic
1048258009 8:132920394-132920416 CTTTGCTCAGGGCAGTTTCCTGG + Intronic
1048648967 8:136453523-136453545 CCATGTACCGGGAAGTTTCCAGG - Intergenic
1049312228 8:141939241-141939263 ACTTGCACAGGGGAGCTTCCCGG + Intergenic
1049805601 8:144537379-144537401 ACCCCCACAGGGAAGTTTGCAGG - Intronic
1054716337 9:68560679-68560701 CCTTGCTGAGGGAAGTTTGGGGG + Intergenic
1058903576 9:109462484-109462506 CCTTGCACACTGAACTTTACAGG + Intronic
1061377448 9:130234810-130234832 CCTTGCACAGGGAAGGCTTGAGG + Exonic
1062184410 9:135209942-135209964 CCTATCACAGGGACGTGTGCAGG - Intergenic
1062387247 9:136317726-136317748 CATTGCACAGCGAACTCTGCTGG - Intergenic
1187410183 X:19044442-19044464 CATAGCAAAGGGAACTTTGCAGG - Intronic
1192474619 X:71429461-71429483 CCTTGGATAGGGAAGTGTGCTGG + Intronic
1198992440 X:142530386-142530408 CCTTGGCCAGGGAAGTTTCTTGG - Intergenic
1199216497 X:145265473-145265495 CCTTGCTGAAGTAAGTTTGCTGG - Intergenic
1201518459 Y:14844534-14844556 CCTTGGACAGGAAAATTTGATGG + Intronic