ID: 1106288132

View in Genome Browser
Species Human (GRCh38)
Location 13:28336019-28336041
Sequence TTTTCTTTTTAGATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1090
Summary {0: 1, 1: 0, 2: 8, 3: 86, 4: 995}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106288132 Original CRISPR TTTTCTTTTTAGATGGTGGA AGG (reversed) Intronic
900011633 1:116236-116258 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
900027738 1:292802-292824 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
900041693 1:472243-472265 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
900063128 1:707221-707243 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
900510766 1:3059813-3059835 TTTTCATTTTAGAGGATGGAAGG - Intergenic
901417324 1:9126816-9126838 TTTTCTTTTAAGATGCAGGCAGG + Intronic
901549949 1:9988739-9988761 TTTTTTTTTGAGATGGTCGCAGG + Intergenic
901551672 1:9999827-9999849 TTTTTTTTTTAGATGGAGTCTGG + Intronic
901622785 1:10602201-10602223 TTTTATTTTTAGGGGCTGGAAGG - Intronic
901694120 1:10993861-10993883 TTTTCTTTTGAGATGGAGTCTGG - Intergenic
902042317 1:13501930-13501952 TTTTTTTTTTTGGTGGGGGATGG + Intronic
902169926 1:14601438-14601460 TTTTTTTTTTTGATGGGGGCGGG + Intronic
902281101 1:15375160-15375182 TTTTCTTATTTCATGGTGGCTGG + Intronic
902638702 1:17752031-17752053 TTTTCTTTTTCACTGGTGCAAGG - Intergenic
902968886 1:20032356-20032378 TTTTTTTTTTTGATGGTGGTAGG + Intronic
903013531 1:20347162-20347184 TTTTCTATTTTTATGCTGGATGG - Intronic
903187519 1:21637153-21637175 TTTTTTTTTTTGGTGGTGGTTGG + Intronic
903441377 1:23390465-23390487 TTTTCTTTTGAGATGGAGTCTGG - Intronic
903565535 1:24262549-24262571 TGTTCTTTGAAGATGGAGGAAGG - Intergenic
903790052 1:25886591-25886613 TTTTTTTTTTTGGTGGGGGATGG + Intronic
903868303 1:26413836-26413858 TTTTTTTTTGAGATGGTGTTTGG + Intronic
903948502 1:26979749-26979771 TTTTTTTTTGAGATGGAGAATGG - Intergenic
904649789 1:31996375-31996397 TTTTCTTTTTCGTTGGGGGTGGG - Intergenic
904716011 1:32468109-32468131 TTATTTTTTGAGATGGGGGATGG - Intronic
905555324 1:38878075-38878097 TTTTCTTTTTTTTTGGTGGGGGG + Intronic
905570119 1:38997098-38997120 TTTTTTTTTTTAATGGTGGGAGG - Intronic
905618124 1:39415337-39415359 TTTTTTTTTTAGATGGAGTCTGG + Exonic
905759339 1:40541197-40541219 TTTTTTTTTTGGAGGGGGGAAGG + Intronic
905854562 1:41300076-41300098 TTTTCTTTTTTTGTGGGGGAGGG + Intergenic
906031304 1:42722481-42722503 TTTTTTTTTTTAATGGGGGATGG - Intergenic
906433260 1:45773336-45773358 TTTTTTTTTTAAATGGAGTAAGG - Intergenic
906927673 1:50136553-50136575 TTTTCTTTTACCATGTTGGAAGG - Intronic
907012889 1:50979189-50979211 TTTTGTTTTTATTTGGTGGTGGG - Intergenic
907234323 1:53031125-53031147 TTTTTTTTTTAGATGGAATAGGG - Intronic
908056908 1:60297690-60297712 TCTTCTATTGAGATGATGGAGGG + Intergenic
908091932 1:60695602-60695624 TTTTATTTTGAGATGGTTGTTGG - Intergenic
908361714 1:63374680-63374702 TTTTCTTTTTTAATAGTGCAGGG + Intronic
908433879 1:64085776-64085798 TTTTTTTTTAAGTTGGGGGAGGG + Intronic
908633821 1:66139724-66139746 TTTTTTTTTTTGAGGGGGGAGGG - Intronic
909093770 1:71260836-71260858 TCGTCTTTTTAGCTGGTGGAGGG + Intergenic
909709048 1:78623417-78623439 TTTTTTTTTTAAATCATGGAAGG + Intronic
909762752 1:79313046-79313068 TTTCTTTTTTAAATGGAGGATGG - Intergenic
910399825 1:86827339-86827361 TTGTATTCTTACATGGTGGAAGG - Intergenic
910432386 1:87171947-87171969 TTTTTTTTTAAGAGGGTGGGTGG - Intergenic
910704223 1:90109666-90109688 TTTGCTTTTTAGAGAGTGGAGGG + Intergenic
910787645 1:91017955-91017977 CTTTCTTTTTGGTTGGGGGACGG - Intronic
910867349 1:91800637-91800659 TTTTCTTTTTCAATCTTGGAGGG - Intronic
910870229 1:91826733-91826755 TTTTTTTTTTTAATAGTGGATGG - Intronic
911108176 1:94154274-94154296 TTTTCTTTTTAAATGACGAATGG + Intronic
911114516 1:94232937-94232959 TTTTTTTTTTGGAGGGGGGAAGG + Intronic
911240748 1:95463100-95463122 TATTTTTTTTTGTTGGTGGAAGG + Intergenic
911332453 1:96541051-96541073 TTTTCTTTATTGTTGGTTGATGG + Intergenic
911740310 1:101379789-101379811 TTTGCTTTGAAGATGGAGGAAGG - Intergenic
912010965 1:104962063-104962085 TTTTCTTGATAGATGGGAGATGG + Intergenic
912022538 1:105123150-105123172 TATTATCTTTATATGGTGGAAGG + Intergenic
912264722 1:108145579-108145601 TTTTTTTTTTATAAGGTGTAAGG + Intronic
912918412 1:113841599-113841621 TTTTTTTTTTTTTTGGTGGAGGG + Intronic
913308144 1:117453966-117453988 TACTCTTTTTTGATGGTGGAGGG - Intronic
913310955 1:117492332-117492354 TACTCTTTTTTGATGGTGGAGGG - Intronic
914678393 1:149921314-149921336 TTTTCTTTTTTTAAGGTGGGAGG + Intergenic
916347701 1:163812705-163812727 TTATCTTCTAAGATGTTGGAGGG - Intergenic
916462082 1:165035422-165035444 TTTTCTTTGTAAATCGTGAAAGG + Intergenic
916648224 1:166810123-166810145 GTTTTTTTTTATATGGTGAAAGG - Intergenic
916850479 1:168698111-168698133 TTTTCAGTTTAGAAGCTGGATGG - Intronic
917113521 1:171577787-171577809 TTTTTTTTTGAGATGGTGTCTGG + Intronic
917330580 1:173876327-173876349 TTTTTTTTTTAGATGGAGTCTGG + Intronic
917490008 1:175490198-175490220 TTAATTTTTTATATGGTGGAAGG - Intronic
917695898 1:177523728-177523750 TTCTCCCTTTAGTTGGTGGATGG + Intergenic
917696339 1:177528173-177528195 TTTTCTTTTTTGGTGGGGTAAGG - Intergenic
917877009 1:179294949-179294971 TTTTCTTTTTAAAAGTTGGGCGG + Intronic
919258823 1:195162642-195162664 TTTTTTTTTTAGTGGGGGGAGGG + Intergenic
919271204 1:195348683-195348705 TTTTTTTTTTTTTTGGTGGATGG - Intergenic
919517537 1:198545628-198545650 TTTTCTTTTTACATGCTGGTAGG - Intergenic
920405350 1:205705090-205705112 TTTTCTTTTTAGAAAGAGGAAGG + Intergenic
920832704 1:209479691-209479713 TTTGTTTTTTACAAGGTGGAAGG - Intergenic
920925562 1:210338172-210338194 TTTTTTTTTTAAATGGGGGCGGG - Intronic
921071452 1:211661623-211661645 TTTTCATTTTGGCTAGTGGACGG - Intronic
921405090 1:214770048-214770070 TTTTTTTTTTTGCTGGTGTAGGG - Intergenic
921607258 1:217170334-217170356 TTTTTTTTTGAGATGGTGTCTGG + Intergenic
922020236 1:221697089-221697111 ATTTTATATTAGATGGTGGATGG - Intergenic
922260069 1:223932246-223932268 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
922415196 1:225415322-225415344 TTTTCTTTTAAGGTTGTAGAAGG - Exonic
923124564 1:231023632-231023654 TTTTCTTTTCACATAGAGGAGGG - Intronic
923311314 1:232738170-232738192 TTTTCTTTTTAAATTCTGAATGG + Intergenic
923581967 1:235226531-235226553 TTTTTTTTTTAGATGGAGTCTGG + Intronic
923750049 1:236739235-236739257 TTTTTTTTTTAACTGGGGGAGGG + Intronic
923901929 1:238335592-238335614 TTCTGTTTTTAAAAGGTGGAGGG - Intergenic
923945042 1:238875504-238875526 TTTTTTTTTTTGGTGGTGGCTGG + Intergenic
923969619 1:239185289-239185311 TCATCTTTTTATAAGGTGGATGG + Intergenic
924064683 1:240209253-240209275 TTTTTTTTTTGGAGGGGGGACGG + Intronic
924163999 1:241263263-241263285 TTTTCTTTTGAGATGGAGTCTGG - Intronic
924181915 1:241447316-241447338 TTTTTTTTTTAGTTGGGGGGTGG + Intergenic
924341237 1:243034805-243034827 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
924488264 1:244508974-244508996 TTTTTTTTTTTGGTGGGGGAAGG - Intronic
1063421184 10:5913641-5913663 TTTTCTTTTTAGAAATGGGAAGG + Intronic
1063566761 10:7177956-7177978 TTCTCTTTTTGGCTTGTGGATGG - Intronic
1064354016 10:14601833-14601855 TTTTCTTTGGGAATGGTGGAGGG - Intronic
1064447972 10:15413231-15413253 TTTTTTTTTTTGGTGGGGGATGG - Intergenic
1064608857 10:17075848-17075870 TTTTTTTATTAGATGCTGAAGGG - Intronic
1065085820 10:22174966-22174988 TTTTCTTTTTACTTAGGGGAGGG + Intergenic
1065161394 10:22926540-22926562 TTTGCTTTTTAGATGAGGCATGG + Intergenic
1065616395 10:27529641-27529663 TTTTATTTTCTGATGGGGGAAGG - Intronic
1065817818 10:29498080-29498102 TTTTTTTTTTTTTTGGTGGAGGG - Intronic
1066039967 10:31539274-31539296 TTTTTTTTGTATATGGTGTACGG + Intergenic
1066232258 10:33447493-33447515 TTTTTTTTTGAGATGGTGTCTGG - Intergenic
1066683593 10:37959619-37959641 TTTTCTTTTGAGATGGAGTCTGG + Intronic
1066735238 10:38470629-38470651 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
1067010358 10:42706275-42706297 TTTTCATTTGATAGGGTGGAGGG + Intergenic
1067196698 10:44126020-44126042 CTTTCTTAATAGATGGAGGAGGG + Intergenic
1067312433 10:45126733-45126755 TTTTCATTTAATAGGGTGGAGGG - Intergenic
1067313392 10:45137296-45137318 TTTTCATTTGATAGGGTGGAGGG - Intergenic
1067434127 10:46265328-46265350 TTTTTTTTTTGCAAGGTGGATGG + Intergenic
1067439570 10:46301006-46301028 TTTTTTTTTTTCAAGGTGGATGG - Intronic
1068283027 10:54901139-54901161 TTTTTTGTAGAGATGGTGGAGGG - Intronic
1068482440 10:57609832-57609854 TTTTTTTTTTTGCTAGTGGAAGG - Intergenic
1068582510 10:58758057-58758079 TTTTTTTTTAAGATAGTAGAAGG - Intronic
1068953113 10:62797711-62797733 TTTTTTTTTTTAATGCTGGAAGG + Intergenic
1069018726 10:63462671-63462693 TTGGCTTTTAAGATGGAGGAAGG + Intronic
1069180778 10:65355600-65355622 TTTTCTTTTTACAGAGAGGATGG - Intergenic
1069335951 10:67350599-67350621 TTTTCTTTGTTGTTGGTGGTGGG - Intronic
1069783070 10:70969114-70969136 TTTTCTTTATTGATAGTGGCTGG + Intergenic
1069973267 10:72191600-72191622 TTTTCTTTTTAGAATGTTTATGG - Intronic
1070183485 10:74037266-74037288 TTTTCTGTTTTGATGGTGACAGG + Intronic
1070294179 10:75145106-75145128 TTTTTTGTTGAGATGGTGCAGGG + Intronic
1070309585 10:75263527-75263549 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1070471501 10:76784934-76784956 TTTTCAAGTTAGTTGGTGGATGG - Intergenic
1071033284 10:81210819-81210841 TTTTATTTTTAGTTTGTCGATGG - Intergenic
1071144168 10:82548049-82548071 TTTTTTTTTTAAATCATGGAAGG + Intronic
1071384118 10:85102436-85102458 TTTTTTTTTTTAATAGTGGAGGG + Intergenic
1071531527 10:86393110-86393132 TTTTCTTTTTTGTTGGGGGTGGG + Intergenic
1072094614 10:92165412-92165434 TTTTTTTTTTGGCTGGTGGAAGG + Intronic
1072238814 10:93476262-93476284 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1072412048 10:95211866-95211888 CTTTCTCTTTAGACGGTGGATGG + Exonic
1072839713 10:98758163-98758185 TTGATTTTTTATATGGTGGAAGG - Intronic
1073296850 10:102445477-102445499 TTTTATTATTAGTGGGTGGAGGG - Intergenic
1073307241 10:102512889-102512911 TTTTCTGTAGAGATGGGGGAGGG - Intronic
1074097678 10:110328373-110328395 TTTTTTTTTTGGAGGGGGGATGG - Intergenic
1074136645 10:110633208-110633230 GTTTCCTTTTGGATGATGGATGG + Intergenic
1074201730 10:111243513-111243535 TTTTCTTTTTCCAGGGTGGAAGG - Intergenic
1074661164 10:115659193-115659215 TTCTCTTTTTGGCTTGTGGAGGG + Intronic
1074692138 10:116015898-116015920 CTTTGTTATTAGATGGTGAAGGG - Intergenic
1074738969 10:116465521-116465543 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1074806444 10:117057727-117057749 TTTTGTTTTTAGATTGTTGTAGG - Intronic
1075098379 10:119488822-119488844 TTTTTTTTTTTTTTGGTGGAAGG - Intergenic
1075345650 10:121680275-121680297 TTTTATATTGAGATGGTGGGAGG - Intergenic
1075380792 10:122016989-122017011 TTCTCTTTTTGGCTTGTGGATGG - Intronic
1075533623 10:123252138-123252160 TTATCTTTTTAAAAGGTGGAGGG - Intergenic
1075721050 10:124587726-124587748 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1076879717 10:133234269-133234291 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1076967966 11:108472-108494 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
1077643791 11:3905374-3905396 TTTTTTTTTTTAAAGGTGGAGGG + Intronic
1077955173 11:7010626-7010648 TTTTTTTTTTTAATGGGGGATGG - Intronic
1077999040 11:7478346-7478368 ATTTCCTCTTAAATGGTGGAAGG + Intergenic
1078458343 11:11493254-11493276 TTTTTTTTTGAGATGAAGGATGG - Intronic
1078890832 11:15557035-15557057 TTTTGTTCTCACATGGTGGAAGG - Intergenic
1079055185 11:17199890-17199912 TTTTTTTTTGAGATGGAGGCTGG - Intronic
1079318078 11:19426698-19426720 TTTTTTTTTTAGTTGGGGGGCGG + Intronic
1079945998 11:26741382-26741404 TTTTTTTTTTAGGTGGGGGCGGG - Intergenic
1080231186 11:30018455-30018477 TTTTTTTTTTAAATGGAGGTGGG - Intergenic
1080309601 11:30874426-30874448 TTTTCTTTTTAAATGAAAGATGG + Intronic
1080709469 11:34733368-34733390 TTTTTTTTTTAAATGATGCAAGG - Intergenic
1080736430 11:35020196-35020218 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1080884921 11:36358408-36358430 TAATCTTTTTTGCTGGTGGAGGG - Intronic
1080910982 11:36598307-36598329 TTCTTTCTTTAGATGGTTGAGGG + Intronic
1081351266 11:42055393-42055415 TTTTCTTTTTAGATGGAGTCTGG + Intergenic
1082172407 11:49021729-49021751 TTTTCTTTTGAGATGGAGTCTGG + Intergenic
1082616474 11:55367229-55367251 TTTTCTTGATAGATCATGGAAGG + Intergenic
1082626281 11:55490793-55490815 TTTTCTTGATAGATCATGGAAGG + Intergenic
1083252622 11:61478039-61478061 TTTTCCTTTTAGCAGGTGGAGGG - Intronic
1083760906 11:64817018-64817040 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1083917727 11:65760467-65760489 TTTTCTTTTTAGTTTGTTTATGG + Intergenic
1084266133 11:68006161-68006183 TTTTTTTTTTAGGTGGTTTATGG + Intergenic
1084522121 11:69669989-69670011 GTTTTTTTTTAAATGGTGAAGGG - Intronic
1085215700 11:74828813-74828835 TTTATTTTTTATATGGTGTAAGG - Intronic
1085222507 11:74887040-74887062 TTGTTTTTGTAGATGGTGTAAGG - Intronic
1085387603 11:76165906-76165928 TTTTATTTTGAGATGGAGTAGGG + Intergenic
1085599302 11:77840515-77840537 TTTTCTTTTGAGATGGAGTCTGG - Intronic
1085599818 11:77845428-77845450 TTTTCTTTTTTTTTGGTGGGGGG + Intronic
1085859209 11:80212333-80212355 TTTTTTTTTTAAATGGCAGAAGG + Intergenic
1085969672 11:81572605-81572627 TTTTCTATTTATATGCAGGATGG - Intergenic
1086053361 11:82619747-82619769 TTTGCTTTTTTTATGGTGGGAGG - Intergenic
1086153603 11:83640746-83640768 TGTTCTTTTTAGATGGTAACAGG + Intronic
1086237773 11:84652941-84652963 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1086902041 11:92378846-92378868 TTATGTTTTTACATGGTGGAAGG + Intronic
1086940579 11:92793924-92793946 TTTTTTTTTTAGAAGGTTGTTGG - Intronic
1087783421 11:102326717-102326739 TTTTCTTTTGAGATGGAGCCTGG + Intronic
1087802894 11:102523182-102523204 TTTTCTTTTTAGAGTGGGGTAGG - Intronic
1088157055 11:106819518-106819540 TAATCTTTTTTGCTGGTGGAGGG - Intronic
1088856587 11:113760679-113760701 TTTTTTTTTTAGAGGGGGGAGGG - Intronic
1089062225 11:115634620-115634642 TTTCCTTTCTAAATGGAGGACGG + Intergenic
1089705067 11:120271884-120271906 TTTCCTTTAAAGAGGGTGGAGGG + Intronic
1089782259 11:120881977-120881999 TTTGCTTTTGAAATGGAGGAAGG - Intronic
1090191700 11:124775259-124775281 TATTCTTTTTAAATGGGGGTGGG - Intronic
1090505396 11:127306942-127306964 TTTTTTTTTTTGAAGGGGGAAGG - Intergenic
1090960872 11:131555661-131555683 TTTGATTTTTAGATGGTGTCTGG + Intronic
1091365737 11:135018838-135018860 GTTTCTTTTTAACTGGAGGAGGG - Intergenic
1092084926 12:5748858-5748880 TTTTTTTTTTGGAGGGTGAAGGG - Intronic
1092478329 12:8837879-8837901 TTTTTTTTTTCGGTGGGGGAGGG - Intronic
1092552423 12:9517659-9517681 TTTTCTTTTCACAGGGAGGAAGG + Intergenic
1092734762 12:11570139-11570161 TTTTATTTTTAGATATTGGTAGG + Intergenic
1092788249 12:12049380-12049402 TTTTCTTTTAATATGGGGGTAGG + Intergenic
1092829434 12:12429524-12429546 TTTTGTTTTTAGATGGTTAGAGG + Intronic
1093312671 12:17609513-17609535 TTTTTTTTTCAGATGTTAGAAGG + Intergenic
1093319230 12:17692122-17692144 TTTTCTTTTTAAATGGAGAAGGG + Intergenic
1093461055 12:19407321-19407343 TTTTCTTTTGAGATGGAGTCTGG + Intronic
1093675388 12:21933213-21933235 TTTGCTTTTCAGAGGGTGGAGGG + Intronic
1093832927 12:23787084-23787106 TTTTGATCTTAGATGGAGGAAGG + Intronic
1093840777 12:23897611-23897633 TTTTGTTTTTTGAGGGTGGGTGG - Intronic
1093855533 12:24097538-24097560 TTTTTTTTTTATATGGTGTAAGG + Intergenic
1093974204 12:25403006-25403028 TTTTTTTTTGAGATGGAGTATGG + Intergenic
1094050244 12:26212347-26212369 TTTTCTCTTTAGATCCTGAAAGG + Intronic
1094137213 12:27140780-27140802 TTTTTTTTTTTTTTGGTGGATGG + Intergenic
1094199937 12:27784836-27784858 TATTCTTTTTATATGTTGGTTGG + Intronic
1094505771 12:31059897-31059919 TTTTGCTTTTAGTTGGTGAAAGG + Intergenic
1094519698 12:31172952-31172974 TTTTCTTTTCACAGGGAGGAAGG - Intergenic
1094733832 12:33209665-33209687 TTTTTTTTTTTTGTGGTGGAGGG + Intergenic
1095473231 12:42559060-42559082 TTTTCTTTTTAGAAGTAGAAGGG - Intronic
1096031659 12:48421532-48421554 TTTTTTTTTTAGATGGAGGATGG + Intergenic
1096103474 12:48983135-48983157 TTTACTTTTCTGTTGGTGGAAGG - Intergenic
1096202966 12:49698992-49699014 TTTTCTTTGAAGATAGAGGAGGG - Intronic
1096277584 12:50223476-50223498 TTTTTTTTTTGGTTGGGGGATGG - Intronic
1096302242 12:50440427-50440449 TTTTCTTTTTAGGAAGTGAAAGG + Exonic
1097349296 12:58530477-58530499 TTTTCTTTCTAGATTGGTGAGGG + Intergenic
1097724608 12:63060649-63060671 TTTTGTTTTTGTTTGGTGGATGG - Intergenic
1098631461 12:72727661-72727683 TTTTTTTTTTAGATTTTGAAAGG - Intergenic
1099231251 12:80027898-80027920 TTTTTTTTTTTGGTGGTGGGGGG - Intergenic
1099263690 12:80416986-80417008 TTTACATTTTAGATGGCAGATGG - Intronic
1099334335 12:81334481-81334503 TTTTTTTTTTTTTTGGTGGAGGG - Intronic
1099487308 12:83244485-83244507 TTTTCTTTCTAGATTCAGGAAGG + Intergenic
1099502821 12:83434383-83434405 TTTTTTTTTTTGCTGTTGGAGGG + Intergenic
1099538975 12:83881654-83881676 TTTTTTTTTTTGGTGGGGGAGGG + Intergenic
1099767881 12:87012661-87012683 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1099933701 12:89101423-89101445 ATATCTTTTTAAATGGAGGAAGG + Intergenic
1100297101 12:93273463-93273485 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1100343100 12:93700440-93700462 TTTTCTTTTGAGATGGAGTCTGG + Intronic
1100514932 12:95318200-95318222 TTTTCTTTTTATCTGGTTGGGGG + Intergenic
1100642627 12:96496920-96496942 TTTTTATTTTACTTGGTGGAGGG + Intronic
1100688852 12:97017124-97017146 TTTCCATTTAATATGGTGGATGG - Intergenic
1100818832 12:98412129-98412151 TTTTTTTTTTAGATAGAGTAGGG - Intergenic
1101334227 12:103782031-103782053 TTTTCTTTTTCAATGGTTGGGGG + Intronic
1101426297 12:104591231-104591253 TTTTGTTCTAAGATGGTGGCAGG + Intronic
1101585845 12:106084750-106084772 TTATCTTTTTAGGGGGTGGGTGG + Intronic
1101681595 12:106972868-106972890 TTTTTTTTTTTTATAGTGGAGGG + Exonic
1101852942 12:108418818-108418840 GCTTCTTTTTATTTGGTGGAAGG + Intergenic
1102020927 12:109682110-109682132 TTTTTTTTTTTGATCTTGGAAGG - Intergenic
1102191220 12:110989985-110990007 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1102372826 12:112396558-112396580 TTTTCTTTTTTGATCTTGGTTGG - Intergenic
1102777148 12:115530182-115530204 CTATCTTTTTAAATGATGGAGGG + Intergenic
1102859548 12:116323489-116323511 TTTTTTTTTGAGATGGGGGATGG - Intergenic
1102930396 12:116857729-116857751 TTTTCTGTTTTGATGGTGAGAGG - Exonic
1103091195 12:118099287-118099309 TCTTTTTTAGAGATGGTGGAGGG + Intronic
1103093920 12:118117872-118117894 TTTTTTTTTTAGACGGAGGCTGG - Intronic
1103155279 12:118679535-118679557 TTTTCTGTTGGCATGGTGGATGG + Intergenic
1103366278 12:120385990-120386012 TTTTGTTTTTACATGGTGCCAGG - Intergenic
1103680418 12:122689480-122689502 TTTTTTTTTTTGGTAGTGGAGGG + Intergenic
1104223160 12:126805825-126805847 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1104305225 12:127603981-127604003 TTTTTTTTTTTGAGGGTGGGAGG + Intergenic
1104395931 12:128432987-128433009 TTTATTTTTTGGCTGGTGGAGGG - Intronic
1104449181 12:128855211-128855233 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1105386033 13:19930394-19930416 TTATTTTTTGAGATGGAGGATGG - Intergenic
1105690667 13:22835793-22835815 TTTTTTTTTAAGGTGGTGGGTGG + Intergenic
1105774177 13:23641335-23641357 TTTTCTTTTTTGGTGAGGGATGG + Intronic
1105949907 13:25220410-25220432 TTTTTTTTTTGGAGGGGGGACGG - Intergenic
1106288132 13:28336019-28336041 TTTTCTTTTTAGATGGTGGAAGG - Intronic
1106514203 13:30439009-30439031 ATTACTTTTTAAATGGTGTATGG + Intergenic
1106681531 13:32013261-32013283 TTCTCTTTTTAGTTGGAGTAGGG + Intergenic
1106827637 13:33541860-33541882 CTTTGTTTTTAGATGCTGCAAGG - Intergenic
1107248230 13:38323605-38323627 TTTTCTTTTTATATGGCGTTAGG + Intergenic
1107275349 13:38671969-38671991 CTTTCTTTATGGAGGGTGGATGG - Intergenic
1107687449 13:42917808-42917830 TTTTCTTTTTATATGTTCCAAGG - Intronic
1107934809 13:45336707-45336729 TTGCCTTTTTAAATGGTTGAGGG - Exonic
1108082162 13:46747747-46747769 TTTTTTTTTGAGATGGGGTATGG + Intronic
1108187738 13:47905153-47905175 ATTTCCTTTTAGATGGAGGGAGG + Intergenic
1108301332 13:49079734-49079756 TTTCCTTTTTATAGGGTGAAGGG - Intronic
1108570944 13:51750684-51750706 TTTTCTTTCTAGTTTGTGCATGG - Intronic
1108690944 13:52858566-52858588 TTTTTTTTTTTGTTGGTGGCAGG + Intergenic
1109332509 13:60947014-60947036 TTTTTTTTTTGGATTGTGTAAGG - Intergenic
1109395742 13:61756041-61756063 TTTATTTTTTATATGGTGAAAGG + Intergenic
1109974694 13:69815851-69815873 TTTTATATTTAGATGGTTGGAGG - Intronic
1110912301 13:80980166-80980188 TTTTCTATTAAAATGGTGGTGGG - Intergenic
1111644607 13:91015446-91015468 TTTTTTTTTGAGATGGAGGCTGG - Intergenic
1112282004 13:98071046-98071068 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1112601449 13:100859439-100859461 TTTTCTTCTTGGCTTGTGGATGG + Intergenic
1112910791 13:104480654-104480676 TTTTCTTTGTCGGTGGAGGAGGG + Intergenic
1112991190 13:105515620-105515642 TTTTTTTTTTTTTTGGTGGAGGG - Intergenic
1113012124 13:105780178-105780200 TTTTTTTTTTAATTGATGGATGG - Intergenic
1113515190 13:110889299-110889321 TGTTCATTTTAGATGGTGCAAGG - Intronic
1113917233 13:113881745-113881767 GTTTCATTTTGGAAGGTGGAGGG - Intergenic
1114011893 14:18377777-18377799 TTTTTTTTTTACATGGGGTAAGG - Intergenic
1114208242 14:20593506-20593528 TTTTTTTTTTTGGTGGGGGATGG - Intronic
1114259003 14:21024540-21024562 GTTTGTTTTTAAATTGTGGAGGG - Exonic
1114419580 14:22570158-22570180 TTTAATTTTTTGTTGGTGGAGGG - Intronic
1114514790 14:23291598-23291620 TTTTCTGTAGAGATGGGGGACGG - Intronic
1114550128 14:23527916-23527938 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1114580548 14:23755014-23755036 TGTTATTTTTATATGGTAGAAGG - Intergenic
1114697342 14:24639177-24639199 TTTTCATTTGTGATGGTGGCTGG - Intergenic
1114889546 14:26900842-26900864 TTTTTTTTTTTGGTGGTGGTAGG - Intergenic
1115420959 14:33195219-33195241 TTTTTTTTTTAGCTAGTGGGTGG - Intronic
1115465853 14:33713399-33713421 TTTGCTTTTTTGAGGGAGGAGGG + Intronic
1115543605 14:34445076-34445098 TTTTTTTTTTAGATGGAGCCTGG - Intronic
1115749818 14:36477868-36477890 TTTATTTTATAGATGGAGGAGGG - Intronic
1116018920 14:39438416-39438438 TAATCTTTTTATATGGTGAAAGG + Intergenic
1116250534 14:42476281-42476303 TTTTATTTTTACATAGTGGTTGG + Intergenic
1116387831 14:44354175-44354197 TAATCTTTTTTGCTGGTGGAGGG + Intergenic
1116450703 14:45061613-45061635 TTATCTTAATAGATGCTGGAAGG - Intronic
1116871572 14:50073422-50073444 TTTTTTTTTGAGAGGTTGGAGGG + Intergenic
1116972858 14:51085498-51085520 ATTCCTTTTTATATGGTGAAAGG + Intronic
1117133602 14:52710422-52710444 TTTTTTTTTGAGATGGAGTACGG - Intronic
1117950171 14:61074845-61074867 TTTTTTTTTTTGGTGGTGGTGGG + Intronic
1118021654 14:61722402-61722424 TTTTCTTTTTAAATTGTGATAGG + Intronic
1118176471 14:63445444-63445466 TAATCTTTTTTGCTGGTGGAGGG + Intronic
1118818848 14:69331669-69331691 TTCTCTTTGGAGGTGGTGGAAGG - Intronic
1119521136 14:75286360-75286382 TTTTTTTTTTTTTTGGTGGAGGG - Intergenic
1119656066 14:76417958-76417980 TTTTTTTTTTTGGTGGGGGATGG + Intronic
1119978120 14:79048633-79048655 TTTTATTTTTTGCTGGTGGAGGG + Intronic
1120589225 14:86355729-86355751 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1121379128 14:93446398-93446420 TTTTTTTTTTTGGTGGGGGATGG + Intronic
1121457958 14:94050873-94050895 TTTTTTTTTTAGATAGAAGATGG - Exonic
1122454593 14:101840471-101840493 TTTTTTTTTTTGGTGGTGGGGGG - Intronic
1123908683 15:24945331-24945353 TTTTTTTTTTACATGGTGGGTGG - Intronic
1124146908 15:27136442-27136464 TTTTAACTTTAGAGGGTGGAAGG + Intronic
1124531398 15:30510847-30510869 TTTTCTTTCTTGTTGGGGGAGGG - Intergenic
1124560232 15:30766694-30766716 TTTTTTTTTTAGAGGGAGGCTGG + Intronic
1124767257 15:32496849-32496871 TTTTCTTTCTTGTTGGGGGAGGG + Intergenic
1124818900 15:33023047-33023069 TTTTTTTTTTGGGTGGGGGAGGG - Intronic
1125620256 15:41054648-41054670 TTTTCTTTTGAGATGGAGTCTGG + Intronic
1125677379 15:41509846-41509868 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1126556740 15:49996573-49996595 GTTTCTTTTTATTTGGTGGAAGG - Intronic
1126739166 15:51760382-51760404 TTTGCTTTGAAGATGGTGGAAGG - Intronic
1126859750 15:52872211-52872233 TTTTTTTTTTAGATGGAGACTGG - Intergenic
1126941016 15:53765591-53765613 CTCTCTCTTTAGATGATGGAAGG + Intergenic
1126959662 15:53977535-53977557 TTTGCTTTTTAGAAAATGGAAGG - Intergenic
1127520084 15:59735169-59735191 TTTTCTTTTAAAATGCTGGGAGG - Intergenic
1127587747 15:60394685-60394707 TTTTCTTTTGAGATGGAGCCTGG - Intronic
1128034818 15:64515552-64515574 TCTTCTTTTTAAAGGGGGGAGGG + Intronic
1128904189 15:71452512-71452534 TTTTTTTTTTTTTTGGTGGAGGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130159377 15:81383622-81383644 TTTTTTTTTTAGATGGAGTTTGG + Intergenic
1130570968 15:85043361-85043383 TTGTCTTTTGGGAGGGTGGAGGG + Intronic
1131244341 15:90777156-90777178 TTTTCTTTTTTGAGGGGGGTGGG + Intronic
1131484702 15:92809955-92809977 TTTTTTTTTTTGACGGTAGATGG + Intergenic
1131498544 15:92936838-92936860 TTTTTTTTTTTGATGGAGGAGGG + Intronic
1131608055 15:93930161-93930183 TTTTTTTTTTTAATGGTGGGTGG - Intergenic
1131865590 15:96705272-96705294 TTTTTTTTTTTGATGGTAGGGGG - Intergenic
1133462105 16:5995993-5996015 CTTTGTTTTCACATGGTGGAAGG + Intergenic
1133572371 16:7054162-7054184 TTTTCTTTTGAGGTGATGGAAGG - Intronic
1133593583 16:7269030-7269052 TTTTTTTTTGAGATGGAAGATGG - Intronic
1133685559 16:8162419-8162441 TTTTTTTTTTTGATGGGGGTGGG - Intergenic
1133705772 16:8353330-8353352 TTTTTTTTTTTGGTGGTGGTTGG - Intergenic
1133993750 16:10730934-10730956 TTTTTTTTTGAGATGGAGGCTGG - Intergenic
1134439979 16:14293620-14293642 TTTTTTTTTGAGATGGAGGCTGG + Intergenic
1134779323 16:16881448-16881470 TTTTCTTTTTCGCTTGTGAAAGG + Intergenic
1134891206 16:17843243-17843265 GTTTTTTTTCACATGGTGGAAGG + Intergenic
1135096112 16:19566186-19566208 TTTTCTTTTAACATGGGGAACGG - Intronic
1135595756 16:23741660-23741682 TTTTTTTTTTTGGTGGGGGAGGG - Intergenic
1136099673 16:27984619-27984641 TTTTTTTTCTAGATAGGGGAAGG + Intronic
1137019233 16:35407101-35407123 TTTTATTTTGAGATTGGGGATGG - Intergenic
1137308764 16:47232356-47232378 TTTTCTTTTTTGAAGTAGGAGGG + Intronic
1137327414 16:47455766-47455788 TTTTTTTTTTTGGTGGGGGATGG - Intronic
1137823832 16:51472179-51472201 TTTTTTTTTTAAGTGGTGGCCGG + Intergenic
1138168756 16:54829629-54829651 TTTTTTTTTGAGATGGTGAGAGG + Intergenic
1138419553 16:56890402-56890424 TTTTGTTTTTAAATGGCAGAGGG + Intronic
1138450380 16:57090537-57090559 TTTTTTTTTTGGAGGGGGGATGG + Intergenic
1138478551 16:57286270-57286292 TTTTGTTTTTAGATGGAGTCTGG - Intergenic
1138637161 16:58349737-58349759 TTTTTTTTTTTTTTGGTGGAAGG + Intronic
1138855806 16:60689785-60689807 TTTTCTTGTCAGATGATGGTTGG + Intergenic
1138931399 16:61661672-61661694 TCTTCTTTTTATATGGCTGATGG - Intronic
1139114811 16:63936984-63937006 TTGTATTTATAGTTGGTGGAGGG - Intergenic
1139241448 16:65396504-65396526 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1139704929 16:68734760-68734782 TTTTGTCTTTTGATGGAGGACGG + Intergenic
1140240563 16:73196156-73196178 TTTTTTTTTTGGAGGGGGGATGG + Intergenic
1140315395 16:73891454-73891476 TTTTCTTTATGGATCGGGGAGGG - Intergenic
1140439118 16:74973292-74973314 TTTGCTTTTTAGATTGGGGTTGG + Intronic
1140500288 16:75428138-75428160 TTTTTTTTTAAGAGGGTTGACGG + Intronic
1140586042 16:76292980-76293002 TTTTCTTTTTTGAAAGTGGCTGG - Intronic
1140712937 16:77695117-77695139 TTTTCTTTTTAGGGGGTGGGTGG + Intergenic
1140837967 16:78812723-78812745 TTTTTTTTTTAGGGGGTGGGAGG - Intronic
1141256339 16:82405738-82405760 TTTTCTTGTTTGTTGGTGGAGGG + Intergenic
1141314701 16:82950815-82950837 TTTTTTTTTTTGGTGGTGGTTGG + Intronic
1141910531 16:87055585-87055607 TTTTCTTCTTAGAATGTTGAAGG - Intergenic
1141990909 16:87609022-87609044 TTTTCTTTTGAGATGGGGTCTGG - Intronic
1142452712 16:90190667-90190689 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
1143080845 17:4380338-4380360 TTTTATTTTTAGTAGGTGGGGGG + Intergenic
1143115164 17:4577843-4577865 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1143364686 17:6398730-6398752 TTTTTTTTTTTTTTGGTGGAGGG + Intronic
1143464360 17:7125992-7126014 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1143473311 17:7189909-7189931 TTTTCTTTTGAGAGAGTGAAAGG - Exonic
1143744149 17:8978212-8978234 TTTTTTTTTTTGATAGTGTATGG - Intergenic
1144573007 17:16412010-16412032 TTTTCATTTTTGATAGAGGAGGG + Intergenic
1145201570 17:20950072-20950094 TTTTTTTGTTATATGGAGGACGG + Intergenic
1145376955 17:22358850-22358872 CTTTCATTTTAGATTCTGGAGGG - Intergenic
1146326860 17:31893723-31893745 TTTTTTTTTTTGGTGGGGGATGG - Intronic
1146467831 17:33100648-33100670 GGCTCTTTTTAGATGGTAGATGG - Intronic
1146682701 17:34819788-34819810 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1147017770 17:37506275-37506297 TTTTCTTTTTTGCAGGGGGACGG - Intronic
1147205985 17:38837665-38837687 TTTTTTTTTTAGATGGAGTTTGG - Intronic
1147226147 17:38979366-38979388 TTTTTTTTTGAGACGGAGGATGG + Intergenic
1147974969 17:44242037-44242059 TTTTTTTTTTTGGTGGGGGAGGG + Intergenic
1148255239 17:46125201-46125223 TAATCTTTTTTGCTGGTGGAAGG - Intronic
1148500131 17:48083818-48083840 TTTTTTTTTTGGAGGGGGGATGG - Intronic
1148535458 17:48434839-48434861 ATTACTATTTAGATGGAGGAGGG - Intergenic
1148807492 17:50271354-50271376 TTTTCTTTTTAGAGCGAGGGTGG + Intergenic
1148958267 17:51371684-51371706 TTTTTTTTTTTGGTGGTGGGTGG + Intergenic
1148968025 17:51454156-51454178 TTTTTTTTAGAGATGGTGGGGGG + Intergenic
1150183648 17:63156369-63156391 CTTTCTTTTTATTTGGTGCAAGG - Intronic
1150259445 17:63776641-63776663 TTTTTTTTTGAGATGGTGTCTGG + Intronic
1150793301 17:68217822-68217844 TTTTTTTTTGAGATGGAGGCTGG + Intergenic
1150868034 17:68875367-68875389 TTTGCTTTTCAGGTGTTGGATGG + Exonic
1150877244 17:68983816-68983838 TTTGCTTTTCAGGTGTTGGATGG + Exonic
1150917885 17:69455037-69455059 TTTTTTTTTTTTTTGGTGGAGGG + Intronic
1151236586 17:72724522-72724544 TTTCCATTTCAGAGGGTGGAGGG - Intronic
1152115104 17:78381148-78381170 TTTTGTTTTTTGGTGGTGGGAGG + Intronic
1152487338 17:80602486-80602508 TTTTCTTTTTTTTTGGTGGGGGG + Intronic
1153313924 18:3703575-3703597 GTTTCTTTTTAGAAGACGGAGGG + Intronic
1153531672 18:6053066-6053088 TTCTATTTTTAAATGGTAGAAGG + Intronic
1154126188 18:11694470-11694492 TTTAATTTTTAGATGGAGCATGG + Intronic
1154153818 18:11928316-11928338 TTTTGTTTTTAGATGGAGTTTGG - Intergenic
1154510870 18:15100019-15100041 TTTTTTTTTTAGATGGAGCCTGG - Intergenic
1154952543 18:21224402-21224424 TTTTTTTTTTTGCTGGTGGAGGG + Intergenic
1154963378 18:21332484-21332506 TTTTCTTTTGAGATGGAGTCTGG + Intronic
1155004958 18:21720495-21720517 TTTTTTTTTTAGAAAGTGGAAGG + Intronic
1155273355 18:24162627-24162649 TTTTCTTCTTGGAAGATGGAAGG + Exonic
1155635585 18:27951217-27951239 TTTTCTTTTTGGTTTGGGGAGGG - Exonic
1156209419 18:34922873-34922895 TTTTTTTTTTAAATGGTTCATGG + Intergenic
1156262010 18:35453306-35453328 TTTTTTTTTTGGAGGGTGCAGGG - Intronic
1156579982 18:38363653-38363675 TTGTGTTTTCAAATGGTGGAAGG - Intergenic
1156581535 18:38382239-38382261 TTGTGTTTTCAAATGGTGGAAGG + Intergenic
1156814320 18:41290796-41290818 TTTTCTTTTTATTTTGTGGCAGG - Intergenic
1156933517 18:42674852-42674874 TTTTCTTTTTAGACGGGAGTAGG - Intergenic
1156952040 18:42913185-42913207 TTTTTTTTTTGGCTGATGGATGG - Intronic
1156957247 18:42982096-42982118 TTCTCTTCATTGATGGTGGAAGG + Intronic
1156957465 18:42986048-42986070 TTTTTTTTTTAGATGGAGTGTGG + Intronic
1157596275 18:48865811-48865833 TTTTTTTTTTAAATGGAAGAAGG - Intergenic
1158040790 18:53090687-53090709 TTTTTTTTTTTGTTGGGGGACGG - Intronic
1158442325 18:57487733-57487755 ATTACCTTTTAGATGGTAGATGG - Exonic
1158848034 18:61465241-61465263 TTTTCTTTTTAGCAGCTGTAGGG - Intronic
1158990941 18:62867821-62867843 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1159030948 18:63231187-63231209 TTTTATTTTTAAATTGTGAATGG - Intronic
1159056136 18:63465761-63465783 TTTTTTTTTTAGACAATGGAAGG + Intergenic
1159302796 18:66597431-66597453 TGATTTTTTTATATGGTGGAAGG - Intronic
1159432134 18:68366202-68366224 TTATCTTTTTAGTTGGTGAAGGG - Intergenic
1159859036 18:73625256-73625278 TTTTCTTTTTACTTGTTAGATGG - Intergenic
1160644773 19:178095-178117 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
1161193193 19:2971060-2971082 TTGTATTTTTAGTTGGTGGGGGG - Intergenic
1161324087 19:3654800-3654822 TTTTCTTTTGAGATGGAGTCTGG - Intronic
1161638299 19:5403236-5403258 TTTTTTGTAGAGATGGTGGAGGG + Intergenic
1161896987 19:7089868-7089890 TTCTCTTTTTTGGTGGTGGTGGG - Intergenic
1162449159 19:10744144-10744166 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1162946538 19:14047364-14047386 TTTTTTTTTGAGATGGAGGCTGG + Intronic
1163209214 19:15828456-15828478 GTTTCCTTTTAGATGACGGAGGG + Intergenic
1163535991 19:17876854-17876876 TTTTTTTTTTAGGGGGGGGACGG - Intronic
1163614291 19:18317700-18317722 TTTTTTTTTTTGATGGTGACAGG + Intronic
1164131863 19:22370797-22370819 TTTTTTTTTGAGATGGTGTCTGG + Intergenic
1164448633 19:28339321-28339343 TTAACTTTTTATATGGTGAAAGG + Intergenic
1164490064 19:28702137-28702159 TAATCTTTTTTGCTGGTGGAGGG + Intergenic
1164612610 19:29643067-29643089 TTTTTTTTTTTGGTGGTGGGGGG + Intergenic
1164724653 19:30457935-30457957 TCTTCTTTTTGGGTGGTGGGTGG + Intronic
1164965841 19:32482067-32482089 TTTTGGTTTTAGATGATGGATGG + Exonic
1165088749 19:33371025-33371047 TTTTCTTTTCAGCTGGTAGCTGG - Intergenic
1165504765 19:36218803-36218825 TTTTCTTTTTTTTTGGTGGAGGG + Intronic
1166171528 19:41030719-41030741 TTTTCCTTTGAGAAGGGGGAAGG + Intergenic
1166520571 19:43477503-43477525 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1166609796 19:44180926-44180948 TTTTCTTTTCAGTCAGTGGAAGG + Intergenic
1167292173 19:48630340-48630362 ATTGCTTTTTAGATTGGGGACGG - Exonic
1167441007 19:49508857-49508879 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1168090747 19:54081680-54081702 TTTTTTTTTGAGATGGTGTCTGG + Intergenic
1168558796 19:57365871-57365893 TTTTCTTTTGAGATGGAGTCTGG + Intronic
925250576 2:2433607-2433629 TTTTATTTTTATTTGGTGGCTGG + Intergenic
925297017 2:2784080-2784102 GTTTCTTTTTGGATGGGGGGAGG - Intergenic
925908617 2:8555936-8555958 TTTTTTTTTTTGCTGGTGAAGGG - Intergenic
926039074 2:9658440-9658462 TTTTCTTTTTTGAGGGGGGTGGG + Intergenic
926272992 2:11381332-11381354 TTTACTTTTGAGAAGGAGGAAGG - Intergenic
926548113 2:14267564-14267586 CTTTTCTTTTCGATGGTGGAGGG + Intergenic
926839248 2:17060256-17060278 CTTTCTATTGAGAAGGTGGATGG + Intergenic
927037750 2:19197919-19197941 TTTTCTTTTTAGCCTGTCGATGG - Intergenic
927070243 2:19521172-19521194 TTATTTTTTTATATGGTGAAAGG - Intergenic
927366295 2:22300738-22300760 TTTTGATTTGAGAAGGTGGATGG + Intergenic
927479691 2:23442485-23442507 TTGTCTTTGAAGATGGAGGAAGG + Intronic
927795978 2:26049193-26049215 TTTTTTTTTTTGCTTGTGGAAGG + Intronic
928345836 2:30494856-30494878 TTTTCTGTTTGGGGGGTGGAGGG + Intronic
928792370 2:34972950-34972972 TTTTTTTCTGAGATGTTGGATGG + Intergenic
929123491 2:38502326-38502348 TTTTCTTTGAAGCTGGAGGAAGG - Intergenic
929462656 2:42114824-42114846 TTTTGTTTTTTGGTGGTGGGGGG + Intergenic
929478857 2:42282375-42282397 TTTTCCTTTTTTTTGGTGGAGGG + Intronic
929824266 2:45298172-45298194 TTTTCTTTTTAGTTGTTTCATGG + Intergenic
929952865 2:46429490-46429512 TTTTCTTTTAAAAGGTTGGAGGG - Intronic
930022519 2:47009893-47009915 TTTTTTTTTTTGGTGGTGGGGGG + Intronic
930286454 2:49435463-49435485 TTTTCTTTTGAGATGGAGTCTGG + Intergenic
930309704 2:49724587-49724609 TTTTCTTTTTTGGTTGGGGAGGG + Intergenic
930765989 2:55085692-55085714 TTTTCTATGTAGATTGGGGAAGG - Intronic
931316417 2:61136795-61136817 TTTTATTTTTAGTAGGTGCAGGG - Intronic
931529025 2:63191378-63191400 TTTTCTTTTGAGATGGAGTCTGG - Intronic
931601813 2:64011551-64011573 TTTTCTTTTGAGATGGAGTCTGG - Intronic
931651021 2:64468760-64468782 TTTTTTTTGTAGGTGATGGAAGG - Intergenic
931881339 2:66574394-66574416 TTTTATTTTTATTTGGTGGTGGG + Intergenic
931895962 2:66729927-66729949 TTTTCTTTATAGATGGAGGAGGG + Intergenic
931949276 2:67343628-67343650 CTTTTTTTTTTGATGGTGGTGGG - Intergenic
932248179 2:70215757-70215779 TTTTTTTTTGAGATGGTGTCTGG + Intronic
932289394 2:70562863-70562885 TTTTTTTTTGAGATGGAGGGTGG - Intergenic
932828555 2:74965096-74965118 TTTTTTTTTTTGGTGGGGGATGG + Intronic
933193492 2:79363552-79363574 TTTTTTTTTTTGCTGGGGGAAGG - Intronic
933383813 2:81584536-81584558 TTTTCTTTTTAGAGGTTTTAAGG - Intergenic
933818730 2:86090373-86090395 TTTTTTTTTGAGATGGTGTCTGG - Intronic
933915229 2:86984882-86984904 TTTTCTTTTTAAATTGTTTAGGG + Intronic
934007764 2:87785019-87785041 TTTTCTTTTTAAATTGTTTAGGG - Intronic
934059181 2:88278559-88278581 TAATCTTTTTTGCTGGTGGAGGG - Intergenic
934072432 2:88396858-88396880 TTTTATTTTTGGAGGGAGGATGG - Intergenic
934150871 2:89146423-89146445 TTTTATTTTTACATGGTCTAGGG + Intergenic
934216405 2:90035602-90035624 TTTTATTTTTACATGGTCTAGGG - Intergenic
934843226 2:97644901-97644923 TTTTTTTTTTAATTGGTGGAGGG + Intergenic
935015021 2:99173699-99173721 TTTTGTTTTTAGTTGGGGGTGGG - Intronic
935073676 2:99719135-99719157 TTTTCTTTTTAAATCATGAATGG + Intronic
935387499 2:102515464-102515486 TTTTCTTTGAGGGTGGTGGAGGG + Intronic
935731607 2:106068860-106068882 TTTTCTAATTAGATGGGGGTGGG - Intronic
935790039 2:106582473-106582495 TTTTTTTTTTTTGTGGTGGAGGG - Intergenic
936130455 2:109835125-109835147 TTTTCTTTTTAAATTGTTTAGGG + Intronic
936214242 2:110536360-110536382 TTTTCTTTTTAAATTGTTTAGGG - Intronic
936423379 2:112390919-112390941 TTTTCTTTTTAAATTGTTTAGGG - Intronic
936448703 2:112617275-112617297 TATTTTTTTTAGGTAGTGGAAGG + Intergenic
936672277 2:114670827-114670849 TTTACTTCTAAGATGATGGATGG - Intronic
937047636 2:118860191-118860213 TTTTTTTTTTGGAGGGGGGAAGG + Intergenic
937485080 2:122307281-122307303 TTTTCTTTATACATGGTGTGCGG + Intergenic
937540819 2:122950644-122950666 TTTTTTTTTTATATGATGTAAGG + Intergenic
938387912 2:130880838-130880860 TTTTTTTTTTAAATAATGGAAGG + Intronic
939027523 2:137031838-137031860 TTTTTTTTTTAGCTGGGGGTAGG + Intronic
939102938 2:137916299-137916321 TTTTGTTCTCAGATGGTGCACGG - Intergenic
939106796 2:137958008-137958030 TTATCTTTTTAAAAGATGGAAGG + Intergenic
939367517 2:141252195-141252217 TTTTTTTTTTAGGGGGTGGGGGG - Intronic
939512781 2:143127220-143127242 TTTTCTTTGTATAAGGTGGAAGG - Intronic
939601349 2:144194905-144194927 TTTACTTTTTAAAATGTGGAGGG - Intronic
939645201 2:144689137-144689159 TTTTCTTTTAAGATTGTGCATGG + Intergenic
940035339 2:149306924-149306946 TTTCCTTTTTAGCTGATGGATGG + Intergenic
940265503 2:151831485-151831507 TTTTCTTTTTTTTTGGTGGGGGG + Intergenic
940364556 2:152833510-152833532 TTTTCTTCTTGCATGGTGGAAGG + Intergenic
940487763 2:154317921-154317943 TTTTTTTTTTAGATTTTGGTAGG - Intronic
941111882 2:161425138-161425160 TATTCTATTTAGAAGGTGGGGGG - Exonic
941118834 2:161505012-161505034 TTTGCTTTTTAGTAGGTGCATGG - Intronic
941511613 2:166417466-166417488 TTTTCTTTTTTGTGGGGGGATGG - Intronic
941923093 2:170871047-170871069 TCTTCTTTTTTGGGGGTGGAGGG + Intergenic
942728686 2:179039488-179039510 TTTTCTTTTTAGGTGTGTGAAGG + Intronic
942747559 2:179252546-179252568 TTTTCTGTTTTGATAGAGGAAGG - Intronic
943069038 2:183119677-183119699 TTTTCTTTTTGGAGGGGGGTGGG + Intronic
943694207 2:190906939-190906961 TTTTTTTTTGAGATGGTGTCTGG + Intronic
944720820 2:202421809-202421831 TTTTCTTTTTTAATGTGGGATGG + Intronic
944815273 2:203370256-203370278 TTTTTTTTTTGGTTGGGGGATGG + Intronic
945039258 2:205730434-205730456 TTCTCTTTGTAGCTGCTGGATGG + Intronic
945131985 2:206583567-206583589 TTTTCTTTTTCTTTGTTGGATGG + Intronic
945337587 2:208611072-208611094 TTTTCTTTATTGTTGGTTGATGG + Intronic
945457300 2:210064806-210064828 TTTTTTTTTTTGGTGGGGGAGGG - Intronic
945508819 2:210674811-210674833 TTGTCTTTTAAGATGTTGTAAGG + Intronic
945722897 2:213440756-213440778 TATTCTTTGTATATGGTGTAAGG - Intronic
945830460 2:214778204-214778226 TTTTCTTTTTTGGGGGTGGGGGG - Intronic
945968918 2:216217532-216217554 GTTTCTATTCAGTTGGTGGAGGG + Intergenic
946661161 2:222001302-222001324 TTTTCTCTTGAGATTTTGGATGG + Intergenic
946747420 2:222860658-222860680 TTTTTTTTTTTTTTGGTGGAGGG + Intergenic
946971610 2:225098893-225098915 TTTTTTTTTTAGATGGAGTGAGG - Intergenic
947394586 2:229674281-229674303 TCTTCTTTTTTGGTGGGGGATGG + Intronic
947585005 2:231350014-231350036 TTTTTTTTTTAGATGTTTGTGGG - Intronic
947807795 2:232980668-232980690 TTTTCTTTTTAAATAGAGGCAGG + Intronic
948046464 2:234949668-234949690 TTTTCTTTTTGTATCCTGGAAGG - Intergenic
948071809 2:235134009-235134031 TTTCCTTTTTAGGTGGGGGAGGG + Intergenic
948126602 2:235568739-235568761 TGTTCTTTCTAGAGGGTGCAGGG + Intronic
1169114224 20:3052554-3052576 TTTTCTTTTTTTTTGGTGGGGGG - Intergenic
1169960911 20:11159207-11159229 TTTTCTTTTTTTGTGGGGGAAGG + Intergenic
1170138651 20:13103283-13103305 CTTACTTTTAAGATGGTGGTGGG - Intronic
1170203137 20:13766924-13766946 TTTTCTTATTTGTTGGTGAAAGG - Exonic
1170276924 20:14601648-14601670 ATTTCTTTTTTAATGGAGGAAGG + Intronic
1170346599 20:15393780-15393802 TTACCTTGTTAGAAGGTGGATGG - Intronic
1170697960 20:18676987-18677009 TTTTCTTTTTAGGGGGTGGGAGG - Intronic
1171047246 20:21821776-21821798 TTTTTTTTTTAAATCCTGGAAGG + Intergenic
1171526538 20:25817053-25817075 CTTTCATTTTAGATTCTGGAGGG + Intronic
1171550289 20:26038832-26038854 CTTTCATTTTAGATTCTGGAGGG - Intergenic
1171805613 20:29676735-29676757 TTTTCATTTTAGATTCTGGAGGG - Intergenic
1171838444 20:30179681-30179703 TTTTCATTTTAGATTCTGGAGGG + Intergenic
1171908448 20:30920504-30920526 TTTTTTTTTTTGGTGGGGGACGG + Intergenic
1173507551 20:43599951-43599973 TTTACTTTTTTAATGGTGGTGGG - Intronic
1173581363 20:44149084-44149106 TTTTTTTTTTAATTGGAGGAGGG - Intronic
1174000585 20:47371592-47371614 TTTTTTTTTTTGGTGGTGGCGGG - Intergenic
1174236439 20:49097087-49097109 CTTTTTTTTTATATGGGGGAAGG + Intergenic
1174249688 20:49209235-49209257 TTTTCTTTTTAGATAGAGACAGG - Intergenic
1174320347 20:49736878-49736900 TTTTCTTTTGAGAGGGGGCAGGG + Intergenic
1175234421 20:57500091-57500113 TTTTTTTTTTTTTTGGTGGATGG + Intronic
1175359896 20:58401286-58401308 TTTTCTTCTTTAAAGGTGGAAGG - Intronic
1175451526 20:59072765-59072787 TTTCCTTCTTAGATAGTAGAGGG - Intergenic
1175459784 20:59143687-59143709 TTTTCTTCTTAAAGGCTGGATGG + Intergenic
1175473324 20:59249787-59249809 TTTTGGTTTAAGATGGAGGATGG + Intronic
1175706440 20:61181335-61181357 TTTTTTTTTGAGATGGTGTCTGG - Intergenic
1176207846 20:63899891-63899913 TTTTTTTTTTGGTTGGGGGACGG + Intronic
1176280737 20:64307816-64307838 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
1176417515 21:6486061-6486083 TTTTTTTTTTGGAAGGGGGAGGG + Intergenic
1176786985 21:13269259-13269281 TTTTATTTTTAGATGGAGCCTGG + Intergenic
1176909992 21:14553034-14553056 TTTTTTTTTTAAATATTGGAAGG - Intronic
1177550908 21:22621213-22621235 TTTTTTTTTTTTGTGGTGGAGGG - Intergenic
1177690168 21:24495578-24495600 TTTTCTTTTTATTTGGGGAAGGG - Intergenic
1177872042 21:26585745-26585767 TTTTCTTTTTTGACGGAGGTGGG + Intergenic
1177986147 21:27977897-27977919 TTTTTTTTTTAGATGGAGCCTGG + Intergenic
1178279714 21:31270979-31271001 TTGTCATTTTAGATGGAGGAGGG - Intronic
1178613292 21:34106928-34106950 TTTTTTTTTTTGGCGGTGGAGGG + Intronic
1178674474 21:34619214-34619236 TTTTTTTTTCAAATGGAGGAAGG + Intergenic
1178858375 21:36269030-36269052 TTTTCTTTTTAGGAGGTGGTGGG - Intronic
1178980012 21:37255863-37255885 TTTTTTTTTTAGATAGAGGCTGG + Intronic
1178995593 21:37396215-37396237 TTTTTTTTTTAGGTTGGGGATGG + Intronic
1179103299 21:38376086-38376108 TTTTCTTTTTAATTGGGGTAGGG + Intergenic
1179315793 21:40243390-40243412 TTTTCTTTTTCAATAGTGAAAGG + Intronic
1179439780 21:41385259-41385281 TTTTCCTTTTAGTTGAAGGAAGG + Intronic
1179693011 21:43094394-43094416 TTTTTTTTTTGGAAGGGGGAGGG + Intronic
1179774514 21:43652389-43652411 TTTTTTTTTTTGATGGTGTCTGG - Intronic
1180030183 21:45201566-45201588 TTTCCATTTTGGAAGGTGGAAGG + Intronic
1180436384 22:15308585-15308607 TTTTTTTTTTACATGGGGTAAGG - Intergenic
1180574841 22:16763717-16763739 CTTTCATTTTAGATTCTGGAGGG + Intergenic
1181519845 22:23439491-23439513 GTTTTTTTTTATATGGTGCAAGG + Intergenic
1181685400 22:24524476-24524498 TTTTCTTTTTTGGTGGAGTAGGG + Intronic
1182645744 22:31807895-31807917 TTTTCTTTTTTTAGGGGGGAGGG + Intronic
1183131920 22:35845384-35845406 TTTTTTTTTTGAATGGTGAATGG - Intronic
1183297719 22:37041505-37041527 TTTTTTTTTGAGATGGAGGCTGG - Intergenic
1183804128 22:40193846-40193868 TTTTTTTTTTGGAGGGTGGGTGG - Intronic
1184570350 22:45319674-45319696 TATTATTAATAGATGGTGGAGGG + Intronic
1184849394 22:47111555-47111577 TTTTCTCGTGAGATGGAGGAAGG + Exonic
1185120547 22:48966038-48966060 TTTTCTTTTTTGGAGGGGGAAGG - Intergenic
949161066 3:882576-882598 TTTTCATTTTAGCTGGGGCAGGG - Intergenic
949358100 3:3202845-3202867 TTTTTTTTTTTGGTGGTGGTTGG - Intergenic
949372500 3:3350792-3350814 TTTTTTTTTTAAATGGTGTGAGG + Intergenic
949782302 3:7703443-7703465 TTTTTTTTTAATCTGGTGGATGG + Intronic
950430093 3:12945518-12945540 TTTTTTTTTTGGAGTGTGGAAGG - Intronic
950547475 3:13647023-13647045 TTTTGTTTTGAGATGGGGGGGGG + Intergenic
950942408 3:16906054-16906076 TTTTTTTTTTTTATGGAGGAAGG - Intronic
950945621 3:16942736-16942758 TTTGCTTTTAAGGAGGTGGAAGG - Intronic
951712220 3:25594826-25594848 TTTTTTTTTTAGAGGGGGGAGGG - Intronic
951761485 3:26152235-26152257 TTTTATTTTTTGATTATGGATGG - Intergenic
952047557 3:29341795-29341817 TTATTATTTTAGATGGTGGGAGG - Intronic
952079660 3:29742729-29742751 TTTTCTTTTTCTTTGTTGGATGG + Intronic
952207010 3:31190343-31190365 TTTTTTTTTTAGTTGGGGGGTGG - Intergenic
952271727 3:31839463-31839485 TTGTCTTTTTAGGGGGTGGTGGG - Intronic
952304314 3:32132146-32132168 TTTTCTTTTTACTTGCTTGATGG + Intronic
952358500 3:32606376-32606398 TTTTCTTTTGAGATGGAGGCTGG - Intergenic
952822026 3:37494039-37494061 GTTTCTTTTTGGATGGTAGGAGG + Intronic
953043392 3:39274470-39274492 TTTTTTTTTTTGGTGGTGGTTGG - Intronic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
953168769 3:40488654-40488676 TTTTTTTTTTAGGGGGTGGGGGG + Exonic
953528171 3:43712922-43712944 ATTTCTTCTTTGCTGGTGGAAGG - Intronic
954016588 3:47697310-47697332 TTTTTTTTTTAGATGGAGTCTGG + Intronic
955061919 3:55499968-55499990 TTTTTTTTTTGGAGGGGGGATGG - Intergenic
955635864 3:61028878-61028900 TTTTTTTTTTTGTTGGTGGGGGG - Intronic
955637033 3:61041362-61041384 TTTTTTTTTTAGATGGAGCCAGG - Intronic
955698020 3:61656048-61656070 TTTTCTTTAGAGATGGTCGGGGG - Intronic
955877019 3:63501482-63501504 TTTTTTTTTTGGTTGGGGGAGGG - Intronic
956107936 3:65841455-65841477 TTTTTTTTTGAGATGCAGGATGG + Intronic
956427970 3:69156226-69156248 TTTTCTTTTTAGCTTCTAGAAGG - Intergenic
956618662 3:71198702-71198724 TTTTTTTTTGAGATGGAGCACGG + Intronic
956619196 3:71203824-71203846 TTTTCTTTTCGGATGGGGGGTGG - Intronic
957201610 3:77143195-77143217 TTTTTTTTTTAGATGGAGTCTGG + Intronic
957401708 3:79724251-79724273 TTTTATTTTAAGATGGTTAATGG + Intronic
957608395 3:82434110-82434132 TTATCTTTGTATATGGTGTAAGG + Intergenic
959153872 3:102642126-102642148 TTTTCTGTTCACATAGTGGAAGG - Intergenic
959324888 3:104924773-104924795 TTTTCTTTTTAAATGTTCAAAGG + Intergenic
959360703 3:105387381-105387403 TTTTCTCTTTAGATGTTTGAAGG + Intronic
959952130 3:112191778-112191800 TTTTCTTTCTATATGGTGTGAGG + Intronic
960324060 3:116273345-116273367 TTTTCTATTAAGATGGAGGCAGG - Intronic
960379087 3:116938270-116938292 TTTTGTGATTAGAGGGTGGAGGG - Intronic
961007155 3:123412779-123412801 TTTTGTTTTTAGCTTGAGGAAGG - Intronic
961939279 3:130620592-130620614 TTTTCTTTAAAGATGAAGGAAGG + Intronic
961969114 3:130940924-130940946 TTTTTTTTTTAGATGGAGTCTGG + Intronic
961969660 3:130947238-130947260 TTTTTTTTTAATGTGGTGGATGG - Intronic
962275699 3:134011781-134011803 TTGTCCTTTTAGAGGCTGGAGGG + Intronic
962569607 3:136699554-136699576 TTTTTTTTTTTTATGGTAGATGG + Intronic
962733217 3:138301765-138301787 ATTTCTTTGTGGATGGTGGGTGG - Intronic
962893586 3:139694016-139694038 CTTTCTATTTGGATTGTGGAAGG + Intergenic
963647244 3:147930306-147930328 TTTCCTTTTTGGATGGTGGGAGG + Intergenic
963685845 3:148432954-148432976 TTTACTTTTTACATCGAGGAAGG + Intergenic
964082501 3:152776610-152776632 TTTTTTTTCTAGATGGTGTCTGG + Intergenic
964333404 3:155628558-155628580 TTTTTTTTTGAGTTGGGGGAGGG + Intronic
964347905 3:155772901-155772923 CTTTCTTGTTTGATGGTGGTGGG + Intronic
964483657 3:157165269-157165291 TTTTTTTTTTAAAGGGGGGATGG - Intergenic
964649886 3:158998866-158998888 TTTTCTCTTTTTTTGGTGGAGGG - Intronic
965055891 3:163715675-163715697 TTTTATTTTTGGGGGGTGGAGGG - Intergenic
965058277 3:163749590-163749612 TTTTTTTTTTTGGTGGTGGGGGG + Intergenic
965464015 3:169004489-169004511 TTTTGTTTTCAGGTGGAGGAAGG - Intergenic
965827770 3:172747902-172747924 TTTTTTTTTGAGATGGGGGCTGG + Intergenic
965830646 3:172784143-172784165 TTTTTTTTTTAAATTGTGGCCGG + Intronic
965831298 3:172792715-172792737 TTTCCTTTTTTTTTGGTGGAGGG + Intronic
965902639 3:173661563-173661585 TTCTTTTTTCAAATGGTGGAAGG - Intronic
965928604 3:174014180-174014202 TTTTCTTTTTATATGTTTCACGG - Intronic
966788553 3:183642594-183642616 TTTTTTTTTTTTTTGGTGGAAGG - Intronic
967656474 3:192056279-192056301 TTTTTTTTTCAGGGGGTGGATGG - Intergenic
967697680 3:192552445-192552467 TTTTCTATTTACATGGTTTAGGG - Intronic
968356336 3:198110463-198110485 TTTTGTTTTGAGATTGGGGATGG + Intergenic
968772330 4:2515287-2515309 TTTTCTTTTCACATAGAGGAGGG - Exonic
969154274 4:5196349-5196371 TTTTTTTTTTTGGTGGTGGGGGG + Intronic
969966843 4:11005289-11005311 TTCTGTCTTTACATGGTGGAAGG + Intergenic
970076745 4:12230848-12230870 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
970181407 4:13399944-13399966 TTTTCTACTTAGAATGTGGAAGG - Intronic
970230743 4:13908238-13908260 TTTTTTCTTTTCATGGTGGATGG + Intergenic
970341081 4:15107563-15107585 TTTTCATGTGAGATGGGGGAAGG + Intergenic
971172396 4:24247193-24247215 TTTTCTTTTTGGGGGGTGGTGGG - Intergenic
971380884 4:26096472-26096494 TTTTCTTTTTTGGTGGAGGGAGG + Intergenic
971732095 4:30397514-30397536 TATTCTTTTTAGATGTCGAACGG - Intergenic
971790509 4:31164462-31164484 TTTTCTTTTTAGATTTTGCAAGG + Intergenic
972502339 4:39690425-39690447 TTTTCTTTTTTTTTGGTGGAGGG + Intergenic
972967801 4:44533508-44533530 TTTTTTTTTTTTTTGGTGGAAGG - Intergenic
974072222 4:57134722-57134744 TTTTTTTTTGAGATGGAGGCTGG + Intergenic
974078941 4:57193535-57193557 TTGTGTTTTTGGATGGTGGCCGG + Intergenic
975574610 4:75850238-75850260 TTTTTTTTTGAGACGGAGGACGG - Intergenic
976626595 4:87190830-87190852 TTGTGTCTTCAGATGGTGGAAGG + Intronic
977015470 4:91687453-91687475 TTTTTTTTTTTTATGGTGAAAGG + Intergenic
977173172 4:93787629-93787651 TTTTCTTTCATTATGGTGGAAGG - Intergenic
977419119 4:96775111-96775133 TAGTCTTTTTATCTGGTGGATGG + Intergenic
977516724 4:98029954-98029976 TTTTCATGGTAGATGGTGGAAGG + Intronic
977975432 4:103259424-103259446 TTTTCTTTTTTGATGGTAATTGG + Intergenic
978784755 4:112597200-112597222 TTTTTTTTTTAGATGGAGTTTGG - Intronic
979261590 4:118653569-118653591 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
979585809 4:122415570-122415592 GTTTCTTTGGAGATTGTGGATGG + Exonic
979973949 4:127172717-127172739 TTTTTTTTTTTGCTGGTGGAGGG - Intergenic
980150208 4:129037428-129037450 TTTTCTGTTGATATGGTGGCTGG + Intronic
980839991 4:138246928-138246950 TTTATTTTTTATTTGGTGGATGG - Intergenic
981786943 4:148490144-148490166 TCTGCTTTTTAGATGGGGGGTGG + Intergenic
982307245 4:153945322-153945344 TTTTATTTTTTAATGGGGGAAGG + Intergenic
982538531 4:156638372-156638394 TTTTCATTTCATATTGTGGATGG + Intronic
982693044 4:158569797-158569819 TGTTCTTTTTTGTTGGTGGGGGG + Intronic
982912335 4:161159782-161159804 TTTTTTTTCTAGCTTGTGGAGGG + Intergenic
983389439 4:167110369-167110391 ATTTCTTTTTAGGTGATGGAGGG + Intronic
984691025 4:182726210-182726232 TTTCCTTTGTAGTTGGGGGAGGG - Intronic
984835917 4:184020870-184020892 TTTACATTTTAGATGCTGGTTGG - Exonic
984839633 4:184056496-184056518 TTTTTTTTTTTGATGATGGTTGG - Intergenic
985819973 5:2153109-2153131 TTTTTTTTTTTTTTGGTGGATGG - Intergenic
986025908 5:3850864-3850886 TTTTCTTTCTGTATGGTTGAAGG - Intergenic
986256355 5:6104105-6104127 TTTTGTCTTCATATGGTGGAGGG + Intergenic
986314628 5:6578295-6578317 TGTTCATTTTAGAGGATGGATGG - Intergenic
987069471 5:14322262-14322284 ATTTCTTTTAAAATGGGGGAGGG + Intronic
987242752 5:16017515-16017537 TTTTTTTTTTAAAGGCTGGATGG - Intergenic
987273903 5:16341912-16341934 TTGTCATTTCATATGGTGGAAGG - Intergenic
987314248 5:16709535-16709557 TTTTCTTTCTAGTTGTTGGCTGG - Intronic
987586349 5:19861809-19861831 TTTTCTTTATAGTGGGTGGGAGG + Intronic
987608563 5:20171889-20171911 TTTTTTTTTTATATGGTGTAAGG + Intronic
987885941 5:23812273-23812295 TTTTATTTTTAGGGGGTGAAAGG + Intergenic
987920122 5:24268912-24268934 TAATCTTTTTTGCTGGTGGAGGG - Intergenic
987942778 5:24563767-24563789 TTTTTTTTTTTTTTGGTGGAGGG - Intronic
988032868 5:25787585-25787607 ATTTCTTTTTTGTTGGTTGATGG + Intergenic
988335070 5:29897027-29897049 TTTTCTTTTTTTGTGGGGGAGGG + Intergenic
988445191 5:31278381-31278403 TTTTCTTGTTAGTTTGTGCACGG - Intronic
988641241 5:33042332-33042354 TTTTCTTTTAAAAGGTTGGAAGG - Intergenic
988696234 5:33625160-33625182 TTCTCTGTTTAGCTGGTAGAGGG - Intronic
989115832 5:37951565-37951587 TTTTTTTTTGAGATGGGGGAGGG + Intergenic
989305433 5:39949713-39949735 TTTTCTTTTGAGATGGAGTCTGG - Intergenic
989385516 5:40851317-40851339 TTTTTTTTTTAGATGGAGTCTGG - Intronic
989446228 5:41532714-41532736 TTTTATTTGTAGAGGGTTGACGG - Intergenic
989773671 5:45175712-45175734 TTTTATTTTTTGATGGTGTTCGG + Intergenic
989793502 5:45437394-45437416 TTTTCTTTATAGATAATGAAAGG + Intronic
989950054 5:50286515-50286537 TTTTCTTTTGATATGGAGAAGGG - Intergenic
990278302 5:54223201-54223223 TTTTTTTTTTACATGGTGGGAGG - Intronic
990283554 5:54277264-54277286 TTTTCTTTTTTGCGGGGGGAGGG - Intronic
990444240 5:55879197-55879219 TGTTCTCTTTAGTTGGTAGAAGG + Intronic
990891400 5:60654362-60654384 TTTTCTTTTTTTTTGGTGGGGGG + Intronic
991189634 5:63854542-63854564 TTTTTTTTTTAAATCATGGATGG - Intergenic
991359766 5:65807331-65807353 TAATCTTTTTTGCTGGTGGAGGG - Intronic
991402446 5:66266807-66266829 TTTATTTTTTAGATCGTGAAAGG + Intergenic
991438433 5:66620056-66620078 TTTTTTTTTTTGATGGAGTAAGG + Intronic
991486402 5:67141384-67141406 TTTTCTCTTTATATGGGGTATGG + Intronic
992062054 5:73062136-73062158 TTTTATTTTTTGCTGGTGGTGGG - Intronic
992430166 5:76702994-76703016 TTTTCTTTTTTGTGGGGGGAGGG + Intronic
992430198 5:76703135-76703157 TTTTCTTTTTTGTGGGGGGAGGG + Intronic
992523158 5:77577313-77577335 TTTTCTTTTTTTTTGGTGGGGGG - Intronic
992697652 5:79306128-79306150 TTCTCTTTTTTGAAGGAGGAGGG - Intronic
993364205 5:87016858-87016880 TTTTCTTTTTAGGTGGGGAGGGG - Intergenic
993400003 5:87437507-87437529 TTTTCTTTTGAGATGGAGTCTGG - Intergenic
993593179 5:89821499-89821521 TTTTCTTTTTATATGGTGAAAGG + Intergenic
993624277 5:90205288-90205310 TTTTATTTTTTGATTGTTGAAGG - Intergenic
994246620 5:97486017-97486039 ATTTCTTTTTAAATCCTGGAGGG - Intergenic
994896224 5:105706912-105706934 TTTTTTTTTAAGATGGAGGAAGG + Intergenic
994996386 5:107068669-107068691 TTTTCTATTTTTTTGGTGGAGGG + Intergenic
995458306 5:112375358-112375380 TTTTTTTTTTAAATAGAGGAAGG - Intronic
995661757 5:114491846-114491868 TGTTCTTTTTAGGGGGTGTAGGG + Intronic
995672364 5:114621069-114621091 TTTACATTTTAAATGGTTGAAGG - Intergenic
995728573 5:115210179-115210201 TTTTTTTTTTAGAAGGTAGGAGG - Intergenic
995965309 5:117899609-117899631 TAATTTTTTTAGATGGTGCAGGG + Intergenic
996273111 5:121632505-121632527 TTTTTTTTTTTTTTGGTGGAGGG - Intergenic
996373469 5:122777045-122777067 TTTTCTTTTTAAATTTGGGAAGG + Intronic
996887676 5:128377539-128377561 TTTTTTTTTTTGGTGGTGGAGGG - Intronic
997414013 5:133711314-133711336 TGCTCTTTTTAGATGGGGGCTGG - Intergenic
997478590 5:134165028-134165050 TTTTTTTTTTTGAGGGGGGAGGG + Intronic
997498380 5:134350600-134350622 TTTTATTTTGAGGTGATGGATGG - Intronic
997742822 5:136272408-136272430 ATTTCTTTCTAAATGGTGAAAGG + Intronic
997942722 5:138172850-138172872 TTTTTTTTTTGAATGGCGGAGGG - Intronic
998579565 5:143357663-143357685 TTTTCTTTTTATGTTGTGCAAGG + Intronic
998637743 5:143974677-143974699 TTTGCTTTTTAGAAAGTGCATGG + Intergenic
998832897 5:146178608-146178630 TTTTTTTTTTTGGTGGGGGATGG - Intronic
999540206 5:152563368-152563390 TTTTTTTATTACATGGTTGATGG + Intergenic
999796851 5:154996855-154996877 TTTTTTTTTTTGATGAGGGAGGG + Intergenic
999856758 5:155603292-155603314 TAATCTTTTTTGCTGGTGGAGGG + Intergenic
1000457968 5:161475773-161475795 TTTCCTTTTTAGTTTGTTGAGGG - Intronic
1000540948 5:162538972-162538994 TTTTTTTTTTTAATGGTGTAAGG - Intergenic
1000719784 5:164692540-164692562 TGTTCTTTGAAGATGGAGGAGGG + Intergenic
1000847154 5:166296084-166296106 TTTTTTTTTGAGATGGAGGCTGG - Intergenic
1000989794 5:167900099-167900121 TTTTTTTTTTAGTGGGTTGAGGG - Intronic
1001360696 5:171083329-171083351 TTCTCTCCTTACATGGTGGAAGG - Intronic
1001582075 5:172805793-172805815 TTTCCTTTAGAGATGGAGGAGGG + Intergenic
1001895230 5:175373379-175373401 TATTTTTTTTATATGGTGTAAGG + Intergenic
1002113601 5:176938939-176938961 TTTTTTTTTTAAATGGTGCTAGG - Intronic
1002371356 5:178757558-178757580 TTTGCATTTGAGCTGGTGGATGG + Intergenic
1002661956 5:180797395-180797417 TTTTTTTTTTTGGTGGGGGATGG - Intronic
1002678387 5:180937930-180937952 TTTTTTTTTTAAATGGGGAAAGG - Intronic
1002682005 5:180972876-180972898 TCTTATTTTTACATGGTAGAAGG - Intergenic
1002732151 5:181346686-181346708 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
1002752380 6:127419-127441 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
1002837213 6:875020-875042 TGTTATTTTTAGAAGATGGAGGG + Intergenic
1003093805 6:3126588-3126610 TTTTTTTTTTTTTTGGTGGAGGG + Intronic
1003501591 6:6707721-6707743 TTTTCTTTGGTGATGGAGGATGG - Intergenic
1003603174 6:7536983-7537005 TTTTCATTTTTGCTGGGGGAGGG - Intergenic
1003714751 6:8633908-8633930 TTTTGTTTTCAGTTAGTGGAGGG + Intergenic
1003871612 6:10408244-10408266 TTTTCTTAAAAGATGGGGGAGGG + Intronic
1003904943 6:10690589-10690611 TTTTCTTCTTGGGTGGTTGAGGG - Intronic
1003912915 6:10758927-10758949 TTTTTTTTTGAGATGGAGTATGG + Intronic
1004013845 6:11714396-11714418 TTTTTTTTTTTTCTGGTGGAGGG - Exonic
1004069951 6:12288773-12288795 TTTTGATTTTAGAAGGAGGAGGG + Intergenic
1004679019 6:17874279-17874301 TTTTGTTTTTTGGTGGTGGTGGG + Intronic
1005307565 6:24528711-24528733 TTTTTTCTTGAGATGGAGGATGG + Intronic
1005385539 6:25280590-25280612 TTTTTTTTTTTGGTGGTGGTGGG + Intronic
1005393098 6:25353849-25353871 TTTTCATTTTAGCTTCTGGAGGG + Intronic
1005404507 6:25472125-25472147 TTTTTTTTTTAAATTATGGAGGG + Intronic
1007901148 6:45414148-45414170 TCTCCTTTTTAGATGAAGGAAGG + Intronic
1008218802 6:48828558-48828580 TTTTTTTTTTACCTGGTAGAAGG - Intergenic
1008280551 6:49590945-49590967 TTTTTTTTTTTGGTGGTGGGGGG + Intergenic
1008331968 6:50256319-50256341 TTTATTTTTTAGATGGTGTAAGG + Intergenic
1008476992 6:51943386-51943408 TTTTTTTTTTTTTTGGTGGAAGG - Intronic
1008904109 6:56657514-56657536 TTTCCTTTTTAAATTGAGGAAGG - Intronic
1008929431 6:56922963-56922985 TTTTGTTTTTAGATTGTGCTAGG - Intronic
1008941922 6:57056547-57056569 TTTTTTTTTTGGATGGGAGAGGG + Intergenic
1009734561 6:67660329-67660351 ATTTTTTTTTATATGGTGTAAGG + Intergenic
1010145976 6:72669917-72669939 TTTTTTTTTTGGAATGTGGATGG + Intronic
1010224081 6:73473349-73473371 TTTTCTTGTTATTTAGTGGATGG + Exonic
1010476003 6:76288146-76288168 TTTTCTTTTTTTTTGGTGGGGGG + Intergenic
1010577359 6:77549092-77549114 TTTTTTTTTTAGATGGGGTCTGG + Intergenic
1010969241 6:82247061-82247083 GATTCTTTTTGGAGGGTGGAGGG - Intronic
1011096109 6:83665400-83665422 TTTCTTTTTTTGATGGAGGAAGG - Intronic
1011188896 6:84709702-84709724 CTTTCTTTATAGATGGTTAATGG - Intronic
1011422615 6:87189633-87189655 TTTTTTTTTTACAGGGTGGGGGG + Intronic
1011639018 6:89402050-89402072 TTTTTTTTTTTGGTGGGGGATGG + Intronic
1011842401 6:91517626-91517648 TTTTCCTTTTCAATGCTGGACGG - Intergenic
1012692432 6:102331053-102331075 TCTTCTTTTTAAATGTTGGCTGG - Intergenic
1012711980 6:102618150-102618172 TTTTTTTTTTAACTGGTGGAGGG - Intergenic
1012920518 6:105217641-105217663 TTTTTTTTTTTTCTGGTGGAGGG + Intergenic
1013050099 6:106524548-106524570 TTTTCTTTTGAGATGGAGTCTGG - Intronic
1013146329 6:107397185-107397207 TTTTTTTTTTTGGTGGTCGAGGG + Intronic
1013328229 6:109069723-109069745 TTTTTTGTTGAGATGGTGGGAGG + Intronic
1013452656 6:110300430-110300452 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1013542304 6:111122681-111122703 TTTTCTTTTTTGGTGGTGGTGGG + Intronic
1013723550 6:113063038-113063060 TTTTCTTTTTAGTTTGTTGGGGG + Intergenic
1013943893 6:115699018-115699040 TATTTTTTTTTGCTGGTGGAGGG - Intergenic
1013949393 6:115761269-115761291 TTTTCTTTTTTTATCATGGAAGG - Intergenic
1013993130 6:116277895-116277917 TTTTTTTTTGAGACGGAGGACGG - Exonic
1014051321 6:116958819-116958841 TAATATTTTTATATGGTGGAAGG - Intergenic
1014060843 6:117070099-117070121 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1014284419 6:119480480-119480502 TTTTTTTTTTTGGTGGAGGAGGG + Intergenic
1014776535 6:125517277-125517299 TTTTTTTTTTAGAGGGTGGAGGG + Intergenic
1015186369 6:130421000-130421022 GATTCTTTTTGGAAGGTGGAAGG - Intronic
1015190991 6:130472206-130472228 TTCTTTTTTTACATGGTGGTAGG - Intergenic
1015537779 6:134283862-134283884 TTTTTTTTTTTGGTGGTGGCAGG - Intronic
1015720678 6:136237802-136237824 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1015956504 6:138604192-138604214 TTTTCTTTTTAGTTGACTGATGG - Intronic
1015974155 6:138772787-138772809 TTTTTTTTTTAAATGGCGGGTGG + Intronic
1016168302 6:140975421-140975443 TTTTTTTTTTTGGTGGGGGATGG + Intergenic
1016404680 6:143717572-143717594 TTTTTTTTTTTGGTGGGGGAAGG + Intronic
1016656963 6:146529969-146529991 TTTTCTTACTACATGGAGGATGG + Intergenic
1016786685 6:148018401-148018423 TTTTCTTTTCATATGGGGGCTGG - Intergenic
1017032020 6:150232589-150232611 TTGTCTTTGTATATGGTGTAAGG + Intronic
1017056712 6:150443277-150443299 ATTTTTTTTTTGAGGGTGGATGG - Intergenic
1017145582 6:151231344-151231366 TTTTTTTTTGAGATGGTGCCTGG - Intergenic
1017195147 6:151692504-151692526 TTTTTTTTTTACAGTGTGGATGG - Intronic
1017363248 6:153602147-153602169 TTGTGTTCTTACATGGTGGAAGG + Intergenic
1017723322 6:157259333-157259355 TATTCTGTTGAGATGGTGGAAGG + Intergenic
1017870584 6:158483327-158483349 TTTTCTTTTTATTGGGGGGATGG + Intronic
1017910330 6:158786713-158786735 TTTTCTTTTTGGTTGGTTAATGG + Intronic
1017969313 6:159297817-159297839 GTTGCTTTGTAGATGGAGGAAGG - Intergenic
1018020054 6:159753843-159753865 TTTTGTTTTTAGTTGGGGGTAGG + Intronic
1018257146 6:161932546-161932568 TTTTATTTTTACATGCTCGAGGG + Intronic
1018516653 6:164587496-164587518 TTTTATTTTTAAATGGTGAATGG + Intergenic
1018609939 6:165638179-165638201 TTTTCTTTTTTGGTGGGGGGAGG - Intronic
1019189254 6:170241332-170241354 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1019236403 6:170618999-170619021 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
1019591414 7:1836791-1836813 GTTTTTTTTTATATGGTGCAAGG - Intronic
1019699072 7:2464286-2464308 TTTTTTTTTTAGATGGTGGGGGG + Intergenic
1019833547 7:3358020-3358042 TTTTCTTTTTTTTTGGGGGATGG + Intronic
1019849295 7:3538346-3538368 TTTTGTTTTTAAATCTTGGAAGG + Intronic
1020382533 7:7562778-7562800 TTTTGCTTTTAGATGGAGGCTGG - Intergenic
1020415168 7:7937283-7937305 TTTTTTTTTTTGAAGGAGGACGG + Intronic
1020478538 7:8628376-8628398 TTTTTTTTTTAGATAATGTATGG + Intronic
1020799551 7:12717042-12717064 GTTTTTATTTAGATGGTGTAGGG + Intergenic
1021024394 7:15645507-15645529 TTTTCTTTTAAGATGGATGTTGG + Intronic
1021071062 7:16241738-16241760 TTTACTTTTTGGATGTGGGAAGG + Intronic
1021254752 7:18377180-18377202 TTACCTTTTCACATGGTGGATGG + Intronic
1021482946 7:21137776-21137798 TTTTCTTTTTAGTTGCTGGAGGG + Intergenic
1022062669 7:26814552-26814574 TTTTTTTTTTTGCTGGTGTAAGG - Intronic
1022406051 7:30091318-30091340 TTTTATTTTTTAATGGAGGATGG + Intronic
1023223799 7:37948350-37948372 TTTTTTTTTTTGATGGTGGACGG + Intronic
1023527560 7:41120639-41120661 TTTTCTTTTGAGATGGAGTCTGG + Intergenic
1024110820 7:46144831-46144853 TCTCCTCTTTAGATGGTGGAGGG - Intergenic
1024151330 7:46574558-46574580 TTATTTTTGTATATGGTGGAAGG - Intergenic
1025264838 7:57448101-57448123 TCTTCTTTTTAGACCGTGTAAGG + Intergenic
1025269876 7:57500516-57500538 TTTTCTTTTGAGATGGAGTTTGG + Intergenic
1025727493 7:64080895-64080917 TTTTTTTTTGTGGTGGTGGAGGG + Intronic
1025775393 7:64556605-64556627 TTTTTTTTTTATATGGTGTAAGG - Intronic
1026075977 7:67168721-67168743 TTTTCTTTTAAGATGGAGTCTGG + Intronic
1026277820 7:68895571-68895593 TTTTATTTTTAGATGGATCATGG - Intergenic
1026375107 7:69742120-69742142 TTTTTTTTTTTGAGGGGGGAGGG + Intronic
1026419886 7:70223630-70223652 TTTTCTTTTTAACTAGTAGAAGG - Intronic
1026583886 7:71640325-71640347 TTTTTTTTTTAGATGATGGCTGG + Intronic
1026587534 7:71668503-71668525 TTTTTTTTTGAGATGGTGTCTGG - Intronic
1026621190 7:71951193-71951215 TTTTCTTTTTATATGGCATAAGG + Intronic
1026622199 7:71959627-71959649 TTTTTTTTTTAAGTGGGGGAAGG + Intronic
1026696140 7:72593808-72593830 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1026700877 7:72643573-72643595 TTTTCTTTTAAGATGGAGTCTGG - Intronic
1026920384 7:74151212-74151234 TTTTCTGTAGAGATGGGGGATGG - Intergenic
1027164355 7:75823865-75823887 TTTTCTTTTTTTCTGGTGGGGGG + Intergenic
1027421934 7:78025224-78025246 TGTTCTTTTTAGATAGTTGTGGG - Intronic
1027573626 7:79903722-79903744 TAATCTTTTTTGCTGGTGGAGGG - Intergenic
1027679242 7:81198581-81198603 TTTTCTTTTGAGATTGGAGATGG + Intronic
1028165907 7:87538387-87538409 TTTTCTTTCTAAATGGTGATGGG + Intronic
1028310286 7:89323876-89323898 TGTTCTCTTTAAATGGAGGAAGG + Intronic
1028431993 7:90758294-90758316 TTTTATGTTTAGATGGGGGGTGG + Intronic
1029327371 7:99821899-99821921 TTTTCCTTTAAAATGGTGGGGGG + Intergenic
1030421051 7:109306707-109306729 TTGTCACTTTACATGGTGGAAGG + Intergenic
1030507619 7:110444819-110444841 TTTTCTTTTTTGAAGGGGGATGG - Intergenic
1030868295 7:114726637-114726659 TTTTTTTTTTTTTTGGTGGAGGG + Intergenic
1031147189 7:118009568-118009590 TTTTCTTTTTGAATGGTGAATGG - Intergenic
1031553380 7:123142645-123142667 TTTTTTTTTTTGATGGAGGCTGG + Intronic
1031830690 7:126621719-126621741 TTTTTTTTTTAAATGGTGATTGG - Intronic
1032235341 7:130117220-130117242 TAATCTTTTTTGCTGGTGGAGGG + Intronic
1032567578 7:132963133-132963155 TTTTTTTTTTATTTGGGGGAGGG - Intronic
1032580944 7:133103154-133103176 TTTTCTTTTTTTTTGGTGGGGGG + Intergenic
1032639753 7:133752723-133752745 CTTTCTTTTTTGATGGGGTATGG + Intronic
1032808751 7:135386160-135386182 TTTTTTTTTTTGATGGGAGAAGG + Intronic
1032826237 7:135571284-135571306 TTTTTTTTTAAGATCGAGGAAGG + Intronic
1032939442 7:136771912-136771934 TTTTCTTTTTTTTTGGTGGCGGG + Intergenic
1032993482 7:137420169-137420191 CTTTCTTATAAGATGGTGGCTGG + Intronic
1033211161 7:139461233-139461255 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1033391835 7:140936211-140936233 TTGTCTTTTTGGATGGAGGTTGG + Intergenic
1033794661 7:144833473-144833495 TTTTGTTTTGAGATGGAGGATGG + Intronic
1033876746 7:145829396-145829418 TTTTTTGTTGAGATTGTGGAGGG - Intergenic
1034013581 7:147557250-147557272 TTTTCTTTTGAGATGGAGTCTGG - Intronic
1034298499 7:149994856-149994878 TTTTTTTTTGAGATGGAGTATGG + Intergenic
1034703331 7:153116921-153116943 TTTTCTTCTTAGATCTTGAAAGG + Intergenic
1034796058 7:154014753-154014775 CTTTGTTTTTAGAACGTGGAGGG - Intronic
1034807517 7:154101922-154101944 TTTTTTTTTGAGATGGAGTATGG - Intronic
1035359142 7:158298817-158298839 TTTACTTTTTTGAAGGTGGGAGG - Intronic
1035511368 8:187608-187630 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
1035681938 8:1494714-1494736 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1035957608 8:4099601-4099623 TTTTTTTTTTAATTGGGGGATGG - Intronic
1036513619 8:9422864-9422886 TTTTTTTTTTTTTTGGTGGACGG - Intergenic
1036528886 8:9562822-9562844 TTTTCTTTCTAGATGGGCAAAGG + Intronic
1036530399 8:9580147-9580169 GTTTCTTTTTAGGTTTTGGAAGG + Exonic
1037221990 8:16534872-16534894 TTTTATTTTTAAATGGTGTTAGG + Intronic
1037283725 8:17273035-17273057 TTTTTTTTTTTTTTGGTGGAGGG + Intronic
1037310136 8:17546743-17546765 TTTGCTTTTTTGATGGTGGGTGG + Intronic
1037568490 8:20138466-20138488 TTTATTTTTTATATGGTGGGAGG - Intergenic
1038851051 8:31276708-31276730 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1038989653 8:32854108-32854130 TTTTCTTTTTAGAGGGAGGTGGG - Intergenic
1039114309 8:34075303-34075325 TTTTTTTTTTTGGTGGGGGACGG + Intergenic
1039328549 8:36511895-36511917 TTTTTTTTTTGGGTGGTGGAGGG - Intergenic
1039352339 8:36776608-36776630 TTTTTTTTTTTTTTGGTGGAGGG - Intergenic
1039355190 8:36807721-36807743 TTTTTTTTTTTTTTGGTGGAGGG - Intronic
1039372705 8:37002767-37002789 TTTTCTTTTGAGATGGAGCCTGG + Intergenic
1039645728 8:39280279-39280301 ATTTTTTTTTAAATGGTAGAAGG + Intronic
1039688299 8:39833235-39833257 TTTTCTATTTATAAGATGGACGG - Intronic
1039719606 8:40149241-40149263 TTGTCTTTGAAGATGGAGGAAGG - Intergenic
1039949116 8:42153663-42153685 TTTTTTTTTTTGGAGGTGGAGGG + Intronic
1040416343 8:47199001-47199023 TTTTCCTCTGAGAAGGTGGACGG - Intergenic
1040920080 8:52606332-52606354 TTATCTTTGTGGATGGTGAAAGG - Intergenic
1041366147 8:57107361-57107383 ATCTCTTTTTAGCTGGTGAAAGG - Intergenic
1041504110 8:58575232-58575254 TTTTCTTTTTGGTTGGGGAAAGG + Intronic
1041991002 8:63991627-63991649 CTTACTTTTAAGATGGAGGAGGG - Intergenic
1042752018 8:72168440-72168462 TTTTCTTTTTTGATCATTGATGG + Intergenic
1042802593 8:72736258-72736280 TTTTTTTTTTAAATGATAGAGGG - Intronic
1042853786 8:73243532-73243554 CTTTTTTTTGAGATGGAGGATGG + Intronic
1043237755 8:77890289-77890311 TTTTTTTTTTAGATTGGGGATGG - Intergenic
1043438572 8:80257176-80257198 ATTTCTATTTAGTTGGGGGAGGG - Intergenic
1043624093 8:82233045-82233067 TTTTTTTTTTTGATGGAGTATGG + Intergenic
1043636017 8:82383074-82383096 TTTTTTTTTGAGATGGAGTAAGG + Intergenic
1043910393 8:85857400-85857422 TTTTATTTTTAGGGGGTGGAAGG - Intergenic
1044119096 8:88372243-88372265 TTTTCTTTTTAAAGGCTGAATGG + Intergenic
1044208274 8:89518219-89518241 TTGTGTTTTTATATGGTGGAAGG + Intergenic
1044283722 8:90386684-90386706 TTCTCTTTTGAGATGGGAGATGG + Intergenic
1044664545 8:94622057-94622079 TTTTCTTTTGAGATGGAGTTTGG - Intergenic
1044943736 8:97370314-97370336 TTTTTTTTTTATATGGCTGATGG - Intergenic
1045081308 8:98628807-98628829 TTTTTTTTTTGGAGTGTGGAGGG - Intronic
1046196972 8:110878000-110878022 TTTTCTTTTTTTTTGGTGGGGGG - Intergenic
1046362216 8:113175811-113175833 ATTATTTTTTAGAGGGTGGAAGG - Intronic
1046713845 8:117545658-117545680 TTTTTCTTTCAGATGGTGGAGGG + Intergenic
1047070899 8:121342408-121342430 CCTTCTTTTTGGATGTTGGAAGG - Intergenic
1047271348 8:123362288-123362310 TTTTTTTTTTAGATAGAGGCAGG - Intronic
1048687517 8:136920267-136920289 TTGTCTTTGAAGATGGAGGAAGG + Intergenic
1049864596 8:144925868-144925890 TTTTCTCTTTAGATGTGGCAAGG - Intergenic
1050239086 9:3615200-3615222 TTATTTTTTTATATGGTGTAAGG + Intergenic
1050918081 9:11162524-11162546 TTTTTTTTTTACAGGCTGGAAGG + Intergenic
1051254844 9:15202721-15202743 TTTTTTTTTTTGGTGGGGGAGGG - Intronic
1051366027 9:16322046-16322068 TTTTTTTTTTAGATGGAGACTGG + Intergenic
1051381351 9:16462212-16462234 TTTTTTCTTTGGCTGGTGGATGG - Intronic
1051968303 9:22856520-22856542 TTTTATGTTTAGATGCTGGGGGG - Intergenic
1052588801 9:30464852-30464874 TTTTCTTATTAGATGTTGGATGG - Intergenic
1052753881 9:32521126-32521148 TTTTTTTTTGAGATGGTGTCTGG - Intronic
1052889857 9:33688446-33688468 TTTTCTTTTTAGAGTTTGGCTGG - Intergenic
1053015479 9:34659685-34659707 TGCTCTTTGTAGATGGTGGCTGG + Intronic
1053369999 9:37552793-37552815 CTCTGTTCTTAGATGGTGGAAGG + Intronic
1054877817 9:70114832-70114854 CTTTCTTTTTTGATGGAGGAAGG - Intronic
1054897103 9:70326617-70326639 TTTTTTTTTTAGCTGGGGGTAGG + Intronic
1055191537 9:73530418-73530440 ATTTCTTTATAGTGGGTGGAGGG + Intergenic
1055470408 9:76604982-76605004 TTTTTTTTTTAAGTGCTGGAGGG - Intergenic
1055864049 9:80790988-80791010 TTTTCTTTTTAGAAGGTCCCTGG - Intergenic
1056013400 9:82356194-82356216 TTTTTTTTTTAGATGTTTAAAGG + Intergenic
1056256224 9:84802263-84802285 TTTTCTTTTTAAAGTATGGAGGG - Intronic
1056275691 9:84992098-84992120 TTATTTTTCTAGTTGGTGGATGG + Intronic
1056290674 9:85140771-85140793 TTCTATTTATAGAAGGTGGATGG - Intergenic
1056312945 9:85359373-85359395 TTTTTTTCCAAGATGGTGGACGG - Intergenic
1056471537 9:86909168-86909190 TTTTCTTCTTGGATGGGGGTGGG + Intergenic
1056556089 9:87689101-87689123 TTTTTTTTTTATATGGTGAAAGG + Intronic
1057017621 9:91666455-91666477 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1057431520 9:94999107-94999129 TTTTCTCTTTGGATGGGAGAAGG - Intronic
1058710249 9:107672852-107672874 TTTTTTTTTGAGATGGTGTCTGG - Intergenic
1058758452 9:108105501-108105523 TTTTCTTTTTACTTGGAGTAAGG + Intergenic
1058928134 9:109689212-109689234 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1059092340 9:111373018-111373040 TTTTTTTTTGAGATGGTGTCTGG - Intronic
1059517891 9:114912868-114912890 TTTTCTTTTTAGCAAGTGGAGGG + Intronic
1059688697 9:116662699-116662721 TTTGCTTTTAAGATGGTGATAGG + Intronic
1059738353 9:117124797-117124819 TTTTTTTTTTTCATGGTGGCAGG - Intronic
1059983444 9:119798251-119798273 TCTTCTTTTTGGATCGTGGTTGG - Intergenic
1060016262 9:120088885-120088907 TTTTTTTTTTAAATTGTGGTTGG + Intergenic
1060293115 9:122322693-122322715 TCTTCTGTGTAGATGGGGGAGGG - Exonic
1060800675 9:126543536-126543558 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1061122733 9:128653997-128654019 TTTTCTTTTGAGATGGAGTCTGG - Intronic
1061127722 9:128687606-128687628 TTTTTTTTTTTGGTGGGGGAGGG - Intronic
1061278893 9:129585789-129585811 TTTTTTTTTCTGGTGGTGGAGGG + Intergenic
1061691217 9:132332942-132332964 TTTTTTTTTAAGATGGTTAAGGG + Intronic
1062001370 9:134217380-134217402 TTTTCTTTTCAGATGGTACAGGG - Intergenic
1062756553 9:138299011-138299033 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
1185757579 X:2663947-2663969 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1185874190 X:3688683-3688705 TTTTTTTTATAGATGGTGTCTGG - Intronic
1185878641 X:3720709-3720731 TTTTCTTTTTAAATGGAGATGGG - Intergenic
1186395444 X:9204006-9204028 TTTTTTTTTTTACTGGTGGAGGG - Intergenic
1186671489 X:11771569-11771591 TTTTCTTTTTTCTGGGTGGAGGG + Intronic
1186757911 X:12692189-12692211 ATTTCTTTTAAAATGTTGGAAGG + Intronic
1186958329 X:14707568-14707590 TGGTTTTTTTAGAGGGTGGAGGG - Intronic
1187416260 X:19095839-19095861 TTTTTTATTGAGATGGGGGAGGG - Intronic
1187736510 X:22310416-22310438 TTTTTTTTTTAAATGATGAATGG + Intergenic
1187832237 X:23394062-23394084 TTTTTTTCTTAGAGGGTGGCAGG - Exonic
1187876362 X:23807229-23807251 TTTGCTTATTAGCTGGTGGGAGG - Intergenic
1188013840 X:25086069-25086091 ATTTATTTTTAGGGGGTGGAGGG + Intergenic
1188195131 X:27223679-27223701 TTTTTTTTTGAGATGGTGTCTGG - Intergenic
1188531977 X:31152191-31152213 TTTTTTTTTGAGATGGAGGCTGG + Intronic
1188770230 X:34145438-34145460 TTTTCTTTTTAAAGGCTGAATGG - Intergenic
1189047497 X:37609194-37609216 ATTTCTTTTTAGCAGGTGGAAGG - Intronic
1189288008 X:39865939-39865961 GTTTTTTTTTAGGTGGGGGAGGG - Intergenic
1190501904 X:51087585-51087607 ATTCCTCTTTAGATGGTGGATGG + Intergenic
1191086844 X:56577388-56577410 TTATTTTTTTATATGGTGAAAGG + Intergenic
1191206557 X:57840284-57840306 ATTTTTTTTTACATGGTGTAAGG + Intergenic
1191210470 X:57879448-57879470 TTTTTTTTGTATATGGTGAAAGG - Intergenic
1191664334 X:63683092-63683114 TTTTCTTTTTAATTTTTGGAGGG - Intronic
1192000148 X:67141044-67141066 TTTTTTTTTTAATTGGGGGATGG + Intergenic
1192598797 X:72439701-72439723 TTGTCTTTTTAGATTGTTGTTGG - Intronic
1192817855 X:74613644-74613666 TTTTTTTTTTTAATGGGGGAGGG + Intronic
1192849612 X:74941414-74941436 TTGTCTTTTTTGATGGTTGTTGG + Intergenic
1193021014 X:76793390-76793412 TTTTTTTTTTAAAGGGAGGATGG - Intergenic
1193047100 X:77065160-77065182 TGCTCTTTTTGGAAGGTGGAAGG - Intergenic
1193165811 X:78278934-78278956 TTATTTTTGTAGATGGTGAAAGG - Intronic
1193247579 X:79247344-79247366 TTTTCTTTGTTGATTTTGGAAGG - Intergenic
1193746925 X:85293506-85293528 TTGGCCTTTTAGAAGGTGGAAGG + Intronic
1193812057 X:86063507-86063529 TGTGCGTTTTAGATGGTGGGTGG + Intergenic
1193821515 X:86171142-86171164 TTTTCTTTTCACATGGTGAATGG + Intronic
1193986395 X:88246011-88246033 TTTGCTTTGAATATGGTGGAAGG - Intergenic
1194084889 X:89514501-89514523 TTTTCTTTTTTGGGGGGGGAGGG + Intergenic
1194214641 X:91113883-91113905 TTTTCTTTTTAGAGGCTGTACGG - Intergenic
1194225604 X:91253178-91253200 TTCTTATTTTAGATGGTGGTAGG + Intergenic
1194468676 X:94265147-94265169 TTTTCTCTTTTGATGGTTGTTGG - Intergenic
1195410370 X:104563880-104563902 TTTTTTTTCTGGATGGGGGATGG - Intergenic
1195829505 X:109040303-109040325 TTTTCTCTTTAGATGTTGCTGGG - Intergenic
1196427278 X:115583860-115583882 TTTTCTTTTTTTTTGGGGGAGGG + Intronic
1196530176 X:116777494-116777516 TTAACTTTTTATATGGTGTAGGG - Intergenic
1196564177 X:117185593-117185615 TAATTTTTTTTGATGGTGGAGGG - Intergenic
1196665994 X:118317523-118317545 TTTTTTTTTTTTTTGGTGGAGGG + Intergenic
1197505564 X:127299386-127299408 TATTTTTTGTACATGGTGGAAGG - Intergenic
1198106433 X:133466296-133466318 TTTTTTTTTTATATGGTGATAGG + Intergenic
1198151252 X:133912516-133912538 TTTTTTTTTTTGGTGGGGGAAGG + Intronic
1199658666 X:150024147-150024169 TTTGCTTCATAGATGGTGGAAGG + Intergenic
1200416058 Y:2911234-2911256 TTCTCTTTTTATTTGTTGGAAGG - Intronic
1200562143 Y:4718071-4718093 TTATTATTTTAGATGGTGGTAGG + Intergenic
1200689795 Y:6295534-6295556 TTTTTTTTTTGGAGGGGGGATGG + Intergenic
1201045477 Y:9879186-9879208 TTTTTTTTTTGGAGGGGGGATGG - Intergenic
1201313044 Y:12614395-12614417 TTGTCTTTTTTGATGGTTGTTGG - Intergenic
1201506919 Y:14712060-14712082 TTTTTTTTTTAGATGGAGTTCGG - Intronic
1201606569 Y:15792349-15792371 TTTTCTTTTTTGGTAGGGGAGGG - Intergenic
1201714564 Y:17030150-17030172 TTTTATTTTTTGATGGTAAAGGG - Intergenic
1202383675 Y:24302028-24302050 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
1202487108 Y:25368092-25368114 TTTTCTTTTGTGATTGGGGAGGG + Intergenic