ID: 1106284665

View in Genome Browser
Species Human (GRCh38)
Location 13:28308294-28308316
Sequence AGCCCTGTGATGTGGGGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 284}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106284665_1106284670 -5 Left 1106284665 13:28308294-28308316 CCTCAACCCCACATCACAGGGCT 0: 1
1: 0
2: 2
3: 40
4: 284
Right 1106284670 13:28308312-28308334 GGGCTTTAGAGAGAAGAGCTGGG 0: 1
1: 0
2: 2
3: 29
4: 287
1106284665_1106284669 -6 Left 1106284665 13:28308294-28308316 CCTCAACCCCACATCACAGGGCT 0: 1
1: 0
2: 2
3: 40
4: 284
Right 1106284669 13:28308311-28308333 AGGGCTTTAGAGAGAAGAGCTGG 0: 1
1: 0
2: 1
3: 35
4: 344
1106284665_1106284671 14 Left 1106284665 13:28308294-28308316 CCTCAACCCCACATCACAGGGCT 0: 1
1: 0
2: 2
3: 40
4: 284
Right 1106284671 13:28308331-28308353 TGGGAGACCTCTTGTTTGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 121
1106284665_1106284673 23 Left 1106284665 13:28308294-28308316 CCTCAACCCCACATCACAGGGCT 0: 1
1: 0
2: 2
3: 40
4: 284
Right 1106284673 13:28308340-28308362 TCTTGTTTGCCAGGCTATACTGG 0: 1
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106284665 Original CRISPR AGCCCTGTGATGTGGGGTTG AGG (reversed) Intronic
900009327 1:91460-91482 AGCCCAGGGATGCGGGGTGGGGG + Intergenic
900029046 1:357421-357443 AGCCCAGGGATGCGGGGTGGGGG + Intergenic
900049649 1:586193-586215 AGCCCGGGGATGCGGGGTGGGGG + Intergenic
900357636 1:2272414-2272436 AGCCCTCCGCTGGGGGGTTGGGG + Intronic
900800134 1:4732169-4732191 GGCCCCATGATGTGGGGATGGGG + Intronic
900910642 1:5594732-5594754 AGCCCTGTGAGGTGGGATGATGG + Intergenic
901206118 1:7496833-7496855 AGCCCTGGGAGGTGGTGTTGGGG - Intronic
902081624 1:13824844-13824866 AGCTCTGGGAAGTGTGGTTGAGG + Exonic
902245018 1:15115046-15115068 GGCGCTGGGGTGTGGGGTTGGGG - Exonic
902413356 1:16225184-16225206 AACTCTGGGAAGTGGGGTTGTGG + Intergenic
903240930 1:21982152-21982174 AGCCCTGTGAAGATGGGTTGAGG - Intronic
903661210 1:24979974-24979996 GGGCCTGGGAGGTGGGGTTGGGG + Intergenic
903678803 1:25083394-25083416 GGCCCAGTGATGGGGAGTTGGGG - Intergenic
903701401 1:25251127-25251149 AGTTCTATGATGTGGGATTGAGG - Intronic
905272268 1:36794841-36794863 AGCACTATGATGTGGGGTGGTGG + Intergenic
906059070 1:42936568-42936590 AGCCCTCTGCAGGGGGGTTGGGG - Intronic
906638777 1:47428449-47428471 AGACCACTGATGTGGGATTGGGG - Intergenic
906938625 1:50236235-50236257 AGCAGTATAATGTGGGGTTGAGG + Intergenic
907368213 1:53979985-53980007 AGCCATTTGATTTGGAGTTGAGG + Intergenic
907454981 1:54569606-54569628 CACCCTGTGGTGAGGGGTTGGGG - Intronic
908972513 1:69854361-69854383 AGCCTTGTGATGTGTGCCTGTGG + Intronic
911039442 1:93580069-93580091 AGGCCTGGGAGGTGGGGCTGAGG - Intronic
911150386 1:94592508-94592530 AGCTATGAGATGTGGGGCTGGGG - Intergenic
912801079 1:112720065-112720087 AGCCCTCTGGTGTGGGAATGGGG + Intergenic
913493492 1:119405009-119405031 AACTCGGTGATGTTGGGTTGGGG + Intergenic
914333278 1:146692340-146692362 AGCACTGGGGGGTGGGGTTGGGG - Intergenic
915593901 1:156885640-156885662 AGCCCTGGTATGTGGAGGTGAGG + Intergenic
915969636 1:160345050-160345072 AGACCTATTTTGTGGGGTTGTGG - Intronic
916075284 1:161197046-161197068 AGCCCTGAGATTTGGCGTTGGGG - Intronic
916579989 1:166098034-166098056 AGTCCTGTGATGTGGGTCTATGG - Intronic
916715877 1:167446316-167446338 AAGCCTGTGATGTGCGGGTGAGG - Intronic
917792756 1:178509873-178509895 TGCCCTGTGATGGTTGGTTGTGG + Intergenic
922176516 1:223201970-223201992 TGCCCTGGCCTGTGGGGTTGGGG + Intergenic
922695634 1:227729566-227729588 AGACCTGGGATGTGGGCTTCAGG + Intronic
922823538 1:228501547-228501569 AGCAATGTGATGTGCGGTAGGGG - Intergenic
922928821 1:229373112-229373134 AGTGCTGTGGGGTGGGGTTGGGG + Intergenic
924707241 1:246510708-246510730 AGCCCTGGGATGAGGGCATGGGG - Intergenic
924740640 1:246792714-246792736 GGCCGTGGGATGTGGGGATGTGG - Intergenic
1063313413 10:4978286-4978308 ATCCCTGTGAGGGGGGGTTAGGG + Exonic
1063314539 10:4989431-4989453 ATCCCTGTGAGGGGGGGTTAGGG - Exonic
1064297533 10:14092027-14092049 AGAGCTGTGAGGTGGGGTTCAGG - Intronic
1064628342 10:17284179-17284201 AGGCCTGAGATCTGGGGTTGCGG + Intergenic
1066224432 10:33368534-33368556 AGACCTGTGAAGTAGGGTAGGGG + Intergenic
1067105084 10:43361255-43361277 ATACCTGTGATGTGGGGTTTGGG + Intergenic
1067771230 10:49127709-49127731 TTCCCTTTGTTGTGGGGTTGGGG + Intergenic
1068121098 10:52782655-52782677 CCCCCTGTGATGTGGGGTGCAGG + Intergenic
1069663342 10:70138477-70138499 AGCCCTGTGAGGGGCGGCTGTGG - Exonic
1069802031 10:71087770-71087792 AGCTGTGTGGTGTGGGGCTGTGG + Intergenic
1070151824 10:73810098-73810120 ACCCCTGAGATGTGTGTTTGGGG - Intronic
1070740855 10:78902364-78902386 AGCCCTGTGTTGTTGGGATAAGG - Intergenic
1070782421 10:79145397-79145419 AGCCCTGAGTTGTTGGGGTGGGG + Intronic
1072051987 10:91714148-91714170 CACCCTGTGAAGTGGGGTTTTGG + Intergenic
1073401275 10:103259728-103259750 AGGCCTGTGATTGGGGGTGGGGG - Intergenic
1073454465 10:103628280-103628302 AGACCTGTCATGTGGGGCGGTGG - Intronic
1075091206 10:119445026-119445048 AGCTCTGTGATGTGAGGATGAGG - Intronic
1075383732 10:122039523-122039545 CGGCCTGAGATGTGGGGTTGGGG + Intronic
1076143109 10:128095501-128095523 CCCCCTGGGAGGTGGGGTTGGGG + Intergenic
1076525335 10:131109056-131109078 AGCACAGTGTTGTGGGGTGGGGG + Intronic
1077342005 11:2030386-2030408 AGTGCTGTGGTGTGGGGCTGTGG + Intergenic
1078109616 11:8382061-8382083 AGCCGTAGGATGTGGGGGTGGGG - Intergenic
1078761336 11:14254163-14254185 ACCCCTCTGATGGGAGGTTGAGG + Intronic
1079121543 11:17688583-17688605 ATCCCTGTGTTGAGGGGCTGGGG + Intergenic
1080719905 11:34838615-34838637 AGCCCTGAGATGGGAGGTAGAGG - Intergenic
1083727072 11:64634202-64634224 ACCCCTGTGCTGTGGGGATCAGG - Intronic
1083872627 11:65498415-65498437 AGCTCTGTGGTGTGGGATTGAGG + Intergenic
1084065925 11:66704547-66704569 AGCCTTGGGAGGTGGGGGTGGGG - Intronic
1086885543 11:92201098-92201120 AGGCCTGTGGCGTGGGGTGGGGG + Intergenic
1089517930 11:119045455-119045477 ACCCCTGTGATTTGGAGGTGTGG - Exonic
1089582597 11:119490757-119490779 AGCCCTGGGTGTTGGGGTTGCGG - Intergenic
1089806328 11:121093993-121094015 AGGCCAGAGATGAGGGGTTGGGG + Intergenic
1090646875 11:128773445-128773467 AGCCCTGTCAAATGGGGTTAGGG - Intronic
1091305079 11:134531526-134531548 AGCCCGGGGATGTGGGGGAGAGG - Intergenic
1202824991 11_KI270721v1_random:85575-85597 AGTGCTGTGGTGTGGGGCTGTGG + Intergenic
1091698184 12:2641994-2642016 ACTGGTGTGATGTGGGGTTGAGG + Intronic
1091750387 12:3018474-3018496 GGCCCTGTGGTGTGGGGGTGGGG - Intronic
1092111567 12:5968295-5968317 AGCGCTGGGTTGTGGGGTGGGGG - Intronic
1092518003 12:9236090-9236112 AAGCCTGTGATTGGGGGTTGCGG - Intergenic
1093577685 12:20753441-20753463 GGCCCTGTGATGTGGGCCTGTGG - Intergenic
1096179503 12:49542848-49542870 AGCCCTGGGATGTGTGGGAGAGG + Intronic
1096450316 12:51735115-51735137 AGCCCTATCATTTGAGGTTGAGG + Intronic
1097054073 12:56239659-56239681 AGTCCTGAGAGGTGGGATTGGGG - Exonic
1098297336 12:69017364-69017386 TGCCCTGTTTCGTGGGGTTGAGG + Intergenic
1100392192 12:94153308-94153330 TCCCCTAGGATGTGGGGTTGAGG + Intronic
1101291338 12:103372686-103372708 AGTCCTGTGAGATGGGGTTGAGG - Intronic
1101751392 12:107585496-107585518 AGCCCTGTGAGATGGGGGAGGGG - Intronic
1102859464 12:116322657-116322679 AGCCCACTGATTTGAGGTTGGGG - Intergenic
1103208743 12:119151154-119151176 AGCCCTGGGATTTGGGGATCGGG - Exonic
1103459165 12:121090077-121090099 GGCCCGGTGAGTTGGGGTTGGGG - Intergenic
1105512666 13:21063304-21063326 AGCCATGTGGCTTGGGGTTGGGG - Intergenic
1105549722 13:21381711-21381733 AGCCATTTAATGGGGGGTTGTGG - Intronic
1106047331 13:26155445-26155467 ATCCCAGTGAAGTGGGGTGGAGG + Intronic
1106284665 13:28308294-28308316 AGCCCTGTGATGTGGGGTTGAGG - Intronic
1107175235 13:37392072-37392094 ATCCCTGTCATGTGGGATGGGGG + Intergenic
1109633980 13:65089161-65089183 AGCCCTGAGATGTGGGGAAAGGG - Intergenic
1110920597 13:81079588-81079610 GGACCTGTGATCGGGGGTTGGGG + Intergenic
1112503234 13:99957721-99957743 AGCCCTGAGATGCGGGCCTGGGG - Intergenic
1112674031 13:101677375-101677397 ACCACTGTGATATGAGGTTGTGG - Intronic
1119602105 14:75983036-75983058 AGCCCTGTGTTGCGGGGTGCGGG - Intronic
1119705305 14:76779440-76779462 AGGCCTGTGATGGGGGGTGGGGG + Exonic
1120305276 14:82761919-82761941 AGGCCTGTGCTGGGGGGTTGAGG + Intergenic
1121229580 14:92346935-92346957 ACCCCTGTGCTATGGGGCTGGGG + Intronic
1122627499 14:103091757-103091779 AACCCTGCAATATGGGGTTGGGG + Intergenic
1125522192 15:40354489-40354511 AGCCCCGTGGAGTGGGGGTGGGG + Intronic
1125535145 15:40438151-40438173 TGCCCAGTGAAGTGGGGTGGAGG + Intergenic
1127830723 15:62748734-62748756 AGGCCTGTGATGTTGGGTGTAGG + Intronic
1129106112 15:73308377-73308399 AGCAATGTGCTGTGGTGTTGAGG - Intergenic
1129156111 15:73719230-73719252 TTCCCTGTGTTGTGGGGCTGGGG + Intergenic
1129392337 15:75226628-75226650 AGACCTGGGTTCTGGGGTTGAGG - Intergenic
1129452511 15:75658915-75658937 TGCCTTGTGATCTGGGGCTGAGG + Exonic
1130119845 15:81038415-81038437 AGCCTTATGAGGTGGTGTTGTGG + Intronic
1130411563 15:83653224-83653246 AGGCCTGGGATTTGGGGTTGGGG - Intergenic
1132229551 15:100171401-100171423 AGCCCTGCGAGGTGGGATGGAGG - Intronic
1132347404 15:101116550-101116572 GGCCCTGTGATGTGTGCTGGGGG - Intergenic
1132572910 16:651762-651784 CGCCCTATGAGATGGGGTTGGGG + Intronic
1132886018 16:2182367-2182389 GGCCCTGTGATGTGGGTGAGAGG - Intronic
1132887525 16:2189200-2189222 AGCCCTGTGGGGTGGGGCTGGGG - Intronic
1134666368 16:16021948-16021970 AGCCCTGTGATCTGGGGAGGAGG + Intronic
1136230622 16:28883349-28883371 TGCCCTGTGATGGGGCGCTGGGG - Intronic
1137457643 16:48630323-48630345 ATACCCGTGGTGTGGGGTTGGGG + Intergenic
1138690893 16:58767591-58767613 AGTCTTGTGATGTGGGGATGGGG + Intergenic
1139665872 16:68455568-68455590 AGCCCCTCGAAGTGGGGTTGGGG + Intergenic
1140000342 16:71018910-71018932 AGCACTGGGGGGTGGGGTTGGGG + Intronic
1141334043 16:83138350-83138372 AGCGCTGTGATGGGGTGCTGTGG + Intronic
1141602725 16:85136321-85136343 AGCCCTGTGATTTGTGGTCGTGG - Intergenic
1142236840 16:88926437-88926459 AGCCCTGTGCTGTGGTTTTCAGG + Intronic
1142251221 16:88992908-88992930 AGCCCTGGGCGGTGGGGGTGGGG - Intergenic
1142629758 17:1217204-1217226 CGCACTGTGCTCTGGGGTTGGGG - Intronic
1142979606 17:3663980-3664002 AGCCCTGGGATGTTAGGCTGGGG - Intronic
1143774158 17:9186699-9186721 AGGCCTGTGTGGTGGGGGTGGGG + Intronic
1144811862 17:18005666-18005688 ATCCCTGCGTTGTGGCGTTGTGG - Intronic
1145100713 17:20074406-20074428 AGCCCTGTGATGGGATGTGGGGG - Intronic
1145761742 17:27429459-27429481 AGCCCTGGGATGAGGGTGTGTGG + Intergenic
1145882633 17:28363619-28363641 TGCCCTCTGATGTGGGGCTGTGG - Exonic
1145984831 17:29038493-29038515 AGCCTTGTGAAGTAGGGATGGGG + Intronic
1145994613 17:29098214-29098236 AGCTCTGAGATCTGGGGTTGGGG + Exonic
1147556302 17:41481347-41481369 TTCCCAGTGATGTGGGGTGGTGG - Intergenic
1147612667 17:41811120-41811142 AGCCCTACGAGGTGGGGTGGAGG - Exonic
1148115403 17:45172183-45172205 GGGCGTGTGATGTGGGGGTGGGG - Intergenic
1148561904 17:48611171-48611193 AGCCCTGTGGATTGGGGCTGGGG + Intronic
1148737527 17:49873226-49873248 AGCCCTATGTTGTGGGGTGAGGG - Intergenic
1148755278 17:49969864-49969886 TTCCCTGGGATGTGGGGGTGGGG + Intronic
1149651883 17:58280794-58280816 GGCCCTCTGAGGTGGGGCTGAGG - Exonic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1151974173 17:77475192-77475214 AACCCTGTGTGGGGGGGTTGTGG + Intronic
1152780298 17:82224808-82224830 GGGCCGGTTATGTGGGGTTGGGG - Intergenic
1152950712 17:83229135-83229157 AGCCCAGGGATGCGGGGTGGGGG - Intergenic
1153906349 18:9665111-9665133 AGGCCTGTGATCTGGCTTTGGGG + Intergenic
1154492429 18:14932193-14932215 AGACCTGGGAGGTGGGGTGGGGG + Intergenic
1155770110 18:29686166-29686188 AACTCTGTGTTGTGGCGTTGGGG - Intergenic
1156463444 18:37334400-37334422 AGCCCTCGGATGTGGGGTCCTGG + Intronic
1157203552 18:45679563-45679585 AGCCCTCTGCACTGGGGTTGGGG - Intronic
1157697999 18:49738962-49738984 AGCCCTGGGAACTGGGGGTGGGG + Intergenic
1160117206 18:76090462-76090484 AGCCCTGAGAAGTGGGGATGAGG + Intergenic
1160973304 19:1779988-1780010 AACCGGGTGATGGGGGGTTGGGG - Exonic
1161381929 19:3970186-3970208 AGCCCTGGGATTTGAGGTTGAGG - Intronic
1161846003 19:6712403-6712425 ACACCTGTGATGTGGGGTGCAGG + Exonic
1163436781 19:17300826-17300848 AACCCTGGCATGTGGGGTGGGGG - Intronic
1163927648 19:20361055-20361077 AGCCCTGGTTTGAGGGGTTGAGG + Intergenic
1164783638 19:30912669-30912691 AGCCCTGAGGTCTGGGGTAGAGG + Intergenic
1165042778 19:33080944-33080966 AGCCCCGCGATGTGCGGGTGAGG - Exonic
1166777497 19:45322011-45322033 AGCCCCGGAATGTGGGGGTGGGG - Intronic
1166999631 19:46738315-46738337 GGCCCTGTGATTTGGGGTTTGGG - Intronic
1167323066 19:48807967-48807989 AGCCCTGTGGGGAGGCGTTGGGG + Intronic
1167710712 19:51108769-51108791 TGCCCTTTGAGGCGGGGTTGCGG + Intergenic
1168325171 19:55535185-55535207 AGCCCTGTGCTGGGGGGGTTGGG - Intronic
1168468552 19:56622874-56622896 AGCTCAGGAATGTGGGGTTGTGG + Exonic
926093499 2:10065404-10065426 AGGCCTGGGCTCTGGGGTTGGGG + Intronic
926409698 2:12590241-12590263 AGCCCTGGGATCTGGGGTACAGG - Intergenic
928856425 2:35808196-35808218 AGCCCTGGGAGGCAGGGTTGCGG - Intergenic
930972841 2:57418535-57418557 AGCCTTGTTATTTGGGGTTTCGG - Intergenic
930994611 2:57701346-57701368 AAACCTGAGCTGTGGGGTTGGGG - Intergenic
932095768 2:68847124-68847146 AGACCTGTGATGTGTGGTACAGG - Intergenic
932424456 2:71620298-71620320 CGCCCTGTGAGGTGGGCTTTGGG + Intronic
932430736 2:71672383-71672405 AGCCCTCTGCCGTGGGGTTCAGG + Intronic
934745863 2:96759374-96759396 AGCCCTGTTAGCTGGGATTGAGG - Intergenic
935943308 2:108264058-108264080 TGCTTTATGATGTGGGGTTGAGG - Intronic
936166241 2:110122167-110122189 AGCCTTGTATTGTGTGGTTGAGG + Intergenic
937225087 2:120364088-120364110 AGCCCAGTGTTCTGGGGGTGGGG + Intergenic
937575885 2:123421492-123421514 AGCACTGTGATGGGGGGAAGTGG + Intergenic
937905636 2:127051524-127051546 GGGCCTGTGAGGCGGGGTTGGGG - Intronic
937983485 2:127628286-127628308 AGCCTCGGGAGGTGGGGTTGGGG - Intronic
938144072 2:128819698-128819720 AGTCCTGGAATGTGGGGTTCTGG - Intergenic
944479802 2:200144800-200144822 AGGCCTGTGATTTGGGGTGGAGG + Intergenic
944861507 2:203819664-203819686 AATCCTGTGATCTGGGGTTTTGG - Intergenic
947516238 2:230807412-230807434 AGGCCTGGGGTGGGGGGTTGGGG - Intronic
947697572 2:232204777-232204799 AGCCCCGTGCGGTGGGGTTGAGG - Intronic
949042465 2:241855597-241855619 AGGCCTGTGAGGTGGCGGTGGGG + Intronic
949086466 2:242160105-242160127 AGCCCAGGGATGCGGGGTGGGGG - Intergenic
1168749963 20:275496-275518 AGCCCTCTGCGGTTGGGTTGGGG - Intronic
1169049822 20:2566360-2566382 AGCCCTGAGAGATGAGGTTGGGG + Intronic
1171482660 20:25465635-25465657 TGCTCTGTGATGTGGGGTCTCGG - Intronic
1172148375 20:32773439-32773461 GGCCCTGTGGTGTGGTGCTGTGG + Intronic
1172597280 20:36158037-36158059 AGCCCTGTGAGGTGTAGATGAGG + Intronic
1172626054 20:36347488-36347510 AGCCCTGTGCTGGGGTGCTGTGG + Intronic
1172699765 20:36845846-36845868 GGCCCTGGGAGGTGGGGGTGAGG + Intronic
1173286033 20:41672202-41672224 GGCTCTGTGACGTGGGGTTGGGG - Intergenic
1173933723 20:46843470-46843492 AGCTCTGTGATGAGGGGCTGAGG + Intergenic
1174531663 20:51219319-51219341 AGCCCTGAGATTCGGGTTTGAGG - Intergenic
1174593701 20:51667055-51667077 AGCTGTGTGTTGTGGGGTTAGGG - Intronic
1175366947 20:58462038-58462060 AGCCCTGTGCGGTGGGGATGGGG - Intronic
1176106712 20:63393079-63393101 TGCCCTGACATGTGGGGGTGGGG - Intergenic
1176961433 21:15163370-15163392 ACCTCTGTGATGTGGGAGTGAGG - Intergenic
1179543604 21:42100223-42100245 AGCCCTGGGCTGTGGGCTTTGGG + Intronic
1179921960 21:44512324-44512346 AGCCAAGTGCTGTGGGGGTGGGG + Intronic
1181315870 22:21970611-21970633 AGCCATGTGGTGGGGTGTTGTGG - Intronic
1182584244 22:31334660-31334682 AGCCCTGTGAGGTGGGAAAGGGG + Intronic
1183582379 22:38733648-38733670 AGGCCTGTGATGGTGGGATGGGG + Intronic
1183783577 22:40015764-40015786 TGACATGTGATGTGGGTTTGGGG - Intronic
1183951609 22:41355866-41355888 AGCGCTGGGATGGGGGGCTGGGG + Intronic
1183984803 22:41563461-41563483 TCCCCTGTGATGGGGGCTTGGGG + Intronic
1184297077 22:43531803-43531825 TGCCCTGTGATGTGTGGTGTGGG - Intronic
1184821734 22:46914743-46914765 GGCCCTGTGCTGTGGGAGTGGGG + Intronic
950535677 3:13576831-13576853 AGCACTGTGAGGTGAGGGTGGGG - Intronic
950647089 3:14383624-14383646 AGCCCTGTGAGTTGGGGTCCTGG + Intergenic
950666326 3:14497497-14497519 AGCCCTGTGGTGGGGGGATCTGG + Intronic
951320644 3:21240384-21240406 ATCCTTGGGTTGTGGGGTTGGGG - Intergenic
951632412 3:24736362-24736384 AGCAATGTGAAGTGAGGTTGGGG - Intergenic
952701932 3:36337385-36337407 AAACCTGTGTTGTGGGGTGGGGG + Intergenic
953931723 3:47009114-47009136 AGCCCTCTGAGGTGAGGATGGGG + Exonic
955205831 3:56895096-56895118 CTCCCTGTAATTTGGGGTTGTGG + Intronic
955777773 3:62451735-62451757 AGCCCTTTGACGTGGTGGTGTGG - Intronic
956674002 3:71717666-71717688 AGCCATGTGCAGTGGGGTTAGGG + Intronic
958632684 3:96702355-96702377 AGCACAGAGATATGGGGTTGAGG + Intergenic
961455194 3:127020544-127020566 AGCCCTGAGCCCTGGGGTTGGGG + Intronic
961771712 3:129254835-129254857 AGCCAGGTGATGTGGGGTGGAGG + Intronic
962958680 3:140290269-140290291 AGCCCTGGGGTGAGGGGCTGAGG + Intronic
962958718 3:140290467-140290489 TGCCCTTTGAGGTGGGATTGAGG + Intronic
964145234 3:153452979-153453001 AGACCTGAGAACTGGGGTTGGGG - Intergenic
966212789 3:177470236-177470258 AGCCCTGTGGGGTGGGGGTAGGG + Intergenic
966660788 3:182412141-182412163 AGCCCTGACATGTGGGGCTTGGG - Intergenic
967633876 3:191778285-191778307 AGAACTGAGATGTGGGGTGGGGG + Intergenic
968077187 3:195822589-195822611 AGCCCTGTGATTTCGAGATGGGG + Intergenic
968469568 4:773170-773192 TGCCCTGTGCTGTGGGGCAGAGG - Intergenic
968914920 4:3493237-3493259 TGCCCTGTGAGGGGGGGCTGTGG - Exonic
969857243 4:10010067-10010089 AGCCATGTGATAGAGGGTTGGGG + Intronic
971384771 4:26132811-26132833 AGGGCTGGGATGTGGGGTGGGGG - Intergenic
973631633 4:52825618-52825640 GGCTGTGTGATGTGGTGTTGAGG - Intergenic
974391607 4:61277567-61277589 ATCCCTGTGATTTTGGATTGTGG - Intronic
975401188 4:73941652-73941674 AGGCCCCTGATGTGGGCTTGCGG + Intergenic
977148184 4:93472948-93472970 AGCCCTGTCGTGTGGGTTTCTGG - Intronic
979275544 4:118811077-118811099 AGCACAGTATTGTGGGGTTGTGG + Intronic
980524646 4:133973635-133973657 TTCCCTGTGATGTGGAGTTTTGG - Intergenic
983524539 4:168747635-168747657 AGCCATGGGATATGGAGTTGGGG + Intronic
983957347 4:173713838-173713860 AGCCCTTTGAGGTGGGCTTGGGG + Intergenic
985654837 5:1125094-1125116 AACCCTGTGGTGTGGAGTAGGGG - Intergenic
985663271 5:1168053-1168075 GGCCCTGTCCTGTGGGGTTCTGG - Intergenic
985719841 5:1483060-1483082 TGGCCGGTGATGTGGGGTGGAGG + Intronic
985812039 5:2097374-2097396 GGACCTGTGATGAGGTGTTGTGG + Intergenic
986167896 5:5291656-5291678 GGCCTTGTGGTGTGGGGGTGGGG - Intronic
990896759 5:60707898-60707920 AGGTCTGTGAGCTGGGGTTGGGG + Intergenic
991290324 5:65027453-65027475 AGCCCTTGGATGTGAGGCTGTGG - Intergenic
998954759 5:147427731-147427753 AGAACTGTGGGGTGGGGTTGGGG - Intronic
999231294 5:150063644-150063666 AGCCCTGGGATGTGGGGAGGAGG + Intronic
1000083310 5:157867649-157867671 AGGCCCCTGAGGTGGGGTTGGGG + Intergenic
1000188245 5:158881914-158881936 AGCCCTGTGAAGGGAGGTGGGGG - Intronic
1000713109 5:164605648-164605670 AGTCCTTTGGTGTGGGGCTGAGG + Intergenic
1001566247 5:172701264-172701286 AGCCCGGTGATGTGGGGGCAGGG - Intergenic
1001919199 5:175587303-175587325 TTGCCTGTGATGTGGGGGTGGGG + Intergenic
1002065060 5:176647724-176647746 TGCCCTGTGCTGGGGGGTGGTGG + Intronic
1002072822 5:176690514-176690536 AGCCCTGTGATGAGAGGGTGGGG - Intergenic
1002396941 5:178964836-178964858 ATTCCTGTGATGGGGTGTTGGGG - Exonic
1002744944 5:181462950-181462972 AGCCCAGGGATGCGGGGTGGGGG - Intergenic
1002787893 6:418479-418501 ACCCCTGAGATGTGGGGTCATGG + Intergenic
1003108021 6:3229853-3229875 AGCGCTGGGGGGTGGGGTTGGGG + Intronic
1004127345 6:12886651-12886673 GGTCCTGTGTTGTTGGGTTGTGG - Intronic
1004709229 6:18154895-18154917 AGCCCTGTGAAGTGGGGTTCAGG - Intronic
1005972321 6:30771014-30771036 AGCCTGGTGATGTGGGGATGAGG - Intergenic
1006446894 6:34084674-34084696 AGCCATGTGAGGTGGGGCTGAGG - Intronic
1008737872 6:54569236-54569258 AGTCCTAAGATGTGGGGTGGAGG - Intergenic
1008737889 6:54569310-54569332 AGTCCTAAGATGTGGGGTGGAGG - Intergenic
1015222896 6:130825269-130825291 AGCTGGGTGATGTGGGGTTCAGG - Intergenic
1016822607 6:148360818-148360840 GACCCTGTGAGGTGTGGTTGTGG + Intronic
1017208170 6:151826060-151826082 AGCCCTGGGATGCGGGGAGGGGG + Intronic
1018253939 6:161899510-161899532 ATCACTGGGAAGTGGGGTTGAGG + Intronic
1021540701 7:21754569-21754591 AGTCCTGTGATGATGGGGTGGGG - Intronic
1023967167 7:44969093-44969115 AGGCTGGTGATGTGGGGGTGGGG - Intronic
1024512260 7:50213282-50213304 AGCAGTGTGATGTGGGTTGGGGG + Intergenic
1024555635 7:50600884-50600906 AGTCCTGAGAAGTGGGGCTGTGG - Intronic
1025603076 7:63017610-63017632 AGCACTGTGATCAGGAGTTGGGG + Intergenic
1028170684 7:87591859-87591881 ACTCCTGTGATAAGGGGTTGAGG + Intronic
1029248418 7:99219031-99219053 AGCCCTGTGAGGTGGGGCCAAGG - Intergenic
1029526350 7:101096554-101096576 AGCTCTGTGAAGTGGGCATGTGG - Intergenic
1030838541 7:114319144-114319166 GGACCTGTGATGGGGGGTTGGGG + Intronic
1032448206 7:132003011-132003033 AGCCCTCTGATTTGGGGCCGGGG - Intergenic
1032597586 7:133257113-133257135 AGGCCTGTGAGGTGGGGCTTAGG + Intronic
1032805258 7:135347879-135347901 AGCCCAGAGATTTGGGGTGGGGG - Intergenic
1032805590 7:135350875-135350897 AGAGGAGTGATGTGGGGTTGGGG - Intergenic
1033227824 7:139575023-139575045 AGCCCTGTGAGGTGGGTGAGGGG + Intronic
1034395380 7:150820373-150820395 AGGCCTGAGAAGTGGGGTGGAGG + Intergenic
1034744435 7:153510481-153510503 CGCCCTGTGGTCTAGGGTTGAGG - Intergenic
1035328058 7:158077559-158077581 AGCCCTGTGTGGTGGGGGTGTGG - Intronic
1035360603 7:158310963-158310985 AGATGTGTGGTGTGGGGTTGGGG - Intronic
1035772046 8:2155550-2155572 AGAGCTGTGATCGGGGGTTGGGG - Intronic
1037918782 8:22789511-22789533 AGCCCCCTGAGGTGGGGCTGTGG + Intronic
1039771022 8:40686933-40686955 AGCCCAGCAATGTGGGATTGAGG - Intronic
1039895927 8:41716439-41716461 AGGCCTGTGATTTGTGTTTGGGG - Intronic
1041682629 8:60608610-60608632 AGGCCAGTGAGGTGGGGTGGGGG - Intronic
1042411908 8:68475817-68475839 CTCCCTGTGATGTGAGGTAGTGG + Intronic
1045959723 8:107953168-107953190 AGCCTTCTGATGTGGAGATGGGG + Intronic
1046278577 8:111994035-111994057 AGCCCTGTGATGTGTAGCAGAGG - Intergenic
1046453495 8:114425387-114425409 AGCACTGTGCTGTGGGGGAGGGG + Intergenic
1046618640 8:116503966-116503988 AGCCCAGTCAAGTGGGCTTGTGG + Intergenic
1046770720 8:118113611-118113633 AGCCCTGTGAAGTGGGGCTGTGG + Intergenic
1048708183 8:137178173-137178195 AGCACTGTGGTTTGGGGGTGAGG + Intergenic
1049578499 8:143400389-143400411 AGCCCGGTGACCAGGGGTTGGGG - Intergenic
1053020687 9:34691827-34691849 AGGCCTGAGATGTGGGATGGGGG - Intergenic
1057268356 9:93633466-93633488 CGCCCTGCCCTGTGGGGTTGGGG + Intronic
1058885223 9:109317872-109317894 AGCCCAGTGAAGTGGGTCTGAGG + Intronic
1061272291 9:129550266-129550288 AGGGCAGTGATGTGGGGTTCGGG - Intergenic
1062046352 9:134426263-134426285 GGCCCTGTGATGTGGGGGCCCGG - Intronic
1062220321 9:135411567-135411589 TGCCCTGGGATGTGGTGTTCTGG - Intergenic
1062292618 9:135803712-135803734 AGCCATGTGCTGTGGGGAAGGGG + Intergenic
1062340629 9:136092487-136092509 AGCCCTGTGGTGTGAGGCCGTGG - Intronic
1062460903 9:136662196-136662218 ACCCCTGTGAAGTGGGGCTGAGG + Intronic
1062537235 9:137026450-137026472 AGGCTTGTGATGTGGGGCTGGGG - Intronic
1062568092 9:137172090-137172112 AGGACTGTGAGGTGGGGGTGGGG + Exonic
1187553479 X:20328892-20328914 AGGCCTTGGAAGTGGGGTTGGGG - Intergenic
1188022449 X:25173725-25173747 TTCACTGTGATGTGGGGTAGGGG + Intergenic
1188111480 X:26199435-26199457 ATCCCTGTGTTCTGGGGTTGGGG - Intergenic
1192139771 X:68637843-68637865 AGCCCTGAGCTGTGAAGTTGTGG - Intergenic
1192299087 X:69881491-69881513 AGTCCTGTGATGTGTTGGTGAGG - Intronic
1192446816 X:71217011-71217033 ATCCTTGTGATTTGGGGTTTGGG - Intronic
1198193191 X:134331491-134331513 AGATCTGTGTTGTGGGGTGGGGG + Intergenic
1199684543 X:150254681-150254703 AGCCCTGTGATCTGGAGTGAGGG - Intergenic
1200119721 X:153784581-153784603 GGCCCAGTGATGTGAGGCTGAGG - Intronic
1200173176 X:154094123-154094145 CCCCCTTTGATGTGGGGGTGGGG + Intronic
1201554373 Y:15253560-15253582 AACCCTGTGTTGTGGGCTGGTGG - Intergenic