ID: 1106283847

View in Genome Browser
Species Human (GRCh38)
Location 13:28302052-28302074
Sequence GGTTTGGTTGGTATAGAGAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 2, 1: 0, 2: 2, 3: 20, 4: 341}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106283839_1106283847 11 Left 1106283839 13:28302018-28302040 CCTGTGTTTTGGGTCCCAACTGT 0: 1
1: 1
2: 0
3: 8
4: 132
Right 1106283847 13:28302052-28302074 GGTTTGGTTGGTATAGAGACGGG 0: 2
1: 0
2: 2
3: 20
4: 341
1106283843_1106283847 -4 Left 1106283843 13:28302033-28302055 CCAACTGTGTTGGTGAATTGGTT 0: 2
1: 0
2: 0
3: 24
4: 172
Right 1106283847 13:28302052-28302074 GGTTTGGTTGGTATAGAGACGGG 0: 2
1: 0
2: 2
3: 20
4: 341
1106283842_1106283847 -3 Left 1106283842 13:28302032-28302054 CCCAACTGTGTTGGTGAATTGGT 0: 2
1: 0
2: 0
3: 10
4: 113
Right 1106283847 13:28302052-28302074 GGTTTGGTTGGTATAGAGACGGG 0: 2
1: 0
2: 2
3: 20
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106283847 Original CRISPR GGTTTGGTTGGTATAGAGAC GGG Exonic
901517653 1:9760072-9760094 TGGTTGGTTGTTTTAGAGACAGG + Intronic
901606695 1:10464707-10464729 GGTTTGGTTTGGTTTGAGACAGG - Intronic
903347634 1:22697533-22697555 TGTTTGTTTGTTTTAGAGACGGG + Intergenic
903388683 1:22947788-22947810 GTTTTGGTTTTTGTAGAGACGGG + Intergenic
903990838 1:27268268-27268290 ATTTTTGATGGTATAGAGACAGG - Intronic
904133529 1:28293197-28293219 GGTTTGTTTGTTTTTGAGACAGG + Intergenic
906073286 1:43033322-43033344 GTTTTTGTTGTTTTAGAGACAGG - Intergenic
907066417 1:51488596-51488618 GATCTGGTTGGTTTTGAGACAGG + Intronic
907537559 1:55178852-55178874 GTTTTGTTTTGTAGAGAGACAGG - Intronic
909912986 1:81283426-81283448 GTTTTGTTTTGTTTAGAGACAGG + Intergenic
910754224 1:90669559-90669581 GTTTTGGTTTGTTTTGAGACAGG - Intergenic
910870618 1:91829760-91829782 GTTTTGTTTTGTTTAGAGACAGG + Intronic
911336951 1:96592954-96592976 GATTTGATTGTTAAAGAGACTGG - Intergenic
912406796 1:109445792-109445814 TGTATTGTTTGTATAGAGACAGG - Intergenic
913153848 1:116074735-116074757 TGTTTGGTTTGTTTTGAGACAGG + Intergenic
913462305 1:119100664-119100686 GGTTTTGTTTGTTTTGAGACAGG + Intronic
913569161 1:120102940-120102962 TGATTGATTGTTATAGAGACAGG - Intergenic
913573503 1:120144872-120144894 GGTTTGGCTGGAATAGAAAGAGG + Intergenic
914289971 1:146263931-146263953 TGATTGATTGTTATAGAGACAGG - Intergenic
914294762 1:146309673-146309695 GGTTTGGCTGGAATAGAAAGAGG + Intergenic
914551014 1:148714714-148714736 TGATTGATTGTTATAGAGACAGG - Intergenic
914555803 1:148760456-148760478 GGTTTGGCTGGAATAGAAAGAGG + Intergenic
914870347 1:151468446-151468468 GTTTTGTTTTGTTTAGAGACAGG - Intergenic
914892259 1:151636474-151636496 GGTATATTTCGTATAGAGACGGG + Intronic
915252313 1:154599455-154599477 GGATTGTTTGGGGTAGAGACTGG - Intronic
915546475 1:156601579-156601601 GGTATGGTTGCCATAGAAACTGG + Intergenic
916805398 1:168255127-168255149 GGTTTGTTTTGTCTAGAGACAGG - Intergenic
917112618 1:171565452-171565474 GGTTTGTTTGTTTTTGAGACAGG + Intronic
917388937 1:174511264-174511286 TGTTTGGTTGGTAAAGAAACAGG - Intronic
917834229 1:178928156-178928178 TGTTTTGTTTTTATAGAGACAGG + Intergenic
919899948 1:202036740-202036762 GTTTTGTTTTGTTTAGAGACAGG - Intergenic
920234770 1:204495181-204495203 GGTTAGGTTGGGGTAGAGAGAGG + Intergenic
921083068 1:211759267-211759289 GTTTTGGTTTTTTTAGAGACGGG + Intronic
921155235 1:212433531-212433553 GGTTAGGTGGGAATTGAGACAGG + Intronic
921571247 1:216781538-216781560 GGTATGTTTGGTATAGCGATTGG - Intronic
922468866 1:225863057-225863079 GTTTTGTTTTGTTTAGAGACAGG + Intronic
922879451 1:228969617-228969639 GTTTTATTTTGTATAGAGACGGG - Intergenic
922922355 1:229317083-229317105 GTTTTTGTTGTTGTAGAGACAGG + Intergenic
923254605 1:232210844-232210866 GGTTTGTTTGTTTTTGAGACAGG - Intergenic
923880470 1:238098776-238098798 TGTTTGTTTGTTTTAGAGACAGG + Intergenic
924228646 1:241944572-241944594 TGTTTGTTTGTTTTAGAGACAGG - Intergenic
924936356 1:248775044-248775066 GGTTTGTTTGTTTTTGAGACAGG + Intergenic
924937165 1:248781844-248781866 TGTTTGTTTAGTATAGAGATGGG - Intergenic
1063839158 10:10050114-10050136 TGTTTGTTTGTTTTAGAGACAGG - Intergenic
1064531902 10:16318947-16318969 TGATTGATTGTTATAGAGACAGG - Intergenic
1065355014 10:24832196-24832218 GTTTTTGTTGGGGTAGAGACGGG - Intergenic
1065929220 10:30464371-30464393 TGTTTGTTTGTTTTAGAGACAGG - Intergenic
1066748249 10:38624672-38624694 GTTTTGTTTTGTTTAGAGACAGG - Intergenic
1068454970 10:57242975-57242997 TGTTTGTTTGTTTTAGAGACAGG + Intergenic
1068772482 10:60837441-60837463 TGTTTGTTTGTTGTAGAGACGGG - Intergenic
1069087608 10:64159557-64159579 GGTTTGGTTTGTAGATAGTCAGG + Intergenic
1069246863 10:66217806-66217828 GCTGTGGTAGGGATAGAGACAGG + Intronic
1069616865 10:69811778-69811800 GGGTTGGTGGGTGTAGAGATTGG - Intronic
1070583982 10:77747327-77747349 AGTTTGTTTGTTTTAGAGACAGG + Intergenic
1070633263 10:78103733-78103755 GTTTTGTTTTGTTTAGAGACAGG - Intergenic
1071222953 10:83491382-83491404 GGTTTGGTTTGGTTTGAGACAGG + Intergenic
1071552203 10:86575224-86575246 TGTTTTGTTTTTATAGAGACTGG + Intergenic
1071581037 10:86770400-86770422 GTTTTGTTTGGTTTTGAGACAGG - Intronic
1072258586 10:93645106-93645128 AGTTTGGTGGTTATAGAAACTGG + Intronic
1072343095 10:94474957-94474979 TTTTTGGTTTGTTTAGAGACAGG + Intronic
1072501108 10:96018801-96018823 TGTTTGTTTGTTATTGAGACAGG + Intronic
1072708741 10:97701695-97701717 GGTTTGTTTGTTTTTGAGACAGG + Intergenic
1073258686 10:102172429-102172451 TGTTTGTTTGTTTTAGAGACAGG + Intergenic
1073304801 10:102494627-102494649 TGGTTGGTTGGTTTTGAGACAGG - Intronic
1073367953 10:102959580-102959602 TGTTTGTTTGCTTTAGAGACAGG + Intronic
1074096605 10:110318771-110318793 GGTTTCTTTGATATAGAGTCAGG - Intergenic
1074589423 10:114798733-114798755 TGTTTGTTTTTTATAGAGACAGG - Intergenic
1075857916 10:125646318-125646340 TGTTTTGTTGGTCTTGAGACAGG - Intronic
1076870680 10:133191783-133191805 GGTTTGGTTGGTGCAGAGCAGGG - Intronic
1077114501 11:877273-877295 GCTTTGGTTGTTTTGGAGACAGG + Intronic
1078465400 11:11546384-11546406 GGTGTGGTTGGCACAGAGAGCGG - Intronic
1079319540 11:19440453-19440475 GGTATGGTTGGAATAGAGGGTGG + Intronic
1080057955 11:27926948-27926970 GGTTTGGAATGTATAGAGCCAGG - Intergenic
1080250509 11:30228370-30228392 GGGGTGGTTGGTATAGATAATGG - Intergenic
1085527799 11:77174183-77174205 GGTTTGGTTGGTGGAGGGGCTGG - Intronic
1086333141 11:85773888-85773910 GGTTTAGTTGGTTTAAAGAGAGG - Intronic
1086386943 11:86318920-86318942 TGTTTGTTTGTTTTAGAGACAGG + Intronic
1088521811 11:110710041-110710063 GGATTGGTTGGTGCAGAGAGAGG + Intronic
1088554469 11:111047926-111047948 GGTTTGGATGTTATGGAGTCAGG + Intergenic
1089537575 11:119169818-119169840 GCTTTGGTTTTTGTAGAGACGGG - Intronic
1089641942 11:119853512-119853534 TGTTTGTTTGTTTTAGAGACAGG + Intergenic
1092659998 12:10727996-10728018 TGTTTGTTTGTTGTAGAGACGGG - Intergenic
1093204177 12:16226995-16227017 GTTTTGGTTGATAGAGAAACTGG + Intronic
1093424868 12:19017304-19017326 TGTTTGTTTGTTTTAGAGACAGG + Intergenic
1094570362 12:31636256-31636278 TGTTTGTTTGTTTTAGAGACAGG - Intergenic
1095760718 12:45832480-45832502 GTTTTGTTTGTTTTAGAGACAGG + Intronic
1096265540 12:50119687-50119709 GGTTTGTTTTGTTTTGAGACAGG - Intronic
1098525953 12:71487418-71487440 GTTTTGTTTTGTTTAGAGACAGG + Intronic
1098597610 12:72292928-72292950 GGTTTGGGTGGTACAGAGCAGGG + Intronic
1100181686 12:92093075-92093097 GGTTTGCTTGTTTTTGAGACAGG + Intronic
1100962416 12:99977319-99977341 GTTTTGTTTTTTATAGAGACAGG + Intronic
1101123353 12:101606473-101606495 TTTTTTTTTGGTATAGAGACAGG + Intronic
1102394147 12:112573906-112573928 GGTGTGGTGGGTAGGGAGACGGG + Intronic
1102694161 12:114785233-114785255 GGTTTTGTTTTTATAGAGATGGG + Intergenic
1103327571 12:120131617-120131639 TGTTTGTTTGTTTTAGAGACAGG + Intronic
1104229047 12:126865787-126865809 TGTTTGTTTGGTTTTGAGACAGG - Intergenic
1106283847 13:28302052-28302074 GGTTTGGTTGGTATAGAGACGGG + Exonic
1106558776 13:30831753-30831775 TGTTTTGTTTGTTTAGAGACAGG - Intergenic
1109741199 13:66558147-66558169 TGTTTGTTTGTTTTAGAGACAGG - Intronic
1110004140 13:70245061-70245083 TGTTTGGTTGGTTTTTAGACAGG + Intergenic
1110106577 13:71684512-71684534 GGATTGGTTGGCATAGAAAAGGG - Intronic
1111584732 13:90269651-90269673 TGTTTGTTTTTTATAGAGACAGG - Intergenic
1113750465 13:112773380-112773402 GGTTTGGTCGATACAGAGAGAGG - Intronic
1114297918 14:21346706-21346728 TGTTTGTTTGTTTTAGAGACAGG + Intronic
1114392012 14:22319823-22319845 TGTTTGTTTGTTTTAGAGACAGG + Intergenic
1114503064 14:23186092-23186114 GGTTTGGTTTTTTTAAAGACAGG - Intronic
1115256673 14:31409684-31409706 GGTTTTGTTTGTTTTGAGACAGG - Intronic
1115266211 14:31503195-31503217 GGTTTGTTTTGTTTAGAGATAGG - Intronic
1115394328 14:32891105-32891127 TGTTTGTTTGTTATTGAGACAGG + Intergenic
1116911189 14:50466203-50466225 TGTTTGTTTGTTATAGAGACAGG - Intronic
1117543050 14:56767411-56767433 GGTTTGTTTTGTTTTGAGACAGG - Intergenic
1117713824 14:58560179-58560201 GGTTTGGTGGGTATGGAGTGGGG - Intergenic
1117778794 14:59210134-59210156 TGTTTGTTTGTTTTAGAGACAGG - Intronic
1118205849 14:63722792-63722814 TGTTTGTTTGTTATAGAGACGGG - Intronic
1118358096 14:65031913-65031935 GTTTTGGTTTTTATTGAGACAGG - Intronic
1120077987 14:80182061-80182083 TGTTTGTTTTTTATAGAGACAGG - Intergenic
1120995486 14:90415332-90415354 TGTTTGTTTGTTTTAGAGACAGG + Intergenic
1121260387 14:92561689-92561711 GTTTTGTTTGGTTTTGAGACAGG + Intronic
1121688304 14:95856138-95856160 TGTTTGTTTGTTGTAGAGACAGG - Intergenic
1121765528 14:96482224-96482246 TGTTTTGTTTTTATAGAGACAGG - Intronic
1122616075 14:103018947-103018969 GGTTTGTTTGTTTTTGAGACAGG + Intronic
1124545080 15:30619173-30619195 GTTTTGTTTGGTTTTGAGACAGG + Intergenic
1124778603 15:32608572-32608594 GTTTTGTTTGGTTTTGAGACAGG + Intergenic
1127374407 15:58369836-58369858 GGTTTGGTTGATAGAGACACAGG + Intronic
1127956453 15:63857973-63857995 GATTTGTTTTGTTTAGAGACAGG + Intergenic
1128178349 15:65577416-65577438 GGTTTGGTTTGGTTTGAGACAGG - Exonic
1128270153 15:66302189-66302211 GGTTTTTTTTGTATTGAGACAGG - Intronic
1128557543 15:68641896-68641918 TGTGTTTTTGGTATAGAGACAGG + Intronic
1128561363 15:68670178-68670200 GGTTTGTTTTGTTTTGAGACAGG + Intronic
1128822640 15:70673865-70673887 TGGTTGGTTGGTTTTGAGACAGG + Intronic
1128844732 15:70881221-70881243 TGTTTGCTTGTTTTAGAGACAGG - Intronic
1129450922 15:75650850-75650872 TGTTTGTTTGTTTTAGAGACAGG - Intronic
1130089779 15:80810966-80810988 GGGTAGGTTGGTAAATAGACAGG - Intronic
1133164945 16:3939721-3939743 TGTTTTGTTTTTATAGAGACAGG + Intergenic
1133752411 16:8735255-8735277 GGTTTGGTTTTTTTTGAGACAGG + Intronic
1134403265 16:13932036-13932058 GGTGTGGTTGGTAGGAAGACAGG + Intronic
1135061363 16:19273924-19273946 TGTTTTGTTTTTATAGAGACAGG + Intergenic
1136102715 16:28007516-28007538 TGGTTGGTTGGTTTTGAGACAGG + Intronic
1138424275 16:56920225-56920247 TGTTTGTTTGTTTTAGAGACAGG - Intergenic
1139428573 16:66898750-66898772 TGTTTGTTTGTTTTAGAGACAGG - Intergenic
1139495559 16:67314587-67314609 TGTTTGTTTGTTATAGAGATGGG + Intronic
1140058219 16:71544397-71544419 GTTTTGTTTTGTATTGAGACAGG - Intronic
1141931576 16:87208125-87208147 GTTTTGGTTGTCATAGTGACTGG - Intronic
1142137531 16:88458528-88458550 CGTCTGGTTGGCATAGAAACAGG - Intronic
1145203879 17:20970166-20970188 TGGTTGGTTGGTAAAGATACTGG + Intergenic
1146652957 17:34618241-34618263 TGTTTGTTTGTTTTAGAGACAGG + Intronic
1147279072 17:39342874-39342896 TGTTTGTTTGGTTTTGAGACAGG - Intronic
1147777451 17:42912577-42912599 GGTTGGCTTGGGATAGAGAAAGG - Exonic
1148239217 17:45988877-45988899 TGTTTGTTTGTTTTAGAGACAGG - Intronic
1148353416 17:46957701-46957723 GATTTGTTTGGTAGAGAGAAGGG + Intronic
1149572743 17:57685221-57685243 CGTTTGTTTGGTAGAGAGAGGGG - Intergenic
1150696505 17:67410382-67410404 GGTTTGTTTGTTTTTGAGACAGG + Intronic
1153561373 18:6375187-6375209 AGTTTGGAAGGTATAAAGACTGG - Intronic
1153758675 18:8309517-8309539 GTTTTTGTTTTTATAGAGACAGG + Intronic
1153903784 18:9642321-9642343 GTTTTGGTTTTTTTAGAGACAGG - Intergenic
1153913791 18:9727320-9727342 GCTTTGTTTTGTTTAGAGACAGG + Intronic
1155132948 18:22956338-22956360 GTTTTGTTTTGTTTAGAGACAGG + Intronic
1155344785 18:24847538-24847560 TGTTTGTTTGTTGTAGAGACAGG - Intergenic
1156014905 18:32536553-32536575 GGTTTGGTTTGTTTTGAGACAGG - Intergenic
1156629907 18:38954590-38954612 GATTTGGTTGGTATAGAAGAAGG + Intergenic
1157023787 18:43818354-43818376 GGTTTGATTGGAAAAGAGACAGG - Intergenic
1157082630 18:44542994-44543016 GGTCTGGAGGCTATAGAGACGGG - Intergenic
1157241647 18:46015396-46015418 GGTTAGGTTGGTAGACAGTCTGG + Intronic
1158978808 18:62738347-62738369 GGTTTTGTTGTTTTTGAGACAGG - Intronic
1162117606 19:8440708-8440730 TGTTTGTTTGCTTTAGAGACAGG - Intronic
1163147919 19:15394547-15394569 TGTTTGGTTTTTTTAGAGACAGG + Intronic
1163276196 19:16285901-16285923 GCTTTTGTTTGTTTAGAGACAGG - Intergenic
1163461492 19:17440690-17440712 GGTTTTGTTTGTTTAGAGACAGG - Intronic
1163510462 19:17732307-17732329 GCATTTGTTGGTATACAGACGGG + Intronic
1163783881 19:19264575-19264597 GGGTTGGGTGTTTTAGAGACAGG - Exonic
1164758670 19:30710368-30710390 TGTTTGTTTGTTTTAGAGACAGG - Intronic
1165793549 19:38506141-38506163 GGATGGGGTGGTTTAGAGACAGG + Intronic
1165875047 19:39000613-39000635 GTTTTTGCTGTTATAGAGACGGG - Intronic
1166188333 19:41157686-41157708 TGTTTGGTTTTTTTAGAGACAGG - Intergenic
1166380443 19:42352740-42352762 TATGTGGTTGCTATAGAGACAGG + Intronic
1166573455 19:43814485-43814507 TGTTTGTTTGTTTTAGAGACAGG - Intronic
926837234 2:17036594-17036616 GGTTTTGTTGCTATAGTAACTGG + Intergenic
927664136 2:25018020-25018042 TGTTTGGTTTGTTTTGAGACAGG - Intergenic
928693953 2:33829830-33829852 GGATTAGTTTGTATAAAGACAGG + Intergenic
929007891 2:37413433-37413455 AGTGTGGATGGGATAGAGACCGG + Intergenic
930417114 2:51103090-51103112 TGTTTGTTTGTTTTAGAGACAGG - Intergenic
930679043 2:54235827-54235849 TGGTTGGTTGGTTTTGAGACAGG - Intronic
931593339 2:63910912-63910934 TGTTTGTTTGTTTTAGAGACCGG + Intronic
932026531 2:68139229-68139251 GGTCTGGTTGTTAAAGAGTCTGG + Intronic
932243618 2:70177862-70177884 GGTTTGTTTTTTGTAGAGACAGG - Intronic
934919062 2:98327285-98327307 TGTTTGTTTGTTTTAGAGACAGG - Intergenic
935053890 2:99548735-99548757 GGTTTGGTTGGTTTTGAGACCGG - Intronic
935244537 2:101206765-101206787 GGTATTTTTAGTATAGAGACAGG - Intronic
937030444 2:118734879-118734901 GTTTTGGTTTTTTTAGAGACAGG + Intergenic
938824426 2:134991020-134991042 GTTTTGTTTTGTTTAGAGACAGG - Intronic
939238160 2:139524189-139524211 GATTTGGCTGGTTTAGAAACAGG + Intergenic
939696804 2:145335922-145335944 TGTTTGCTTGCTTTAGAGACTGG + Intergenic
940027705 2:149225893-149225915 GTTTTGGTTGGTGTAGAGAAGGG + Intergenic
941071677 2:160961586-160961608 GTTTTGTTTTGTTTAGAGACAGG - Intergenic
941206613 2:162580903-162580925 GGTCTGGGTGATATAGAGAAAGG + Intronic
942573104 2:177333337-177333359 GTTTTGGTTTGAGTAGAGACTGG + Intronic
943828835 2:192431943-192431965 GGTTTGGTTTTTTTTGAGACAGG + Intergenic
946636483 2:221733917-221733939 GGTTTGGTTTGGTTTGAGACAGG + Intergenic
946682917 2:222236263-222236285 TGTTTGTTTGTTTTAGAGACAGG + Intronic
947480212 2:230492312-230492334 GGTTTGGTTTGGCTAGAGACAGG + Intronic
947904761 2:233752737-233752759 TGTTTGTTTGTTTTAGAGACAGG - Intronic
1169254947 20:4090108-4090130 TGTTTGTTTGCTTTAGAGACAGG + Intergenic
1170465844 20:16621803-16621825 TGTTTGTTTTTTATAGAGACAGG - Intergenic
1170688509 20:18590181-18590203 GGTTTGTTTGTTTTAGAGATGGG + Intronic
1170835409 20:19879823-19879845 GGTTTGTATGCTATAGAGAGAGG + Intergenic
1172532266 20:35640600-35640622 GGTTTTGTTGGATTAGAGTCAGG - Intronic
1174170503 20:48615181-48615203 GGTTTGGCTGGTACAGAGGTGGG - Intergenic
1174647859 20:52101577-52101599 AGTTTTGTTTTTATAGAGACAGG + Intronic
1174726772 20:52871073-52871095 TGTTGGGTTGGTTTAGAGAAGGG + Intergenic
1175970969 20:62686734-62686756 GGTTTGGACGGTGCAGAGACAGG + Intergenic
1176920327 21:14680105-14680127 GCTTTGGTTGGGCTTGAGACAGG - Intergenic
1178325224 21:31640206-31640228 AGATTGGTAGGTAAAGAGACTGG + Intergenic
1178497637 21:33100950-33100972 GTTGTTGTTGTTATAGAGACAGG - Intergenic
1178852005 21:36220514-36220536 TGTTTGTTTGGTTTTGAGACAGG + Intronic
1179119049 21:38525795-38525817 GGTGTGGTTGGTAGAAGGACTGG - Intronic
1179222804 21:39424473-39424495 GGTTTGTTTGTTTTTGAGACAGG - Intronic
1179542571 21:42093216-42093238 TGTTTGTTTTTTATAGAGACAGG + Intronic
1180985568 22:19902175-19902197 GTTTTGTTTGTTTTAGAGACAGG - Intronic
1181489501 22:23252737-23252759 GGTTGGGTTGCTATAGAAAGGGG - Intronic
1181564332 22:23725364-23725386 TGTTTGCTTGTTTTAGAGACAGG + Intergenic
952516493 3:34109659-34109681 TGTTTGTTTTGTTTAGAGACAGG - Intergenic
953814227 3:46141198-46141220 GGTTTGGTTGGTATAGAGACAGG + Intergenic
955145959 3:56319797-56319819 GGTTTGTTTTTTATAGAGATGGG - Intronic
955769975 3:62376850-62376872 GTTTGGGTTGGGAAAGAGACTGG - Intergenic
956182778 3:66533054-66533076 GTTTTTGTTTTTATAGAGACAGG + Intergenic
957429124 3:80078608-80078630 GGTTTTGATGGTATGGAGAAGGG + Intergenic
960467622 3:118016732-118016754 TGTTTGGTTGTTTGAGAGACAGG - Intergenic
961871149 3:129989059-129989081 GCTTTTGTTTTTATAGAGACAGG + Intergenic
962627382 3:137239416-137239438 GTTTTGTTTTGTTTAGAGACAGG + Intergenic
962704792 3:138032618-138032640 GTTTTGCTTTGTTTAGAGACGGG + Exonic
963198724 3:142564948-142564970 GGTTTGGTTTTGGTAGAGACAGG + Intronic
965429449 3:168568459-168568481 TGGTTGGTTGGTTTTGAGACAGG + Intergenic
965663752 3:171069548-171069570 GGTTTGGGTGGTAGAGAAAGAGG + Intronic
967823554 3:193860611-193860633 GTTTTGGTGAGTATAGAGAAAGG + Intergenic
967905765 3:194498446-194498468 TGTTTTGTTGTTTTAGAGACAGG - Intergenic
969601422 4:8178772-8178794 TGTTTGTTTGTTTTAGAGACAGG + Intergenic
969927111 4:10595074-10595096 GGTTTGGTTTTTTTTGAGACGGG - Intronic
970495781 4:16624266-16624288 GTTTTGGTTTTTATAGAGGCAGG + Intronic
972353165 4:38256148-38256170 GTTTTGTTTTTTATAGAGACAGG - Intergenic
973537690 4:51900554-51900576 TATTTGTTTTGTATAGAGACAGG - Intronic
973622875 4:52744819-52744841 GTTTTGGCAGCTATAGAGACAGG + Exonic
973955184 4:56056576-56056598 GGTTTTTTTTTTATAGAGACAGG - Intergenic
974039477 4:56845445-56845467 TGTTTTGTTTGTTTAGAGACAGG - Intergenic
974412822 4:61564278-61564300 GGTTTGTTTGTTTTTGAGACAGG + Intronic
975770068 4:77711115-77711137 GGTGTGGGTGGTATAAAGTCTGG - Intergenic
976311145 4:83614813-83614835 GGGTTGGTTGGTTTGGTGACTGG + Intergenic
978459038 4:108929818-108929840 TGTTTTGTTGTTTTAGAGACAGG - Intronic
978748116 4:112218066-112218088 TGTTTTGTTTGTTTAGAGACAGG + Intergenic
979230845 4:118347692-118347714 GTTTTGCTTGTTTTAGAGACAGG + Intronic
981030960 4:140125627-140125649 TGTTTGTTTTGTAGAGAGACAGG + Intronic
981557539 4:146011506-146011528 TGTTTGTTTGTTTTAGAGACAGG + Intergenic
981584987 4:146290852-146290874 GTTTGGTTTGGTTTAGAGACAGG - Intronic
981733699 4:147926514-147926536 GGTTTGGGAGGGATAGAGACTGG + Intronic
982378926 4:154726757-154726779 TGTTTGTTTGTTTTAGAGACAGG - Intronic
982755597 4:159215176-159215198 TGTTTGGTTTTTAAAGAGACAGG + Intronic
983554209 4:169045562-169045584 GGTTTGGTTTTTTTAGAGACAGG - Intergenic
983616379 4:169710040-169710062 TGTTTGTTTGTTTTAGAGACAGG - Intronic
984655849 4:182317486-182317508 GGTTTGGTTTTTGTAGAGAGAGG + Intronic
985715466 5:1457111-1457133 GGGTTGGCTGGGAAAGAGACAGG - Intronic
985809401 5:2071930-2071952 AATCTGGTTGGTAAAGAGACTGG + Intergenic
986685375 5:10271504-10271526 TGATTGGTTGTTTTAGAGACAGG - Intergenic
986719193 5:10548145-10548167 TGTTTGTTTGTTTTAGAGACTGG - Intergenic
988365195 5:30289414-30289436 GTTTTGGGTGCTAGAGAGACTGG - Intergenic
989126400 5:38056378-38056400 TGTTTGTTTGGAATAGAGACAGG + Intergenic
989232032 5:39097855-39097877 TGTTTTGTTTGTTTAGAGACGGG + Intergenic
989502419 5:42183724-42183746 GGTTTGGTTTGGATTCAGACAGG - Intergenic
991439337 5:66630111-66630133 GATTTGGTTGGTCTAGACAGTGG - Intronic
991528898 5:67593945-67593967 TGTATTGTTAGTATAGAGACGGG - Intergenic
992781160 5:80129302-80129324 TGTTTGATTGTTTTAGAGACAGG + Intronic
992963505 5:81978666-81978688 TGTTTGTTTGTTTTAGAGACAGG + Intronic
995878712 5:116819974-116819996 GGTTTGGTTTTTTTTGAGACAGG - Intergenic
997216404 5:132114745-132114767 GGTTTGGGTGGACTAGAGAGTGG - Intergenic
997438583 5:133892657-133892679 GATCTGGCTGGTATAGAGAAAGG + Intergenic
999499878 5:152136213-152136235 GGTTTGGCTTGGTTAGAGACTGG - Intergenic
999838573 5:155400619-155400641 GGCTTGGTAGGTTTAGAGATCGG - Intergenic
1001498231 5:172205814-172205836 GGTTTGGTTTTAATAGAGACAGG - Intergenic
1002839917 6:896634-896656 GGTGTTGTGGGTATAGATACGGG + Intergenic
1003866962 6:10372085-10372107 GTTTTGTTTTGTTTAGAGACAGG - Intergenic
1004564151 6:16779907-16779929 TGTTTGTTTGTTTTAGAGACAGG + Intergenic
1004654990 6:17651125-17651147 TGTTTAGTTTTTATAGAGACGGG - Intronic
1004999903 6:21230165-21230187 GGTTTGTTTGTTTTTGAGACAGG + Intronic
1005346181 6:24893023-24893045 GTTTTGGTTTTTTTAGAGACAGG - Intronic
1006724706 6:36189446-36189468 GGTTTGGTAGGTCTAGAGTGGGG + Intergenic
1007010082 6:38408344-38408366 GTTTTGTTTTGTTTAGAGACAGG - Intronic
1008290605 6:49711137-49711159 TGTTTGTTTGTTTTAGAGACAGG - Intronic
1008851490 6:56027785-56027807 GGTTTGGGTAGTATAGTCACTGG - Intergenic
1009711441 6:67326856-67326878 GGTCTGGTTGTTAAAGAGCCTGG + Intergenic
1011462334 6:87617727-87617749 TGTTTGTTTTTTATAGAGACAGG - Intronic
1011843697 6:91534453-91534475 GTTTTGCATGGTATGGAGACTGG + Intergenic
1017829249 6:158110378-158110400 TGTTTTGTTTGTTTAGAGACAGG - Exonic
1018910425 6:168098343-168098365 GGTTGGGATGGAAGAGAGACAGG + Intergenic
1019131194 6:169877238-169877260 TGTTTGGTTGGTTCTGAGACAGG - Intergenic
1019992371 7:4701305-4701327 CGTTTGTTGGGTACAGAGACTGG + Intronic
1020129923 7:5553977-5553999 TGTTTGGTTTTTTTAGAGACAGG - Intronic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1020228378 7:6298036-6298058 TGTTTGTTTGGTATTGAGACAGG - Intergenic
1020388795 7:7636130-7636152 GGTTTTGTTTTTGTAGAGACAGG - Intergenic
1021465128 7:20934075-20934097 GGTTTGGTTTTTGTAGAGACAGG + Intergenic
1021784507 7:24138618-24138640 GGATTGTTTGATATAGAGGCAGG + Intergenic
1022012760 7:26323242-26323264 GTTTTGTTTGGTTTTGAGACAGG - Intronic
1022211629 7:28215887-28215909 GGTTTTGTTGTTTTTGAGACAGG - Intergenic
1023928749 7:44691350-44691372 GTTTTGTTTTGTGTAGAGACAGG - Intronic
1025729170 7:64094928-64094950 TGTTTGCTTGTTTTAGAGACAGG - Intronic
1026333151 7:69370763-69370785 GTTTTGTTTTGTTTAGAGACAGG - Intergenic
1026573988 7:71556735-71556757 GTTTTGTTTTGTTTAGAGACAGG + Intronic
1027274300 7:76542620-76542642 GGTTTGGTTTTTTTAGAGATGGG - Intergenic
1027327743 7:77061589-77061611 GGTTTGGTTTTTTTAGAGATGGG - Intergenic
1030269314 7:107653232-107653254 TGTTTGTTTGTTTTAGAGACAGG - Intergenic
1030283427 7:107800321-107800343 TGTTTGTTTGTTTTAGAGACAGG - Intronic
1030975508 7:116117279-116117301 TGTATGGATGGTATAGACACTGG - Intronic
1031222554 7:118988634-118988656 GGTTTTATTTCTATAGAGACAGG - Intergenic
1031975529 7:128091232-128091254 GGTTTGGTTTCTTTTGAGACCGG + Intronic
1032133381 7:129250265-129250287 GGTTTGTTTGTTTTTGAGACAGG - Intronic
1033071115 7:138203117-138203139 TGTTTGTTTGGTTTTGAGACAGG - Intergenic
1038462009 8:27725142-27725164 TGTTTGTTTGTTTTAGAGACAGG - Intergenic
1039059561 8:33562916-33562938 GTTTTGTTTTGTTTAGAGACGGG - Intronic
1039481471 8:37876590-37876612 TGTTTGTTTGTTTTAGAGACAGG - Intronic
1039649997 8:39331023-39331045 GCTATTGTTGTTATAGAGACTGG + Intergenic
1040004562 8:42608525-42608547 GGTTTTGTTTGTTTAGACACAGG - Intergenic
1041486025 8:58377086-58377108 TGTTTGGTTTTTATTGAGACAGG - Intergenic
1042178693 8:66062819-66062841 GTTTTGTTTTGTTTAGAGACAGG - Intronic
1042420193 8:68579467-68579489 GGTTTAGTTGGCCAAGAGACAGG - Intronic
1042607218 8:70557579-70557601 GATGTGGTTGTTATAGAGACTGG + Intergenic
1045038956 8:98202528-98202550 GATCTGGTTGTTAAAGAGACTGG + Intronic
1045529413 8:102970351-102970373 GGTTTGTTTGTTTTTGAGACAGG + Intronic
1050397159 9:5211067-5211089 GATCTGGTTGGAATGGAGACGGG + Intergenic
1050399397 9:5235208-5235230 GATCTGGTTGGAATGGAGACAGG + Exonic
1051224162 9:14881287-14881309 GGTGTGGCTGGTCTAGAGACAGG - Intronic
1051281507 9:15446220-15446242 GGTTTGTTTGTTTTTGAGACAGG + Intronic
1052325410 9:27212464-27212486 GGTTTGGTAGGAATGGAGAGGGG + Intronic
1053089637 9:35262925-35262947 GGTTTGGTTTTTTTTGAGACAGG - Intronic
1053612770 9:39731987-39732009 GGCTTGGTGGATAAAGAGACTGG + Intergenic
1053870811 9:42489949-42489971 GGCTTGGTGGATAAAGAGACTGG + Intergenic
1054085484 9:60739168-60739190 GGCTTGGTGGATAAAGAGACTGG - Intergenic
1054240746 9:62610403-62610425 GGCTTGGTGGATAAAGAGACTGG - Intergenic
1054554880 9:66644927-66644949 GGCTTGGTGGATAAAGAGACTGG - Intergenic
1056166558 9:83946737-83946759 GGTGTGGTGGTTGTAGAGACAGG - Intronic
1057159323 9:92875584-92875606 GGATTGATTGGTAGAGAGCCAGG - Intronic
1057424966 9:94940888-94940910 GTTCTGGTTGGTCAAGAGACAGG - Intronic
1058018665 9:100067118-100067140 TGTTTGGTTTTTTTAGAGACAGG - Intronic
1058661923 9:107274374-107274396 TGTTTGTTTGTTTTAGAGACAGG + Intergenic
1058759112 9:108112769-108112791 GGTTTGGTTTTTATAGAGACGGG + Intergenic
1059950032 9:119452825-119452847 GGTTTGGCTGGGACAGAGAAAGG + Intergenic
1061522100 9:131124808-131124830 GTTTTGTTTTTTATAGAGACGGG + Intergenic
1061644161 9:131986352-131986374 GGTTTGTTTGTTATAGAGGCAGG + Intronic
1061708726 9:132472765-132472787 TGTTTGTTTGTTTTAGAGACAGG - Intronic
1062620749 9:137420818-137420840 TGTTTGTTTTGTTTAGAGACAGG + Intronic
1185496990 X:562554-562576 CGATTGGTAGGTAGAGAGACAGG - Intergenic
1185496996 X:562662-562684 TGATTGGTAGGTAGAGAGACAGG - Intergenic
1185945962 X:4376371-4376393 TGTTTGGTTATTTTAGAGACAGG - Intergenic
1186038194 X:5447404-5447426 TGTTTGTTTGTTTTAGAGACAGG + Intergenic
1186045405 X:5531302-5531324 TGTTTGTTTGTTTTAGAGACAGG - Intergenic
1186122517 X:6379283-6379305 TGTTTGTTTGTTTTAGAGACAGG - Intergenic
1188113028 X:26214242-26214264 GGTTTGGATGGAAAAGTGACCGG + Intergenic
1188134666 X:26480775-26480797 GGTTTGGTTGGTTTTAAGACAGG - Intergenic
1188188058 X:27140458-27140480 GATTTTGTTGTTGTAGAGACAGG + Intergenic
1188398489 X:29715877-29715899 GGGTTGCTTGGTAAAGAAACTGG - Intronic
1189845964 X:45138816-45138838 TCTTTGTTTGCTATAGAGACAGG - Intergenic
1190334211 X:49252728-49252750 GGTTGGGTTGGCATAAAGGCTGG + Intronic
1190843740 X:54171221-54171243 TGTTTGTTTGTTTTAGAGACAGG - Intronic
1193120833 X:77821473-77821495 TGTTTGTTTGTTTTAGAGACAGG + Intergenic
1194199934 X:90941898-90941920 GATGTGGTTGTTAAAGAGACTGG + Intergenic
1195495634 X:105529736-105529758 GGTTTCCATGGAATAGAGACAGG - Intronic
1197807122 X:130408167-130408189 TGTTTGTTTGTTTTAGAGACAGG + Intronic
1201501334 Y:14646186-14646208 GGTTCTGTTTGTATGGAGACTGG - Intronic