ID: 1106286657

View in Genome Browser
Species Human (GRCh38)
Location 13:28323855-28323877
Sequence CTTTGGGGAAGGAGGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 681
Summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 616}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106286647_1106286657 26 Left 1106286647 13:28323806-28323828 CCTAGGAGGAGTTATAAGAGAAG 0: 1
1: 0
2: 2
3: 11
4: 212
Right 1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG 0: 1
1: 0
2: 5
3: 59
4: 616
1106286646_1106286657 27 Left 1106286646 13:28323805-28323827 CCCTAGGAGGAGTTATAAGAGAA 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG 0: 1
1: 0
2: 5
3: 59
4: 616
1106286651_1106286657 -7 Left 1106286651 13:28323839-28323861 CCAATTTCTCAGGTTTCTTTGGG 0: 1
1: 0
2: 8
3: 36
4: 317
Right 1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG 0: 1
1: 0
2: 5
3: 59
4: 616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106286657 Original CRISPR CTTTGGGGAAGGAGGGAACA TGG Intronic
900193167 1:1360013-1360035 CCATGGGGAGAGAGGGAACAGGG - Intronic
900402619 1:2478781-2478803 CTGTGGGGTAGGAGGGATCCAGG + Intronic
900433313 1:2612936-2612958 CTGAATGGAAGGAGGGAACAGGG + Intronic
900469610 1:2847276-2847298 CCTTGGGGGAGGCGGGAGCAGGG - Intergenic
900595414 1:3478084-3478106 CCCTGGGGCAGGAGGGTACAGGG + Intronic
900765354 1:4501262-4501284 CTTTGGGGAAGGATGGCAAGGGG + Intergenic
901216654 1:7559003-7559025 CTTTGGGAGAGGAGGGACAAAGG + Intronic
901799168 1:11697554-11697576 CATTGGGATAGGAGGGAACCAGG - Intronic
902086843 1:13869129-13869151 CTTTCTGGAAGGAGGGATCTGGG + Intergenic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902700261 1:18167572-18167594 CGGTGGGAAAGGAGGGAACTTGG - Intronic
902701563 1:18175768-18175790 TTTTGGAGGCGGAGGGAACATGG - Intronic
903189564 1:21649199-21649221 CTTTGGAGGAGGAGGGAACGAGG - Intronic
903840023 1:26232454-26232476 ATGTGAGGAGGGAGGGAACAGGG - Intergenic
904810471 1:33160305-33160327 CTTGGGGGTAGGAGGGATGAGGG + Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906666315 1:47624596-47624618 CTATGGGGAAGGAGAGCAAAGGG - Intergenic
906746299 1:48224413-48224435 CTTTGGGGAGGGAAGGATAAGGG + Intronic
907495732 1:54843097-54843119 CCCTGGGGAAGGAGGGCACAGGG - Intergenic
907701116 1:56789049-56789071 CTTTGGGGGAGGAGGACCCAGGG + Exonic
908792171 1:67793770-67793792 GTTTGAGGAAGGAGGGGACAGGG - Intronic
908881710 1:68740118-68740140 CTTTGGGGGAGGAGCCAAGATGG - Intergenic
909277761 1:73709750-73709772 CTTGGGGGAAGGAAGCAAGAAGG + Intergenic
909781103 1:79548811-79548833 CTTTGGGAAAGGCTGGAAAAAGG - Intergenic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
910793629 1:91075965-91075987 CTTTGGGGAGGGAAGGAACCAGG + Intergenic
911210229 1:95131353-95131375 CCTTGTGGAAGAAGGGAACATGG + Intronic
911692576 1:100850955-100850977 CTATGGTGCAGGTGGGAACAGGG + Intergenic
911761286 1:101620185-101620207 CCTGGGGGAAGGAGTGAAGATGG + Intergenic
912663873 1:111561505-111561527 ATTGGGGGAAGGAGGGAGGAAGG + Intronic
912680012 1:111723147-111723169 CTCTGGAGAAGGTGGGGACAAGG + Exonic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912871405 1:113310472-113310494 CTTGGGGGAGGGAGAGCACAGGG + Intergenic
912994401 1:114518577-114518599 GGTTGGGGGAGGAGGGATCAGGG - Intergenic
914513765 1:148356065-148356087 CTTTGGGGAAGAAGGGCAGGGGG - Intergenic
915123430 1:153647250-153647272 CTCTGGGGTAGGAGGGAGCCTGG - Intergenic
915226924 1:154418484-154418506 ATGTGGGGGAGGAGGGAGCAGGG + Intronic
915275778 1:154787312-154787334 CATTTGGGAGGGAGGGACCAGGG + Intronic
915354548 1:155248196-155248218 CTTTTTGGAAGGTGGGCACAGGG + Exonic
915455134 1:156035568-156035590 CTTTGAGGAAGGAGAGGAGAGGG - Exonic
915948764 1:160173746-160173768 GGCTGGGGATGGAGGGAACATGG - Intronic
916845065 1:168642382-168642404 TATTGGCAAAGGAGGGAACAGGG - Intergenic
917225590 1:172778219-172778241 CTTTTGGGAAAAATGGAACAGGG + Intergenic
918126978 1:181592761-181592783 AGTTGGGGAAAGAAGGAACAAGG - Intronic
918329502 1:183444452-183444474 CTTTGGGGAAATAGGAAAGAAGG + Intergenic
919082921 1:192888060-192888082 CTTTGGAGAAAGAGTTAACAAGG - Intergenic
919881454 1:201903772-201903794 TTTTGGGAAAGGAAGGAAGAGGG - Intronic
920039549 1:203086395-203086417 TATAGGGGGAGGAGGGAACAAGG + Intergenic
920167559 1:204046331-204046353 CTTAGGGGAGGGAGAGAACTTGG + Intergenic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
920286962 1:204887149-204887171 GCTTGGGGGAGGAGGGAATAGGG - Intronic
920433744 1:205935320-205935342 TTTTTTGTAAGGAGGGAACAGGG + Intronic
920517772 1:206599336-206599358 TTTTGGAGAAGGGGAGAACAGGG + Intronic
921694379 1:218190777-218190799 TTTTGGGGAAGGGAGGAAGATGG + Intergenic
921989745 1:221351764-221351786 GTCTGGGGAACGAGGAAACAAGG - Intergenic
922752933 1:228079330-228079352 GTCTGGGGAAGAAGGAAACAGGG + Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922968074 1:229709278-229709300 CAGTGGGGAAGGAGAAAACATGG - Intergenic
923228024 1:231957279-231957301 GTTTGCGGAGGGAGGGAAGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923730406 1:236544377-236544399 CTTTCAAGAAGGAAGGAACACGG + Intronic
1063619961 10:7637529-7637551 CTGTGGGGACTGAGGGAACCTGG - Intronic
1064390396 10:14937142-14937164 GGTTGGGGAAGGAGAGAATAGGG + Intronic
1064400767 10:15019173-15019195 GGTTGGGGAAGGAGAGAATAGGG + Intergenic
1064932737 10:20644809-20644831 ATTTGGTGAAGGAGAGAACCTGG - Intergenic
1065455792 10:25905314-25905336 CTTTGGGGAAAGGGTGAACAAGG + Intergenic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1066706335 10:38183053-38183075 CTTTGGGGACACAGGGAAAAGGG - Intergenic
1067012677 10:42729108-42729130 CTTTGGGAAAGGAGCTAAGATGG + Intergenic
1067191052 10:44068727-44068749 CTTTAGGGAAGAAGGACACAGGG + Intergenic
1067310912 10:45112760-45112782 CTTTGGGAAAGGAGCTAAGATGG - Intergenic
1067553621 10:47252798-47252820 ATTCGGGCAAGGAGGCAACAAGG - Intergenic
1067786947 10:49257124-49257146 GTTTGTGGAAGGTGGGAAAAAGG + Intergenic
1067901976 10:50251354-50251376 TCTTGGGGAAGGAGGGAAGGAGG - Intergenic
1067917529 10:50417171-50417193 GTTTGGGGAAGTAGGGGACAGGG - Intronic
1069802985 10:71093754-71093776 CATGGGGCAAGGAGGGAGCAGGG + Intergenic
1069834243 10:71298711-71298733 CATGGGAGCAGGAGGGAACACGG + Intronic
1070124029 10:73605826-73605848 CTTTGGGGAAGGAGGAATCGGGG + Intronic
1070161724 10:73870922-73870944 TCTTGGAGATGGAGGGAACAAGG - Intronic
1070441265 10:76445985-76446007 CTTTGGGGAAGCTGGGACTAGGG - Intronic
1070500072 10:77064358-77064380 GTTGGGGGAAGGAGGGAGAAGGG + Intronic
1070541537 10:77418725-77418747 GTTGGGGGAAAGAGGGGACATGG - Intronic
1070611673 10:77937631-77937653 TTGTGGGGTAGGTGGGAACAAGG - Intergenic
1070932105 10:80268334-80268356 GTTTGGAGAAAGAAGGAACAAGG - Intergenic
1071149454 10:82617412-82617434 GTTTGGAGAAGGAGGCAGCATGG + Intronic
1071396490 10:85228746-85228768 CTTAATGGAAGAAGGGAACAAGG - Intergenic
1072218030 10:93304300-93304322 CATTGAGAAAGGAGGGGACAAGG + Intergenic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1072591915 10:96833754-96833776 CTGTCGGGAAGGAGGGAATGAGG - Intronic
1072788874 10:98303269-98303291 CTCTGGGGAACAAGGGCACAGGG + Intergenic
1073430639 10:103484582-103484604 CTTTGGGGGAAGAGGGCACCTGG + Intergenic
1074271618 10:111959234-111959256 CTTTGGAGAATGAAGGAAGAGGG + Intergenic
1074574971 10:114660080-114660102 ACTTGGGGAAAGTGGGAACATGG + Intronic
1075065857 10:119288459-119288481 CTTTGGGGAAACAGGGAAGCAGG - Intronic
1075464856 10:122643538-122643560 CCTTGGGGGAGGCGGGAACCAGG - Exonic
1075657980 10:124174428-124174450 CTTTGGGGCTGGAGGGCACTGGG - Intergenic
1075859314 10:125661302-125661324 CTTTGGGGAAGCTGGAAATAAGG - Intronic
1076091543 10:127690421-127690443 CATGGGGGAAGGTGGGAAGAAGG + Intergenic
1076512962 10:131025365-131025387 GATAAGGGAAGGAGGGAACATGG - Intergenic
1076883274 10:133249700-133249722 TTCTGGGGGAGGAGGGAACGTGG + Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077295566 11:1824887-1824909 CTTTGGGGACGGAGGGTCCCAGG + Intergenic
1077372905 11:2192025-2192047 GTCTGGGGAAGGAGGGAAGGAGG + Intergenic
1077761358 11:5103136-5103158 CTTTCTGGAAGGAAGGAAGAAGG + Intergenic
1078522826 11:12077037-12077059 CTTTTGAGGAGGAGGGAACTGGG + Intergenic
1078564510 11:12403063-12403085 CTGTGGGGAAGGAGGCAGCGAGG - Intronic
1078897482 11:15609821-15609843 TTTAAGGGAAGGAAGGAACATGG - Intergenic
1082172198 11:49018461-49018483 CGTTGGGGAAGGGTGTAACATGG + Intergenic
1082775629 11:57242420-57242442 CTCTCGGGAAGGAGAGAAAAAGG - Intergenic
1083016302 11:59457644-59457666 CTCTGGGGAGGGGCGGAACAAGG + Exonic
1084770855 11:71342056-71342078 CTTTGAGGAAGGGGGTGACATGG + Intergenic
1085236915 11:75022376-75022398 CTTTGGGGAAAGAGGCAGCAAGG - Intergenic
1085692718 11:78676971-78676993 CTGAGGGGCAGGAGGGAACGTGG + Intronic
1085907790 11:80785503-80785525 TGTTGGGGAGGGAGGGAACAAGG - Intergenic
1086400382 11:86456629-86456651 CTCTGGGGAAGGACGGAGCAGGG + Intronic
1086693562 11:89817499-89817521 CATTGGGGAAGGGTGTAACATGG - Intergenic
1086712584 11:90027070-90027092 CATTGGGGAAGGGTGTAACATGG + Intergenic
1087139843 11:94754464-94754486 ATTTGAGGAAGGAGATAACAAGG - Intronic
1088750885 11:112841350-112841372 ATTTGGGGAAGAGGGGAAAATGG + Intergenic
1088827327 11:113506925-113506947 CCTTGGGGAATGAGGGCAGAAGG + Intergenic
1088917910 11:114241005-114241027 CTCTGGGCCAGGAGGAAACATGG - Intronic
1088923757 11:114280684-114280706 CTTTGGGAAAAGGAGGAACAAGG + Intronic
1089043986 11:115482960-115482982 CATTGGGCAAGCAGTGAACACGG + Intronic
1089179271 11:116569807-116569829 CTTTGCTGAAGGAGGGACCCGGG - Intergenic
1089569245 11:119392148-119392170 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1089623211 11:119734772-119734794 CTCAGGGCCAGGAGGGAACATGG - Intergenic
1090153056 11:124405296-124405318 CTTGGGGGAGGGAGAGAAGAGGG - Intergenic
1090753207 11:129765420-129765442 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1091750221 12:3017650-3017672 AGTCAGGGAAGGAGGGAACAAGG + Intronic
1092004358 12:5056640-5056662 ATTTGGGGAAGTAGAAAACAGGG + Intergenic
1092024576 12:5230247-5230269 CTTTGGGGAAACAGGGGTCAAGG - Intergenic
1092655055 12:10674948-10674970 CTCTGGGGAAACAGTGAACAAGG + Intergenic
1092926017 12:13273123-13273145 GTTTGGAGAATGAGGGGACAGGG + Intergenic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1094770397 12:33651639-33651661 GTTGGGGGTAGGAGGGAAAAGGG + Intergenic
1094776591 12:33736541-33736563 CATTGGGGAAGGGGGGAATGGGG - Intergenic
1096238454 12:49945560-49945582 CTTTGGGGACTGAGGGAGAAGGG - Intergenic
1096239730 12:49953425-49953447 CCTTGGGTAAGGAGAGAACTCGG - Intronic
1096297678 12:50397641-50397663 CAGTGGGGAAGGAAGGAACCAGG - Intronic
1096420472 12:51452893-51452915 CTTTGGGGAAGGAGCGAGATGGG + Intronic
1096717544 12:53500250-53500272 CTTTGGGGGAGGAGGCAATGGGG + Intergenic
1096798938 12:54096629-54096651 CTTTGGGGGATGGGGAAACAGGG + Intergenic
1097070537 12:56351248-56351270 CCTGGGGGAAAGAAGGAACAAGG - Intronic
1098219371 12:68252448-68252470 CTCTGTGGAAGGAGGGAAGGAGG + Intronic
1098524584 12:71471984-71472006 CTTTGGGGACTCAGGGAAAAGGG + Intronic
1098612299 12:72474425-72474447 GCTTGGGGGAGGAGGAAACAAGG - Intronic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1099278812 12:80615618-80615640 CTTTGGGGCAGGGGTGAAGAAGG + Intronic
1099374305 12:81878973-81878995 CTATGGGCAAGGAGGTATCATGG + Intergenic
1099924111 12:88996560-88996582 CTTTGAGGAAGGAAGTGACATGG + Intergenic
1099941491 12:89194525-89194547 TGTTGGGGAAGGAGGGAGGAAGG - Intergenic
1100292110 12:93225744-93225766 CTCTGGGGAAGGAGAGAAATGGG - Intergenic
1100706778 12:97209389-97209411 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101879977 12:108619597-108619619 CTTTGGGGAAGGAATGAACAAGG - Intergenic
1102183742 12:110932115-110932137 CTTTGGGGAAGAAGGGACATTGG + Intergenic
1102232099 12:111269785-111269807 CTTTGGGGAAAGAGGAGAGAGGG - Intronic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1103010613 12:117455662-117455684 ATTTGGGGAATGAAGGGACAAGG + Exonic
1103130511 12:118464451-118464473 CTTTGGGGATGCAGGGGAAAGGG - Intergenic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103958691 12:124593907-124593929 TTTTGGATGAGGAGGGAACATGG + Intergenic
1103966244 12:124641722-124641744 CTCTGGGCAAGGAGGGAGCTAGG - Intergenic
1103975717 12:124701312-124701334 CTTTCCTGAAGGAGGGAACCTGG + Intergenic
1104160684 12:126177325-126177347 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1106312769 13:28568216-28568238 AGCTGGGGAAGGAGGGAGCAGGG - Intergenic
1106356887 13:28991763-28991785 CAAAGGGGAAGGAGGGAAAAAGG - Intronic
1107625676 13:42280713-42280735 ATTTGGGCAAGGAGGGATAAAGG + Intronic
1109178459 13:59184645-59184667 GTTTGGGGGAGGTGGGAATAGGG - Intergenic
1109371375 13:61424464-61424486 ATTTGGGGAAGGAGAGAGGATGG + Intronic
1109624861 13:64961893-64961915 ATTTAGGAAAGGAGGGAAGATGG + Intergenic
1109945825 13:69430246-69430268 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1110182263 13:72631770-72631792 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1110471548 13:75865661-75865683 CTTTGGGGAGGAGGGGAAAAAGG - Intergenic
1111115373 13:83769643-83769665 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111893169 13:94108364-94108386 CTTTGGGGACTCAGGGAAAAAGG + Intronic
1112472935 13:99705745-99705767 CTGGGGGGAAGGAGGGAATGGGG + Intronic
1112682305 13:101780784-101780806 CTATGGGGAAGGGGAGATCAGGG + Intronic
1112933765 13:104774121-104774143 CCTTGGGGAGGTAGGGAACTAGG + Intergenic
1113698327 13:112364588-112364610 ATCTGGGAAGGGAGGGAACAGGG + Intergenic
1115364509 14:32542664-32542686 CCTTGAGGAAGGAGGGAACATGG + Intronic
1117999376 14:61508976-61508998 CCTTGGAGAAGGTGAGAACATGG - Intronic
1118316992 14:64731572-64731594 CCTTTGGGAAGGAGAGAAGATGG - Intronic
1118589716 14:67392428-67392450 CTAGGGGGAAGGAGGGAGCAAGG + Intronic
1118638308 14:67768190-67768212 CTAGGGGTAAGGAGGGAGCATGG + Intronic
1118813616 14:69293185-69293207 CTTTGGGGCAGGACAGAACAGGG - Intronic
1119728031 14:76933854-76933876 GATTTGGGAAGGAGGGGACACGG - Intergenic
1120052379 14:79882250-79882272 CTTTGGCCAAGGATGCAACATGG + Intergenic
1120159675 14:81131786-81131808 CTATGGGGAAAAGGGGAACAGGG - Intronic
1120312740 14:82851449-82851471 CTTTGGGGAAGGAAGAACCCTGG + Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1121510697 14:94510923-94510945 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1121599954 14:95195954-95195976 CTTGGGAGAAGGAGGGAGCAGGG - Intronic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1122191722 14:100050167-100050189 CTTTGGGGAAGAAAGGAGCGGGG + Intronic
1122200989 14:100122533-100122555 CTATGAAGTAGGAGGGAACAGGG + Intronic
1122715501 14:103694475-103694497 CTTTATGGAATGAGGGAGCACGG + Intergenic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1122785974 14:104163437-104163459 CTTTGGGCGACGAGGGCACAAGG + Intronic
1122860512 14:104580357-104580379 TCTGGGGGAAGCAGGGAACACGG + Intronic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1123411728 15:20066501-20066523 ATTTGGGGATAGAGGGACCACGG - Intergenic
1123521072 15:21073620-21073642 ATTTGGGGATAGAGGGACCACGG - Intergenic
1124784133 15:32663474-32663496 CTTTGTGGCAGGAGGCATCAGGG + Intronic
1124792812 15:32745839-32745861 CTTTATGGAAGGATGGAAGAGGG + Intergenic
1125582745 15:40798336-40798358 GCTGGGGGGAGGAGGGAACAGGG + Intronic
1125717890 15:41830080-41830102 CCTCGGGGATGCAGGGAACAGGG - Intronic
1126108494 15:45162308-45162330 CTTTGAGGATGGAGGCAAAAGGG - Exonic
1126901455 15:53318850-53318872 CTATGGGGAAGGGGGGACCAAGG + Intergenic
1127226464 15:56935633-56935655 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1127337727 15:58006172-58006194 CTTTGGGGAAGGATGGGAGTGGG - Intronic
1128255645 15:66194649-66194671 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1128431894 15:67604342-67604364 CTTTAGGAAATGAGGCAACAAGG - Intronic
1128506452 15:68276493-68276515 CTTTGGGGAAGGGAGGAAGAGGG + Intergenic
1128578420 15:68791745-68791767 CAGAGGGGAAGGAGGGGACAGGG + Intronic
1128637088 15:69309586-69309608 CTCTGAGGAGGGAGGGGACAGGG - Intronic
1128654667 15:69451980-69452002 CTTGGGGGAAGGAGGGATTATGG - Intergenic
1129524039 15:76202943-76202965 CTTTGAGGGAGGAGAGAAGAGGG - Intronic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1130194777 15:81769041-81769063 CTTTAGGCAATGATGGAACATGG - Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1131330726 15:91496975-91496997 CTTTGGGGAAAGAGGTAAAGTGG - Intergenic
1131357292 15:91757101-91757123 GGTTGGGGGAGGAGGGAAGAGGG - Intergenic
1132066096 15:98732498-98732520 GTCTGGGGAAGGAGGGAAGCTGG + Intronic
1132104146 15:99050713-99050735 GTTTGGGGAAGGAAAGAACAGGG + Intergenic
1132583685 16:696668-696690 CTTTGGGGTGGGAGGAAAGAAGG - Intronic
1132909260 16:2299877-2299899 CTTCAGGGCAGGAGGGAGCAAGG + Intronic
1133409058 16:5552832-5552854 CCTTGGGAAACGAGGGAAAAGGG + Intergenic
1135207919 16:20498905-20498927 CCTTGGGGATGCAGGGCACAGGG - Intergenic
1135210980 16:20524795-20524817 CCTTGGGGATGCAGGGCACAGGG + Intergenic
1136125330 16:28175327-28175349 TTTTGGGGAGGGAGAAAACATGG - Intronic
1136128615 16:28204054-28204076 CTTTAGGGAAGGAGTAAACTAGG - Intronic
1136139275 16:28278249-28278271 CTTTGGGGCAGGGGAGAGCAGGG + Intergenic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1137804060 16:51287139-51287161 CTTGGGGGAAAGAGAGAAAAGGG + Intergenic
1138221401 16:55254759-55254781 CTATGGGGGAGGAGGGAAATGGG - Intergenic
1138435121 16:56994277-56994299 CTTAGGGGAAGGATGGCAAAAGG + Intronic
1138449605 16:57085613-57085635 CTTTGGGGAGGAAGGGGGCAGGG - Intergenic
1138631996 16:58303890-58303912 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1138679740 16:58676165-58676187 CTGGGGGGAAGGATGGAACAGGG - Intronic
1138894578 16:61188089-61188111 ATATGGCGAAAGAGGGAACAAGG + Intergenic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139641443 16:68294525-68294547 CTGTAGGGAAGGGGGGAGCAGGG + Intronic
1140037827 16:71384430-71384452 GTTGGGGGAAGGAGGGTGCAGGG - Intronic
1140722892 16:77787346-77787368 CCCTGTGGAAGGAGGGAAAATGG + Intergenic
1140800994 16:78488162-78488184 GGCTGGGGATGGAGGGAACATGG + Intronic
1141011429 16:80404012-80404034 CAGTGGGGAGGGAGTGAACAAGG - Intergenic
1141038789 16:80654118-80654140 ATTTGGGGAAGAAGGGTGCAAGG + Intronic
1141543854 16:84749424-84749446 CTTTTGGGAAAGAGGGAGTAGGG + Intronic
1142024451 16:87804971-87804993 CTCTGGGGAAGGAAGGATGACGG - Intergenic
1142325438 16:89411886-89411908 CTGAGGGGAGGGATGGAACATGG - Intronic
1142478718 17:204949-204971 CAGTCGGGAAGGAGGGAGCAGGG + Intergenic
1142492704 17:289069-289091 CTTTGGGGCAGGAGAGAGCAGGG + Intronic
1142971917 17:3617789-3617811 CTTTGGGGTAGGAGGTAAACAGG - Intronic
1143291789 17:5836963-5836985 CTTTGGAGAAGGAGGCCTCAGGG + Intronic
1143847218 17:9781595-9781617 CTGTGGGGAAGAAGGAAACAGGG + Intronic
1144086403 17:11812885-11812907 CTTTGGGGTAGGAGGGAAGTTGG - Intronic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1144145053 17:12389294-12389316 CTGTGAGGGAGCAGGGAACAGGG + Intergenic
1144805324 17:17962237-17962259 GCTGGGGGGAGGAGGGAACAGGG + Intronic
1145275901 17:21430220-21430242 CTTTTGGAAGGCAGGGAACAAGG - Intergenic
1145313748 17:21716133-21716155 CTTTTGGAAGGCAGGGAACAAGG - Intergenic
1145409222 17:22641742-22641764 TTTTGGAGGAGGAGGGGACAGGG + Intergenic
1145712188 17:26988106-26988128 CTTTTGGAAGGCAGGGAACAAGG - Intergenic
1145869274 17:28260149-28260171 GTGTGGAGAAGGAGGAAACAGGG - Intergenic
1146003751 17:29148027-29148049 ATTTGGGGAAGGATGGGAAATGG + Intronic
1146577642 17:34008766-34008788 CTTTGGGCAAGGAAGAACCAGGG - Intronic
1147155401 17:38542207-38542229 CTCTGGGGAGGGAGGGACTAGGG + Intronic
1147362931 17:39942964-39942986 CCTTGGGGAGTGAGGGAAGATGG + Intronic
1147585112 17:41649589-41649611 CTTTGGGGAAGGGGAGAGCCTGG + Intergenic
1147672623 17:42185345-42185367 CTTTGTGGAAGGAAGGTTCATGG + Exonic
1148458141 17:47821846-47821868 CTTGGCGGGAGGAGGGGACAGGG - Intergenic
1148852865 17:50563085-50563107 CTTTGGGGAAGGGGGGTGGAAGG + Intronic
1148863770 17:50618201-50618223 CTCTGGGGGAGGAGGGAAAGGGG - Exonic
1149394892 17:56230343-56230365 TTTTGGGGAAGGAGAGAGGAAGG + Intronic
1150008651 17:61485753-61485775 CTTTGGGGAAGGAGCAATGAGGG - Intergenic
1150009145 17:61488400-61488422 CTCTGGGGCAGGAGGGCTCAGGG + Intergenic
1150177061 17:63068967-63068989 ATTTGGGGAGGGATGGAAGAAGG + Intronic
1150271569 17:63869311-63869333 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150275104 17:63892192-63892214 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150277243 17:63906953-63906975 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150295038 17:64002924-64002946 CTCTGGGGAGGGAGGGGGCAAGG + Exonic
1151201816 17:72474136-72474158 CTTTGGGGACGCGGGGAAAAGGG + Intergenic
1151426854 17:74036424-74036446 CTCTTGGGGAGGAGAGAACAGGG - Intergenic
1151629496 17:75300940-75300962 CGTGGGGAAAGGAGGGAAAAAGG - Intergenic
1151841047 17:76617519-76617541 ATTTGGGGAAGGATGGAATGGGG + Intergenic
1152183816 17:78841368-78841390 GTTTGGGGAGGGAGGGATCTGGG + Intronic
1152297017 17:79473751-79473773 CTTTGGGGTGGGAGGGGAGATGG - Intronic
1152789805 17:82273039-82273061 GGTTGGGGAAGGAGGGGATAGGG - Intronic
1154355491 18:13620942-13620964 CTTTAGGGAAGGAGACACCACGG - Intronic
1155150004 18:23115720-23115742 GCTTGGGGAAGGAGGGAATGAGG - Intergenic
1155234920 18:23809707-23809729 CTTGGGGGAGGGAGGAAACTAGG + Intronic
1155311744 18:24531035-24531057 CTTTGAGTCATGAGGGAACAAGG - Intergenic
1155493931 18:26424703-26424725 ATTTGGAGAAGGAGAGGACATGG - Intergenic
1156144309 18:34157841-34157863 CTTTGGGAGAGGTAGGAACAGGG + Intronic
1157012532 18:43668488-43668510 CTTGGGGGAAGATGAGAACAAGG + Intergenic
1157106993 18:44783104-44783126 CTTTGGGAAAAGTGAGAACAGGG - Intronic
1157449368 18:47773739-47773761 CATTGGAGAGGGAGGGAGCAGGG + Intergenic
1157464836 18:47934089-47934111 CACTGGGGAACGAGAGAACATGG - Intergenic
1157465193 18:47937964-47937986 CACTGGGGAATGAGAGAACATGG - Intergenic
1157569812 18:48704873-48704895 GGTTGGGGAAGGAGGAAGCATGG + Intronic
1157636963 18:49168169-49168191 CTCTGAGGAAGGAGGAAAAAGGG + Intronic
1157655462 18:49383400-49383422 CTTTGGGGTATGAGGGAATTTGG - Intronic
1157739111 18:50076326-50076348 GTTTGGGCATGGATGGAACATGG - Intronic
1159634369 18:70787459-70787481 CTGCGGGGAGGGAGGGAGCAGGG + Intergenic
1160053917 18:75461957-75461979 CATTGAGAAAGTAGGGAACATGG + Intergenic
1160735567 19:660877-660899 CTTTGGAGCAGGACGCAACAAGG - Intronic
1160816660 19:1039138-1039160 CTTGGGGGATGGGGGGATCAAGG + Intergenic
1161136783 19:2624742-2624764 CTTCTGGGAAGGAGGGAAGGAGG + Intronic
1161415417 19:4144082-4144104 CGTTGGTGGAGGAGGAAACAGGG - Intergenic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1163128032 19:15254968-15254990 CTTTGGGGAAGGAGGAAAGGCGG - Intronic
1163160929 19:15463864-15463886 TTAGGGGGAAAGAGGGAACAGGG + Intronic
1163386074 19:17001426-17001448 CCTTGGGGGAGAGGGGAACATGG + Intronic
1163508329 19:17720913-17720935 CTGGTGGGAAGGAGGGATCAAGG - Intronic
1163590403 19:18190575-18190597 ATTGGGGGAAGGAAGGAAGAAGG + Intergenic
1165330959 19:35141046-35141068 AAATTGGGAAGGAGGGAACAGGG - Intronic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1166741239 19:45116152-45116174 CTCTTGGGACGGAAGGAACAAGG - Intronic
1166816087 19:45547069-45547091 CTATGGGGAAGGAGGGAGGGAGG + Intronic
1166956473 19:46468760-46468782 TTTGGGGGGAGGGGGGAACAGGG + Intronic
1167782512 19:51608302-51608324 CTTTTGGGAAGGAGAGGCCAGGG + Intergenic
1168057747 19:53872865-53872887 CCTTGGGGAGGGAGGGAAAGAGG + Intronic
1168078802 19:53994372-53994394 ATTTGGGAAAGGAGGGAGTATGG - Intronic
925293989 2:2765918-2765940 GTATGGGGAAGGAGGGGACAGGG - Intergenic
925497559 2:4469223-4469245 CGTTGAGGAAGGAAGGGACAGGG + Intergenic
926171146 2:10553222-10553244 CCTTGGGAATGGAAGGAACAGGG + Intergenic
926370834 2:12177276-12177298 GTGTGGGGAGGGAGGGCACACGG - Intergenic
927388520 2:22564834-22564856 CTATCAGAAAGGAGGGAACAAGG + Intergenic
928035828 2:27822197-27822219 CTATGGCTAAGCAGGGAACAGGG + Intronic
928134749 2:28679870-28679892 CTGTGGGGAAGGAGTCTACAGGG - Intergenic
928378222 2:30796076-30796098 TTTTGGGGAAGAAAGGAAAAGGG - Intronic
928846264 2:35676863-35676885 CTTGGGGGAAAGAGGGCAAAGGG - Intergenic
928891005 2:36202917-36202939 TCTTGAGGAAGGAGAGAACATGG - Intergenic
929202045 2:39245643-39245665 CCTTGGGAAAGAAGGGGACATGG - Intergenic
929632933 2:43484377-43484399 TTTTAGGGAAGAAGGGAATAGGG + Intronic
929689818 2:44064897-44064919 CTTGAGGGAAAGAGGGAACTGGG - Intergenic
930540099 2:52694882-52694904 GGTTGGGGATGGAGAGAACAGGG + Intergenic
930836357 2:55797962-55797984 CTTTGGGGATGTAGGGGAAAGGG + Intergenic
930927590 2:56838208-56838230 CTTTGGGGAAACAGGGGAAAGGG + Intergenic
931232100 2:60383607-60383629 CGTTGGGGAGGGAGGGAACACGG - Intergenic
931588146 2:63851529-63851551 CTTTGGGGATTGAGAGATCAGGG + Intronic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
933047072 2:77552578-77552600 CTTTGGGTAAGGAAAGAACAAGG - Intronic
935503234 2:103868065-103868087 CTTAGAGGAAGGAGGAAAGAGGG + Intergenic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
935848486 2:107193016-107193038 CTGAGGGAAAGGAGGAAACAAGG + Intergenic
936159890 2:110076939-110076961 CTTTTAGGAAGAAGGGAGCATGG - Intergenic
936184774 2:110294414-110294436 CTTTTAGGAAGAAGGGAGCATGG + Intergenic
936427850 2:112435187-112435209 CTTTTGGAAAGGATAGAACAAGG - Intergenic
936865801 2:117075050-117075072 CTATGGGGAAGGAGCAAGCAGGG - Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937835930 2:126470219-126470241 CTTGGCGGATGCAGGGAACAGGG + Intergenic
937893957 2:126963347-126963369 CATTGAGGAAGGATGGGACAGGG + Intergenic
938406181 2:131034642-131034664 CTTTGGGGAGGGATGGGCCAGGG - Intronic
939576663 2:143903443-143903465 CTGTAGGGAAGGAGGGCCCAGGG - Intergenic
939579519 2:143931316-143931338 ATTTGGGGAATGAAGGTACAAGG - Intergenic
939914148 2:148020132-148020154 CTTTGGGGAAGGAGCAGGCAGGG - Intronic
940019974 2:149146395-149146417 CTCTGCGGAAGGATGGAGCATGG + Intronic
940317934 2:152344319-152344341 CTTTGGGGTAGGAAGAAAAAGGG - Intronic
940692913 2:156941769-156941791 GCTTGGGGAAGGAGGAATCAAGG + Intergenic
940890547 2:159031305-159031327 CTGTGGGGAAGGAAGGGCCATGG + Intronic
942026045 2:171911997-171912019 CTTTGGTCAAGGAGGGGCCAAGG + Intronic
942226099 2:173817422-173817444 CTTGGGTGAAGGAGGTAAAAAGG + Intergenic
942462127 2:176175611-176175633 CTTTGGGGAAGGTGGGGATCAGG + Intergenic
943345802 2:186735206-186735228 TTTGGGGGAAGCAGGGGACAGGG + Intronic
943890810 2:193284619-193284641 CTTTGGGGAAGGATGGAAGTGGG - Intergenic
944324946 2:198393164-198393186 CTATTGGGATGGAGGGCACATGG + Intronic
945405380 2:209441475-209441497 CTTTGGAAAAGAAGGGAAAAAGG + Intronic
946318843 2:218936439-218936461 GTTTTGGGAAGGAGGGAATGTGG + Intergenic
947709936 2:232307287-232307309 CTTTAGGAAGGGAGGGAGCATGG + Intronic
947879311 2:233491494-233491516 CTTTGAGGAAGGAGAGAATGTGG - Intronic
948002320 2:234578339-234578361 TTTTGGGGGAGGAGGGACCTAGG - Intergenic
948070028 2:235113731-235113753 CTTCGGGGAAGCAAAGAACAGGG - Intergenic
948288722 2:236808375-236808397 CATTGGAGAGGGAGGGACCACGG - Intergenic
948528366 2:238587424-238587446 CTGTGGGGGAGGGGGGACCAAGG + Intergenic
948875358 2:240824076-240824098 CTCTGGGGAGGGAGGCAGCAAGG - Intergenic
1171423854 20:25037320-25037342 CTCAGGGGAAGGAGGACACAGGG - Intronic
1171797484 20:29577721-29577743 CTTTGGGGGATGGGGAAACAGGG - Intergenic
1171850767 20:30306440-30306462 CTTTGGGGGATGGGGAAACAGGG + Intergenic
1173923222 20:46761601-46761623 CTGTCGGGAAGGAGGGAGCTGGG - Intergenic
1174461248 20:50684502-50684524 CTCTGGGCAAGGTGGGACCAGGG + Intronic
1174716273 20:52762147-52762169 CTTTGGGGAAGAAAGGCACAAGG - Intergenic
1174894355 20:54433166-54433188 TGTTGGGGGAGGAGGGAAGAAGG - Intergenic
1175427752 20:58880134-58880156 GATGGGGGAAGAAGGGAACATGG + Intronic
1175451837 20:59076024-59076046 CTTTGGGGAAGGGGGAGACAAGG - Intergenic
1175869091 20:62199097-62199119 CCTGGGGGAAAGAGGGAAGACGG - Exonic
1176374398 21:6080024-6080046 CTTTTGGAAAGGATAGAACAAGG + Intergenic
1176976245 21:15326162-15326184 CCTTGGGGATGCAGGGCACAGGG - Intergenic
1177905919 21:26970846-26970868 AGCTGGGGAAGGAGGGAAGAAGG - Intergenic
1178337782 21:31759341-31759363 CTTTGAGGCGGGAGGGAAAAAGG - Intergenic
1178711507 21:34921292-34921314 CTGTGGGGGAGGGGGAAACAGGG - Intronic
1178828658 21:36036453-36036475 GTTTGGGGAAGAGGGGAATAGGG - Intronic
1179502407 21:41818471-41818493 CTTTGCGCAAGGACGGCACATGG - Intronic
1179749078 21:43458221-43458243 CTTTTGGAAAGGATAGAACAAGG - Intergenic
1180909374 22:19438165-19438187 CTTGGGGGAAGAGGGGAACAGGG - Intronic
1180951250 22:19721618-19721640 CCTGGGGGAAGGAGGGAGAAAGG - Exonic
1181035843 22:20169394-20169416 CTGGGGGGTAGGAGGGGACAGGG + Intergenic
1181394358 22:22608993-22609015 ATTTGGAGGAGGAGAGAACAAGG + Intergenic
1182411351 22:30189636-30189658 CTCAGGGCAAGGAGGGAGCAAGG - Intergenic
1182881299 22:33735790-33735812 GTTTGAGGAAGGCGGGAATATGG - Intronic
1183405927 22:37630543-37630565 CTTTGGTGATGGAGAGATCAGGG - Intronic
1183420892 22:37710625-37710647 CCTTGGGGAAGGAGTGCAAATGG - Intronic
1184252942 22:43271206-43271228 CTATGAGCAAGGAGGGAGCAGGG - Intronic
1184386866 22:44181571-44181593 GTTTGGGGAAGGCGGGGAGAGGG + Intronic
1184492016 22:44815242-44815264 GTGTGGGGGAGGAGGGAGCATGG + Intronic
1184612349 22:45612862-45612884 CTCTGGGGAAGGAGGAAAACAGG + Intergenic
1184718741 22:46296926-46296948 CTTTGGGTAAGGTGGGGTCAGGG + Exonic
949768729 3:7554907-7554929 CCTTGGGGCAGGAGGCAACTTGG - Intronic
950185574 3:10943379-10943401 CTTTGGGAGAGCAGGGAACCAGG + Intergenic
951202428 3:19890261-19890283 CTTGGGGGAGGGAGGGATTAAGG - Intronic
951794711 3:26525431-26525453 CATAGTGGAAGGAGTGAACACGG + Intergenic
951816257 3:26758455-26758477 CTTTGGAGAGAGACGGAACATGG + Intergenic
952083357 3:29787670-29787692 CTTTGGGGACTCAGGGAAAAAGG + Intronic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952715690 3:36478186-36478208 CTTTGTGGAAGGTGACAACAAGG - Intronic
954423289 3:50430110-50430132 GTTTGAGGAAGGAGGCAAAAGGG + Intronic
954638488 3:52084572-52084594 CTTAGGGGCAGGAAAGAACAAGG + Intronic
955169154 3:56546287-56546309 CAGTGGGGAAGGAGTAAACAAGG + Intergenic
955527447 3:59836013-59836035 CTATGGGGAGTGAGGGAAAATGG - Intronic
956022978 3:64951756-64951778 CTTTGGGGAAGCTGAGAAGAAGG + Intergenic
956515492 3:70042017-70042039 CTTTTTTGAAGGAGGGAAGATGG + Intergenic
956608858 3:71101404-71101426 CTTGGGGGAAAGAGTGAACTTGG + Intronic
956852956 3:73247987-73248009 CCTAGGGGAAGCTGGGAACATGG + Intergenic
957571272 3:81949999-81950021 CTTTGAGGAAGGAGAGAAAAAGG - Intergenic
958761954 3:98319892-98319914 CTTTGGGATAGTAGAGAACATGG + Intergenic
958859241 3:99425445-99425467 CTTTTGGGAATGAAGGAACTGGG - Intergenic
958912196 3:100006388-100006410 TTATGGGGAAGGAGGAAAAAAGG - Intronic
959202193 3:103261433-103261455 GTTTGGGCTAGGAGGAAACAAGG - Intergenic
960314049 3:116154660-116154682 CCTTGGAGAAGAAGGGAGCAAGG - Intronic
960886130 3:122396944-122396966 GTTGGGGGAAGGAGGAAACAGGG + Intronic
960904700 3:122588730-122588752 GTTTGGGGGAGGAGGAAATAAGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961472773 3:127126879-127126901 CTTTGTGGGAGAAGGGAAGAGGG - Intergenic
961611706 3:128144829-128144851 ATGGGGGGAAGGAGGGACCAGGG - Intronic
961635737 3:128331301-128331323 CATTGAGGAAGGGGGGAAGAAGG - Intronic
961734004 3:128989259-128989281 CTTAGGGCCAGGAGGGACCAGGG - Intronic
961812634 3:129530732-129530754 CCTTGGGGAAGGAGAGAGCTTGG - Intronic
962031928 3:131610105-131610127 ATTTGTGAAAGGAGGGAAAAAGG - Intronic
962385473 3:134929097-134929119 CTTGGTAGACGGAGGGAACAAGG + Intronic
962498847 3:135968474-135968496 CCTTGAGGAAGAAAGGAACAGGG + Intronic
962695351 3:137942290-137942312 CTTTGGGGAAAGAGCTATCATGG - Intergenic
962894328 3:139700317-139700339 CTTTGGGGAAGGTGGGATGCAGG + Intergenic
963138415 3:141928689-141928711 CTCTCGGGCAGGAGGGAACTGGG + Intergenic
963269679 3:143273431-143273453 CTTTGTGGAAGGTGGGAAGAGGG - Intronic
963732045 3:148984451-148984473 CTTTGAGGAAGGAGAGGAGAGGG - Intergenic
964546127 3:157835563-157835585 CTTTGGGCAAGAGGGGAACTAGG - Intergenic
966220943 3:177550472-177550494 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
966792129 3:183682949-183682971 TTTTGGGGAAGGGGGGAGAACGG + Exonic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
966955779 3:184877079-184877101 CTCTGGGTAAAGAGAGAACAGGG - Intronic
967996761 3:195172816-195172838 ATTTGGGGAAAGAGGGCAAAGGG + Intronic
968887220 4:3341335-3341357 GTATGGGGGAGGAGGGGACAAGG + Intronic
968911642 4:3479532-3479554 CCCTGGGGAAGGAGGGAATGTGG - Intronic
969546635 4:7834342-7834364 CTTTGGGGATTCAGGGAAAAAGG + Intronic
969695318 4:8730925-8730947 GTGTGGGGAGGGAGGGAACCTGG + Intergenic
969746962 4:9080148-9080170 CTCTGGGGCTGGAGGGAGCAGGG - Intergenic
972672363 4:41225946-41225968 CTTGGGGGAAGGGGGGAATAGGG + Intergenic
972805689 4:42527919-42527941 CTCTGGGGAAGGATGGGAGAAGG - Intronic
973050542 4:45590515-45590537 CTTTGGAAAAGCAGAGAACAAGG + Intergenic
974800269 4:66808396-66808418 CTCTGTGGAAGGAGGGAGCATGG - Intergenic
975369598 4:73569057-73569079 CTTGGGAGAAGGAGAGCACAAGG - Intergenic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
976708211 4:88041204-88041226 GTTGGGGCAAGGAGGAAACATGG - Intronic
977637788 4:99320205-99320227 CTTTGGGGACTGAGGGAAAAGGG - Intronic
977845452 4:101761760-101761782 ATCTGGGGAAGGGGTGAACAGGG - Intronic
978072789 4:104492236-104492258 CTGTGGGGAGGGAGGGAGCGGGG - Intronic
978990492 4:115076080-115076102 TTGTTGGGAAAGAGGGAACAAGG - Exonic
980569731 4:134598675-134598697 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
980586383 4:134821948-134821970 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
980701737 4:136441807-136441829 CCTTGGGGATGCAGGGTACAGGG - Intergenic
982128552 4:152205897-152205919 CTTTGGGGAAGTGGGGACTAAGG - Intergenic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
982640937 4:157959602-157959624 CCTTAGGGGAGGAGGGACCAAGG - Intergenic
983406165 4:167334097-167334119 ATTTGGGGAAGAATGGATCAGGG - Intergenic
983587195 4:169368648-169368670 TTTTGGGGAATCAGGGGACAGGG - Intergenic
984849461 4:184141426-184141448 CTGTGGGGAAGGCGGCAACAAGG + Intronic
986259485 5:6131782-6131804 CTTTGGGGACTGAGGGGAAAGGG + Intergenic
986340462 5:6784695-6784717 CTTTAGAGAAGGAGGGAGCCAGG + Intergenic
986399833 5:7370119-7370141 CTTTGGGAGAGGAAGGAACTTGG + Intergenic
987698479 5:21363425-21363447 CTTTTGGGAAGGTAGGAAGATGG - Intergenic
987734219 5:21818519-21818541 TCTGGGGGAAGGAGGGAAGAAGG - Intronic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
988900633 5:35728652-35728674 CTTTGGCGAGGGTAGGAACATGG + Intronic
989380383 5:40804388-40804410 CATGGGGGATGGAGGGAACTTGG + Intergenic
989777710 5:45229214-45229236 CTTTGAGGAAGATGGGAGCAGGG - Intergenic
989985228 5:50689495-50689517 TTTCAGGGAAGGAGGGAAAATGG + Intronic
990112844 5:52349273-52349295 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
990714273 5:58619245-58619267 CTTTGGGGAATGATGGAGCAGGG - Intronic
991367845 5:65887427-65887449 CATTTGGCAAGGAGGTAACAAGG + Intergenic
992535864 5:77702720-77702742 CATTGGGGAAGGAAGGATGAAGG + Intronic
993543531 5:89182518-89182540 TCTAGGGAAAGGAGGGAACAGGG - Intergenic
993893447 5:93502989-93503011 CTATGGGAAAGGAGAGAAAAGGG + Intergenic
994753589 5:103767803-103767825 CATTTGTGAAGGAGGGAAGAGGG - Intergenic
995131767 5:108638079-108638101 TAGGGGGGAAGGAGGGAACATGG + Intergenic
996088246 5:119325806-119325828 TTCAGGGGAAGGAGGGGACAGGG - Intronic
996698638 5:126425862-126425884 GGGTGGGGAAGGAGGGAATAGGG + Intronic
996870205 5:128182370-128182392 TTTTGGGGAAAGAAGGAACTGGG - Intronic
997873884 5:137531050-137531072 TGTTGGGGAAGGAGGTAATATGG + Intronic
998474577 5:142409437-142409459 CTGTGGGGAAGGCGGGGACCAGG + Intergenic
998778865 5:145633903-145633925 CTATGGGAATGCAGGGAACATGG - Intronic
998788054 5:145733974-145733996 CTATGGGGAAGGACTGAAGATGG + Intronic
999242574 5:150136364-150136386 CTTTTGGGCTGGAGGGAACTGGG + Intronic
999742467 5:154566624-154566646 CTGTATGGAAGGAGGGAACTTGG - Intergenic
1000168342 5:158677301-158677323 CCTTGGGGCAGGAGGGAGGAAGG - Intergenic
1000275510 5:159731236-159731258 CCTAGGGGAAGGAGGGAAGGAGG + Intergenic
1000283048 5:159798857-159798879 CTTGGGAGAAGGAGGGAGAAGGG - Intergenic
1001442138 5:171751132-171751154 CTAAGAGGAAGGAGGGATCATGG - Intergenic
1002270220 5:178066938-178066960 CTTTGTGGAAGGAGGGAAGGAGG + Intergenic
1002426289 5:179178191-179178213 GCTTGGGGAAGGCCGGAACAGGG + Intronic
1003130379 6:3390391-3390413 CTTTGGGGAGGGAGGAGAGAGGG - Intronic
1003252249 6:4440304-4440326 CTTTGGGGACTCAGGGAAAAAGG - Intergenic
1003616797 6:7661649-7661671 AGTAGGGGAAGGAGTGAACAGGG - Intergenic
1004785168 6:18960531-18960553 CTTTGGGGAGAGAGAGAAAAAGG - Intergenic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005473743 6:26187272-26187294 ACTTGGGGAAGAAGGTAACATGG + Intergenic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006450964 6:34105499-34105521 CTGAGAGGAAGGAGGGGACAAGG - Intronic
1006871571 6:37256820-37256842 ATTTGGGGAAAGAGGGAAGGCGG - Intronic
1007499909 6:42288757-42288779 CTCTGTGGCAGGTGGGAACAAGG + Intronic
1008050772 6:46898479-46898501 CTTCAGGGAAGGAGGGAGAAAGG + Intronic
1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG + Intronic
1008857065 6:56101481-56101503 CTCCGGGGCAGGATGGAACACGG - Exonic
1009478149 6:64121062-64121084 CTATGGGGGAGGGGGGCACATGG - Intronic
1009979934 6:70715891-70715913 CTTTGGGGACTGGGGGAAAAGGG - Intronic
1010366815 6:75060602-75060624 CTAGGGGGAAGGAAGGAAAAAGG - Intergenic
1011114441 6:83874703-83874725 CCTTGGGGAAGAAGCGATCAGGG - Intronic
1011220254 6:85047617-85047639 CTTTGGGGACTAAAGGAACAGGG + Intergenic
1011451917 6:87502113-87502135 AATTGGGGAAGGAGGGGACCTGG - Intronic
1012052634 6:94362622-94362644 CTCTGGGGATGCAGGGCACAGGG + Intergenic
1012171075 6:96016641-96016663 CTTTGGGAAAGGAGAGAAGGTGG - Intronic
1012381028 6:98619709-98619731 CTTGTGGGAAGGAGAGAACTTGG - Intergenic
1012433734 6:99192933-99192955 CTTTGGTGAAAGAAGGAAGAAGG - Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1012865665 6:104615304-104615326 CCTTGGTGAAGGAGAAAACAGGG + Intergenic
1013591190 6:111620694-111620716 CTTGGGGGAACGAAGGAAGAAGG - Intergenic
1014419920 6:121230945-121230967 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1014759986 6:125345811-125345833 GTTTGGGAGAGCAGGGAACAGGG + Intergenic
1014931027 6:127336463-127336485 CTTTGGGAAAGCAGGGAAATAGG - Intronic
1015021988 6:128487531-128487553 CTTTAGGGAAGGATGGAGAAGGG - Intronic
1015296751 6:131603586-131603608 CTTGGGGGTAGGAGGAAACAAGG - Intronic
1015402523 6:132802224-132802246 CTTTGGGGAACCAGGGCAGATGG - Intergenic
1015980276 6:138831418-138831440 CTATGGAGAAAGAGGGAAGAGGG - Intronic
1016100826 6:140098015-140098037 TGTTGGGGAAGGAGGGAGCAAGG - Intergenic
1016411407 6:143787319-143787341 CTTTGGGGCAGGTGGAAATAAGG - Intronic
1018425317 6:163674715-163674737 TTTTGGGGACGGATGGCACAAGG + Intergenic
1018835753 6:167482479-167482501 TTTTGGGGAAGGAGGACACCAGG + Intergenic
1018881615 6:167888018-167888040 AGTTGGGGCAGGAGGGATCATGG + Intronic
1019272338 7:157189-157211 CTGGAGGGAAGGAGGGGACAGGG + Intergenic
1019343862 7:520360-520382 CTTTGGGGAAGGAGGGGGGCGGG + Intergenic
1019859781 7:3646944-3646966 CTTGGGGGAAGGAGGGAGTGGGG + Intronic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020138000 7:5597127-5597149 CTTCGGCCAAGGAGGGAAGATGG + Intronic
1020326489 7:6978417-6978439 CTCTGGGGCTGGAGGGAGCAGGG + Intergenic
1020635383 7:10690611-10690633 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1020732304 7:11895944-11895966 CTTCCGGTAAGGAGGGAACTTGG + Intergenic
1021097029 7:16547014-16547036 CCTTGGGGATGCAGGGCACAGGG - Intronic
1021472737 7:21024326-21024348 AGGTGGGGAAGGAGGGAATAGGG - Intergenic
1021848712 7:24787257-24787279 CACAGGGGAAGGAGGGAACATGG + Intergenic
1022520951 7:31006600-31006622 CTCTGAGGCAGGAGGGAAAAGGG - Intergenic
1023225989 7:37969579-37969601 CTCTGCGATAGGAGGGAACATGG + Intronic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1025708996 7:63890757-63890779 ATTTGGGGAACGATGGGACAGGG + Intergenic
1025857347 7:65293828-65293850 CTTTGGGGAATTAGGGCAAAGGG - Intergenic
1026102716 7:67396188-67396210 CCTGGGGGAAGGAGGGAAGCTGG - Intergenic
1026566874 7:71496554-71496576 CTTCGGGGAAGGAGGGCAGGTGG - Intronic
1026833287 7:73622988-73623010 ATTTGGGGAGGGAGGGAGAAGGG + Intronic
1027036917 7:74931775-74931797 CTTGGGGGAAGGGGGGATCCAGG + Intergenic
1028064194 7:86361063-86361085 CATCAGGGAAGGAGGGAACAAGG + Intergenic
1028619899 7:92813748-92813770 TTTTGGGGAGGGGAGGAACATGG + Intronic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029423107 7:100481671-100481693 GTCTGGGGAAGGAGGGACCAAGG - Intergenic
1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG + Intronic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1030874229 7:114793376-114793398 CTGTGAGGAAGAAAGGAACAAGG + Intergenic
1031089990 7:117342886-117342908 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1031614353 7:123863868-123863890 CTTTGGGGAAGGAGTGAGAAGGG + Intronic
1031836231 7:126685041-126685063 CCTTGGGGACGCAGGGCACAGGG - Intronic
1032271173 7:130408083-130408105 CCTTGGGGAAGGAGGCAGGAGGG - Intronic
1032358342 7:131230713-131230735 CTGTAGGGAAGGAAGGCACAGGG - Intronic
1033452697 7:141475710-141475732 CTTAGGGGCAGGATGGAGCAGGG + Exonic
1034062754 7:148108089-148108111 CTCTGGGGAGGGAGGAGACAGGG + Intronic
1034113301 7:148559386-148559408 CTATGGGGAAGAAGGGAATAGGG - Intergenic
1035781189 8:2229411-2229433 CTGTGGGGAAGGAGGCTGCAAGG - Intergenic
1036687051 8:10918739-10918761 CTTTGGGGAAGCAGGGATTGGGG - Intronic
1036794152 8:11743238-11743260 CTTTGGGCAAGGAGTTAGCATGG + Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037087878 8:14875463-14875485 CTTTGGATAAGGAAGGGACAAGG + Intronic
1037307872 8:17524642-17524664 CTTTGGGGAATCAGGGGAAAGGG + Intronic
1037386479 8:18347855-18347877 CTTGGGGGAAGGAGTGGAAAGGG + Intergenic
1037403785 8:18520494-18520516 GTTTTTGGAAGGTGGGAACAGGG - Intergenic
1037656561 8:20888735-20888757 ATTTTGGAAAAGAGGGAACAAGG + Intergenic
1037836883 8:22219871-22219893 GTGTGGAGAAGGAGAGAACATGG - Exonic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038656709 8:29459407-29459429 TTTTGGGAAAGTGGGGAACATGG + Intergenic
1038892446 8:31741213-31741235 CTTAGGGGCAGGAGGGAACAGGG + Intronic
1039415105 8:37386666-37386688 CTTTGGGAAAGGTGGGAAGCTGG - Intergenic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1039978017 8:42383597-42383619 CTTTGAGGAAGGAGGGTCCAGGG - Intergenic
1041225784 8:55696916-55696938 TTTTGGGGAAGGTGGTAACATGG + Intronic
1042856189 8:73270540-73270562 CTTTCAGGAAGGAGGGGAGATGG + Intergenic
1042970499 8:74402688-74402710 CTTTGGGGAAGGAGCCAAGATGG - Intronic
1043134128 8:76500311-76500333 CCTTGGGCCTGGAGGGAACATGG - Intergenic
1043379142 8:79684132-79684154 ACTTGGGGAAGTGGGGAACATGG - Intergenic
1043541282 8:81265676-81265698 CTTTTGGGAAGGAGAGAAGGAGG - Intergenic
1043691621 8:83160474-83160496 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1044847808 8:96399101-96399123 TTCTGGGGAAGGAGGAAACTGGG - Intergenic
1045271466 8:100665431-100665453 ATTTTGGGAAGAAGGGAAAACGG - Intergenic
1045356631 8:101395252-101395274 GTTTGGGGAACGGGGGAAAATGG - Intergenic
1045712206 8:104998056-104998078 CTTTGGGGAAGGATGCCAGAAGG + Intronic
1046816954 8:118595792-118595814 CTGTGGGGAAGGAGGAAAAGAGG - Intronic
1047661579 8:127043037-127043059 CCTTGTGGTGGGAGGGAACATGG - Intergenic
1047941209 8:129829210-129829232 CTCAGGGGAAGGAGGGAGCAGGG - Intergenic
1047943566 8:129851259-129851281 CATGGAGGAGGGAGGGAACATGG + Intronic
1048300306 8:133246358-133246380 CTTTGGGGATAGAGGGACCAGGG - Intronic
1048367543 8:133751630-133751652 GGTTGGGCAAGGAGGAAACAGGG - Intergenic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1049310140 8:141929514-141929536 TTTGGGGGAAGGATGGAGCAGGG - Intergenic
1049440642 8:142608008-142608030 CGTTTGGGAAGGAGGGAGGAAGG - Intergenic
1050255906 9:3791581-3791603 TATTGGGAAAGGTGGGAACAAGG - Intergenic
1050441550 9:5669290-5669312 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1050696613 9:8286273-8286295 TGTTGGGGAAGGAGGGAATAAGG - Intergenic
1051694581 9:19754293-19754315 CCTTGGGGAAGGAGGATAGACGG - Intronic
1052219535 9:26002637-26002659 CTTTGGGGACTTAGGGAAAAGGG + Intergenic
1052733396 9:32315651-32315673 GTTGGGGGAAGAAGGGAAGAAGG + Intergenic
1052996465 9:34553902-34553924 CTCGGGGGAAGGTTGGAACAGGG - Intronic
1053381825 9:37655178-37655200 ATTTCAGTAAGGAGGGAACAAGG - Intronic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1053788546 9:41669732-41669754 CTTTGGGGGATGGGGAAACAGGG + Intergenic
1054156593 9:61645036-61645058 CTTTGGGGGATGGGGAAACAGGG - Intergenic
1054176831 9:61881071-61881093 CTTTGGGGGATGGGGAAACAGGG + Intergenic
1054660704 9:67699735-67699757 CTTTGGGGGATGGGGAAACAGGG - Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1054715178 9:68550305-68550327 CCTTTAGGAGGGAGGGAACAGGG + Intergenic
1054930717 9:70632316-70632338 GTTTGGGGAAGAAGTGAATAAGG - Intronic
1054998017 9:71414403-71414425 CTTTGTGAAAGGAAGGAAAAAGG - Intronic
1055343336 9:75308702-75308724 CAGTGGGGAGGGATGGAACAGGG + Intergenic
1055910963 9:81350641-81350663 CTTTGGGGAGGGAGAGTGCAGGG + Intergenic
1057231449 9:93324079-93324101 ATTTGGGAAATGAGGGGACAAGG - Intronic
1057469161 9:95342409-95342431 CTGGGGGGAAGGAGGTAACTAGG + Intergenic
1058219830 9:102284792-102284814 CTTTGGGGATTGAGGGGAAAAGG + Intergenic
1059294041 9:113253884-113253906 CTATGGGGTAGGAGTTAACAAGG + Intronic
1060508669 9:124216691-124216713 CTGTGGGGAAGGGGTGCACAGGG + Intergenic
1060519604 9:124286940-124286962 CTTTCGGGCAGGAAGGAAGAGGG - Intronic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1061275707 9:129568674-129568696 CCCCGGGGAAGGAGGGACCAGGG - Intergenic
1061533217 9:131230810-131230832 CTTTGGGGGAGAAGGCAAGAGGG - Intronic
1061970507 9:134042242-134042264 CTTTGGGCCAGGAGGCTACAAGG - Intronic
1062531932 9:137005600-137005622 CTTGGGGGAAGGAGGCTGCAGGG + Intergenic
1186712734 X:12217047-12217069 GTTTGTGAAAGGAGGGAACCAGG + Intronic
1186897638 X:14020359-14020381 CTTTGGGGAAGAAGCGCAGAAGG + Exonic
1187466462 X:19531960-19531982 CTATGGGGTGGGTGGGAACAGGG + Intergenic
1188450493 X:30303337-30303359 CCTTGGGGAAGGAGGCACCTCGG + Intergenic
1189150746 X:38703798-38703820 CTTTGGGGAAGAAGAAAAGAAGG + Intergenic
1189180448 X:38999596-38999618 GTTTGTGGAAGTAGGGAAGAGGG - Intergenic
1189381815 X:40507533-40507555 ATTTGGGGAAGCAAGGAAAAAGG - Intergenic
1189780208 X:44506763-44506785 CGCTGGGGAAGGAGGGAAAGGGG + Intergenic
1190462883 X:50696119-50696141 CTTTGAGGAAGGAGGCAACATGG + Intronic
1190734698 X:53248569-53248591 CTTTGGGGCAGAAGGGTACAGGG + Intronic
1191629187 X:63302735-63302757 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1191869214 X:65731289-65731311 TGTTGGAGAAAGAGGGAACAGGG + Intronic
1192220025 X:69191601-69191623 CTTTTTGGCAGGAGGGAACATGG - Intergenic
1192902884 X:75519039-75519061 ACTTGGGGGAAGAGGGAACAGGG + Intronic
1192943808 X:75942561-75942583 CTTGGGGGAATGGGGGAAGATGG - Intergenic
1193088012 X:77464888-77464910 CTTTGGGGACTGAGGGGAAAGGG + Intergenic
1194104128 X:89747347-89747369 CTTTGGGGACTGAGGGGAAAGGG - Intergenic
1194885923 X:99316134-99316156 CTTTAAGGCAGGAGGGAACATGG - Intergenic
1195282472 X:103349162-103349184 TTTTGGGGAAGGTTAGAACAGGG - Intergenic
1195411195 X:104568688-104568710 CTTTGGGGAAGCCGGAAGCATGG - Intronic
1196384959 X:115139682-115139704 CTTGGGGGAGGGAGAGCACAGGG + Intronic
1196707047 X:118726001-118726023 CTTTTGGGAGGGAAGGAGCAAGG - Intergenic
1198092730 X:133347726-133347748 CTTTTTGGAAGGAGGGAGGATGG - Intronic
1198332741 X:135636799-135636821 TGTTGGGGAAGGTGGGGACAAGG - Intergenic
1199411167 X:147525195-147525217 CTTTGGTGGAGGTGGGAAGAGGG - Intergenic
1199910056 X:152276913-152276935 CTTTGAGGAGGGAGGGAAACAGG + Intronic
1201550080 Y:15210281-15210303 ATGAAGGGAAGGAGGGAACAAGG + Intergenic