ID: 1106283899

View in Genome Browser
Species Human (GRCh38)
Location 13:28302537-28302559
Sequence CTGGGCCCTCAAATGTAGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 2, 1: 0, 2: 1, 3: 7, 4: 138}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106283889_1106283899 16 Left 1106283889 13:28302498-28302520 CCAGAAAATGTCCCCTCATCGCT 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1106283899 13:28302537-28302559 CTGGGCCCTCAAATGTAGAAGGG 0: 2
1: 0
2: 1
3: 7
4: 138
1106283896_1106283899 -9 Left 1106283896 13:28302523-28302545 CCATCTGCTCCTGGCTGGGCCCT 0: 1
1: 1
2: 10
3: 75
4: 580
Right 1106283899 13:28302537-28302559 CTGGGCCCTCAAATGTAGAAGGG 0: 2
1: 0
2: 1
3: 7
4: 138
1106283892_1106283899 3 Left 1106283892 13:28302511-28302533 CCTCATCGCTGTCCATCTGCTCC 0: 1
1: 0
2: 0
3: 17
4: 226
Right 1106283899 13:28302537-28302559 CTGGGCCCTCAAATGTAGAAGGG 0: 2
1: 0
2: 1
3: 7
4: 138
1106283890_1106283899 5 Left 1106283890 13:28302509-28302531 CCCCTCATCGCTGTCCATCTGCT 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1106283899 13:28302537-28302559 CTGGGCCCTCAAATGTAGAAGGG 0: 2
1: 0
2: 1
3: 7
4: 138
1106283886_1106283899 27 Left 1106283886 13:28302487-28302509 CCTCCCAGAATCCAGAAAATGTC 0: 2
1: 0
2: 2
3: 24
4: 371
Right 1106283899 13:28302537-28302559 CTGGGCCCTCAAATGTAGAAGGG 0: 2
1: 0
2: 1
3: 7
4: 138
1106283891_1106283899 4 Left 1106283891 13:28302510-28302532 CCCTCATCGCTGTCCATCTGCTC 0: 1
1: 0
2: 0
3: 12
4: 181
Right 1106283899 13:28302537-28302559 CTGGGCCCTCAAATGTAGAAGGG 0: 2
1: 0
2: 1
3: 7
4: 138
1106283888_1106283899 23 Left 1106283888 13:28302491-28302513 CCAGAATCCAGAAAATGTCCCCT 0: 2
1: 0
2: 2
3: 18
4: 196
Right 1106283899 13:28302537-28302559 CTGGGCCCTCAAATGTAGAAGGG 0: 2
1: 0
2: 1
3: 7
4: 138
1106283887_1106283899 24 Left 1106283887 13:28302490-28302512 CCCAGAATCCAGAAAATGTCCCC 0: 2
1: 0
2: 1
3: 35
4: 229
Right 1106283899 13:28302537-28302559 CTGGGCCCTCAAATGTAGAAGGG 0: 2
1: 0
2: 1
3: 7
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106283899 Original CRISPR CTGGGCCCTCAAATGTAGAA GGG Exonic
901036273 1:6338169-6338191 CTGGGCCCTCACAAGCAGGAAGG + Intronic
905593821 1:39188429-39188451 CTGGGCCCTAAAATGCTGATTGG + Intronic
906436406 1:45800560-45800582 CTGGGTGCTCAACTGGAGAAGGG + Intronic
908348019 1:63255616-63255638 ATGGGCCCTCATTTATAGAAAGG + Intergenic
908897897 1:68921702-68921724 CTCAGCTCTCAAATGTGGAAAGG + Intergenic
909921649 1:81388638-81388660 CTGTGCCCTCTCATGTTGAAAGG - Intronic
913042065 1:115036734-115036756 CTGGGCCCTCTAGGGAAGAAGGG - Intergenic
914350859 1:146839003-146839025 CTGGGACCTCAAAAGATGAAAGG - Intergenic
916274629 1:162980357-162980379 CTGTTCCCTCATATGTAAAATGG - Intergenic
919588892 1:199474349-199474371 CAGAGTCCTGAAATGTAGAAGGG - Intergenic
921426562 1:215008673-215008695 CTAGGACCTCAAAGTTAGAAAGG - Intronic
922321279 1:224489852-224489874 CTGGGTCCTCACGTGTTGAAAGG + Intronic
922565250 1:226597412-226597434 CTGTGGCCTCACATGTAGATGGG - Intronic
923765866 1:236891888-236891910 CTGGGCCCCCCAATATAGAGAGG + Intronic
923889117 1:238191669-238191691 CTGTGTCCTCACATGTAGAAGGG - Intergenic
1063387771 10:5626885-5626907 CTGGGCCCTGAAAGATGGAAAGG + Intergenic
1067158557 10:43803145-43803167 CTGTGCCCTCACATGGAGCAAGG + Intergenic
1068106860 10:52628850-52628872 CTGGGTCCTCACATGATGAAAGG - Intergenic
1071175778 10:82925074-82925096 CAGGGCCCTCATCTGTAAAATGG - Intronic
1072541568 10:96402300-96402322 CTAGTACCACAAATGTAGAAAGG - Intronic
1072845180 10:98821797-98821819 CTGGGCACTCTAAATTAGAAAGG + Intronic
1076913177 10:133402461-133402483 CTGGTCCGTCAAATGGGGAAAGG - Intronic
1079195584 11:18323526-18323548 CTGGGTCTTCAAATGGACAAAGG - Intronic
1081429124 11:42956555-42956577 CTGAGCTCTCAAATGAACAAAGG + Intergenic
1087566598 11:99867657-99867679 AAGGGCCCTCAAAAGTAGAAGGG - Intronic
1088119496 11:106351429-106351451 CTGTGTCCTCAGAGGTAGAAAGG + Intergenic
1089019267 11:115195543-115195565 CTGGGCCTAGAAATGTTGAAAGG - Intronic
1091194193 11:133717938-133717960 CTGTGTCCTCAGAGGTAGAAGGG + Intergenic
1094091596 12:26655972-26655994 CTGGGTCCTCATCTGTAAAATGG + Intronic
1095364803 12:41390098-41390120 CACGGCCCTCAACTGTAAAAAGG - Intronic
1102326874 12:111993270-111993292 GTGGACCCCCAAAAGTAGAAGGG + Intronic
1103120424 12:118375763-118375785 CTGAGCTCTCAACTGAAGAAGGG - Intergenic
1103329960 12:120147330-120147352 CTGGGCCCCCAGAACTAGAATGG + Intronic
1103953258 12:124563470-124563492 CTGTGCCCTCATCTGTAAAATGG + Intronic
1104327734 12:127816005-127816027 CTGTGCCCTCACATGGAGGAAGG - Intergenic
1106283899 13:28302537-28302559 CTGGGCCCTCAAATGTAGAAGGG + Exonic
1106617890 13:31347224-31347246 CTGGGCCCTGAAAGCTTGAAGGG + Intergenic
1106690068 13:32105277-32105299 CTGTGTCCTCACATGGAGAAAGG - Intronic
1107655673 13:42590120-42590142 CTGGGGCTGGAAATGTAGAAAGG - Intronic
1108398270 13:50011529-50011551 CTGGGCCCACAAATATGAAATGG - Intronic
1110281584 13:73699821-73699843 CTGAGCCCATAAATGTAGAGTGG + Intronic
1111238533 13:85442367-85442389 TGGGGCCCTTAATTGTAGAATGG - Intergenic
1112041111 13:95549072-95549094 CTTAGACCTCAAAAGTAGAAAGG + Intronic
1114888757 14:26889023-26889045 CTGGGTCCTCATATGGTGAAAGG + Intergenic
1118708591 14:68501897-68501919 CTTAGCCTTCAAAGGTAGAAAGG + Intronic
1120062384 14:79999466-79999488 CTGAGTCTTCAAATGGAGAAGGG + Intergenic
1120608054 14:86604350-86604372 CTGAGCCCTCAAAGCTAAAATGG + Intergenic
1120672823 14:87384032-87384054 CTGGGTTTTCAAATATAGAAAGG - Intergenic
1122200509 14:100119766-100119788 CTGTGCCCTCATCTGTAAAATGG - Intronic
1124598402 15:31110710-31110732 CTGTGCCCTCCAATGGAGGATGG - Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1126591060 15:50340131-50340153 CTGTGCCCTCATATGGTGAAGGG - Intronic
1135223132 16:20631212-20631234 ATGGGGCCTCACATGGAGAATGG + Intronic
1135821438 16:25690214-25690236 ATGGGCTCTCAAATTTCGAAAGG - Intergenic
1137677312 16:50310114-50310136 CTGGGCTCTAAAAGGCAGAAAGG + Intronic
1139811427 16:69621827-69621849 CTGGGACCACAAATGTACACTGG - Intronic
1139983177 16:70876541-70876563 CTGGGACCTCAAAAGATGAAAGG + Intronic
1140325190 16:73994618-73994640 CTTGGCTCTCACATGAAGAATGG - Intergenic
1140879008 16:79180513-79180535 GTGGACCCTCAAATGTGGGAAGG + Intronic
1143251024 17:5523056-5523078 CTGGGACCTCAAGTCTAGAGGGG + Intronic
1143986579 17:10919784-10919806 CTTGACCTTCAAATGTAGGATGG - Intergenic
1144110290 17:12023894-12023916 CTGGGACCTGACATGTAGTAAGG + Intronic
1145254529 17:21315378-21315400 CTGTGTCCTCAGATGTAGAAGGG - Intergenic
1145322066 17:21772587-21772609 CTGTGTCCTCAGATGTAGAAGGG + Intergenic
1146326161 17:31888082-31888104 CTTGGCCCTCAAATGTTCTAAGG + Intronic
1149553479 17:57556999-57557021 CTGAGGCCTGAAATGGAGAAGGG + Intronic
1151376426 17:73691877-73691899 CTGGGCCCCTAAGTGTGGAAAGG - Intergenic
1153439678 18:5102462-5102484 CTTGGCCACCAAATGTAAAAGGG - Intergenic
1156500979 18:37558172-37558194 TTGAGTCCTCAAAAGTAGAAGGG - Intronic
1158720275 18:59918480-59918502 CTGGGCCATCAACTGTGGAATGG - Intergenic
1160114008 18:76060038-76060060 CTGGCTCCTTAAAAGTAGAATGG + Intergenic
1161167176 19:2794569-2794591 CTGGGCCCTGGGATGGAGAAAGG - Intronic
1166353291 19:42211371-42211393 CTAGACCCTCAAAGGGAGAAGGG + Intronic
1167171327 19:47834249-47834271 CTGTGTCCTCACATGTAAAATGG - Intronic
1167789885 19:51668351-51668373 CTGTGTCCTCACATGTTGAAGGG + Intergenic
1168465968 19:56601437-56601459 CTGGCCTCACAAATGTAGACAGG - Intronic
925280985 2:2684298-2684320 CTGGGCTCTCAATTGAGGAATGG - Intergenic
926436097 2:12839648-12839670 CTTGGCCCACCATTGTAGAAAGG + Intergenic
928454201 2:31404564-31404586 CTGGGCCTTCAAAACTACAATGG + Intronic
929893552 2:45938519-45938541 GTGGGCGCTGAAATGTTGAAAGG - Intronic
932897381 2:75654215-75654237 CTGTGCCCTCACATGGTGAAAGG + Intronic
935825826 2:106948265-106948287 CTGAGTCCTCAAATGGTGAAAGG + Intergenic
939088450 2:137750049-137750071 CTGGGCACTCAAAGGTCTAATGG + Intergenic
944706620 2:202295744-202295766 CAGAGCCCTCAAATCTAGACGGG + Exonic
946502813 2:220267628-220267650 CTGTGGCTTCAACTGTAGAATGG + Intergenic
947076748 2:226353302-226353324 CTGGGCTCACAAATGCACAAGGG - Intergenic
947337429 2:229101974-229101996 CAAGGCCCTTAAATGTAGAGAGG + Intronic
948592088 2:239057017-239057039 CGGGACCCTAAAATGGAGAAAGG + Intronic
1169114397 20:3054069-3054091 CAGGGCCCTCAAAAATGGAAAGG + Intergenic
1170278962 20:14624692-14624714 GTGGTCCCTCACATGTGGAAAGG - Intronic
1170982836 20:21230893-21230915 CTGGGGCCTCATTTGTAAAATGG - Intronic
1172654284 20:36527554-36527576 CTGGGCCCTCAACCGCAGAGAGG - Exonic
1173260481 20:41430651-41430673 CTCAGCCCTCAAATGAAGACAGG + Intronic
1178413668 21:32386650-32386672 TTGTTCCCTCAACTGTAGAATGG + Intronic
1178471506 21:32897647-32897669 CAGGACCCTGAAATGTGGAAAGG + Intergenic
1182619116 22:31608770-31608792 CTGGGCCCTTAAATGTTTAGGGG + Intronic
1183328731 22:37208154-37208176 CTGGGGCCTCACATGTAGAAAGG - Intronic
1185088938 22:48755334-48755356 CTGGGCCCTCTAAGGCAGCAGGG - Intronic
950156497 3:10725043-10725065 CTGGTCCCTCATCTGTAAAATGG + Intergenic
950654554 3:14428541-14428563 CAGGTTCCTCAAATATAGAATGG - Intronic
951447624 3:22801299-22801321 CAGGTCCCTCATCTGTAGAATGG - Intergenic
952904348 3:38129744-38129766 CAGGGCCCACAAATTCAGAAGGG + Intronic
953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG + Intergenic
960638690 3:119808011-119808033 CTGGGCATTCAAATGGAAAAGGG + Intronic
962593730 3:136917653-136917675 CTTGACCCTCAAAAGTAAAATGG - Intronic
966558085 3:181286166-181286188 CTGTGTCCTCACATGAAGAAGGG - Intergenic
971683460 4:29732617-29732639 CTGTGTCTTCACATGTAGAAGGG - Intergenic
973036314 4:45411861-45411883 CTGGGTCCTCAAAAATTGAATGG - Intergenic
973913192 4:55604782-55604804 CTGGGCCTTCCAAAGTTGAAGGG + Intronic
985936430 5:3101302-3101324 CTGCTCACTCAGATGTAGAATGG + Intergenic
986132306 5:4942813-4942835 CTGGGCTGTCAAAAGGAGAAGGG + Intergenic
988904523 5:35772531-35772553 CTACGCCCTCAGATGGAGAAGGG - Intronic
995280652 5:110331764-110331786 CTGTGCCCTCACATGTGGAAGGG - Intronic
998738075 5:145165959-145165981 CTGGGACCTCAAAAGTACAATGG - Intergenic
999588991 5:153123271-153123293 ATGTGGGCTCAAATGTAGAAGGG + Intergenic
999822257 5:155239852-155239874 CTGGGGCCACAAATGTCCAAAGG + Intergenic
1005353525 6:24960341-24960363 CTGTGTCCTCACATGGAGAAGGG + Intronic
1008979397 6:57465658-57465680 CAGGTCCCTCAAATGTAAGAAGG + Intronic
1009167535 6:60358650-60358672 CAGGTCCCTCAAATGTAAGAAGG + Intergenic
1015390083 6:132672163-132672185 CTCTGCTCTCTAATGTAGAATGG + Intergenic
1016718471 6:147263743-147263765 CTGGGCCTTAAAGTGTAGATAGG - Intronic
1018633844 6:165843548-165843570 CTGCGTCCTCAATGGTAGAAGGG + Intronic
1020210141 7:6152865-6152887 TTGGACCCTCAAAGGTAGAGGGG - Intronic
1021781737 7:24113544-24113566 CTGTTCCCTCAAATATAAAATGG - Intergenic
1022077419 7:26985810-26985832 CTGGGCCCTCAGATATGTAAAGG - Intronic
1023467755 7:40476103-40476125 CAGGCCCCTCATATGTAAAATGG + Intronic
1032078994 7:128849339-128849361 CTGGGCCCTCGAATCCAGATTGG + Exonic
1032742658 7:134754207-134754229 CTGGGGCCTGAGATGTGGAAAGG + Intronic
1033508886 7:142034715-142034737 CAGAGCCCGCAAAGGTAGAACGG - Exonic
1034840891 7:154395147-154395169 CTGTGTCCTCAAATGATGAAAGG + Intronic
1036678367 8:10852910-10852932 CTGGTCTCACAAATGAAGAAGGG - Intergenic
1043099413 8:76021843-76021865 CTGGGTCCTCTAATGATGAAGGG - Intergenic
1044990569 8:97791817-97791839 CTGAGTCCTCATCTGTAGAATGG + Intronic
1048276269 8:133068308-133068330 CTGGGCACTCAAGGGTAGAGGGG - Intronic
1051701261 9:19826628-19826650 CTGTGTCCTCACATGAAGAAAGG + Intergenic
1053071338 9:35103824-35103846 CAGTGCCCTCATATGTAAAATGG - Intergenic
1058131939 9:101263749-101263771 CTGTTTCCTCAAATGTAAAATGG + Intronic
1058577129 9:106415703-106415725 GAGGGTCCTTAAATGTAGAAAGG + Intergenic
1058751530 9:108043000-108043022 CTTTGCCCTCACATTTAGAAGGG + Intergenic
1060023958 9:120155476-120155498 CTGAGGCCTCAAAGGTAGTAGGG + Intergenic
1061446730 9:130642922-130642944 CTGAGCCCTCATCTGTAAAATGG - Intergenic
1190382852 X:49856208-49856230 CTGGGACCCCAAATGTATTAAGG + Intergenic
1190916350 X:54814063-54814085 CAGGTCCCTCAACTGTAAAACGG - Intronic
1195958347 X:110358800-110358822 CTGGGCTCTGGAATGTGGAAAGG + Intronic
1198614499 X:138441399-138441421 CTGTTCCCTCATATGTAAAATGG - Intergenic
1199838223 X:151615279-151615301 GTGGTACCTCAAATGTTGAAGGG - Intronic
1200953983 Y:8927314-8927336 CAGGACCCTGGAATGTAGAAGGG + Intergenic
1200986521 Y:9306948-9306970 CAGGACCCTGGAATGTAGAAGGG - Intergenic