ID: 1106292272

View in Genome Browser
Species Human (GRCh38)
Location 13:28374971-28374993
Sequence CCAATGCATGATCCCTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106292270_1106292272 10 Left 1106292270 13:28374938-28374960 CCTGCTATTCATACGAATAGATG 0: 1
1: 0
2: 0
3: 7
4: 28
Right 1106292272 13:28374971-28374993 CCAATGCATGATCCCTCAGTTGG 0: 1
1: 0
2: 1
3: 6
4: 81
1106292269_1106292272 11 Left 1106292269 13:28374937-28374959 CCCTGCTATTCATACGAATAGAT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1106292272 13:28374971-28374993 CCAATGCATGATCCCTCAGTTGG 0: 1
1: 0
2: 1
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106292272 Original CRISPR CCAATGCATGATCCCTCAGT TGG Intronic
900746374 1:4363408-4363430 CAAATGAATGATTCCTCATTAGG - Intergenic
901961348 1:12828714-12828736 CCAAGGCTTGGTCCCTCAGCAGG + Exonic
901975743 1:12942449-12942471 CCAAGGCTTGGTCCCTCAGCAGG + Exonic
901983337 1:13053584-13053606 CCAAGGCTTGGTCCCTCAGCAGG + Intronic
901998751 1:13175334-13175356 CCAAGGCTTGGTCCCTCAGCAGG - Intergenic
902005158 1:13226037-13226059 CCAAGGCCTGGTCCCTCAGCAGG + Intergenic
902009431 1:13259316-13259338 CCAAGGCTTGGTCCCTCAGCAGG - Exonic
902017238 1:13318461-13318483 CCAAAGCTTGGTCCCTCAGCAGG - Exonic
902024382 1:13371831-13371853 CCAAGGCCTGGTCCCTCAGCAGG + Intergenic
902776632 1:18679129-18679151 CCCATGCAGCATCCCCCAGTGGG - Intronic
904363114 1:29991251-29991273 CAAATGCACAGTCCCTCAGTGGG - Intergenic
904887327 1:33750237-33750259 CCATTGCAAGATCCATCTGTTGG + Intronic
904985948 1:34549135-34549157 CCAATGCCCTGTCCCTCAGTGGG - Intergenic
906118831 1:43373923-43373945 CCAATGTCTGATCCATCAGTGGG + Intergenic
906205801 1:43985696-43985718 CCAATCCCTGATCCCCCAGTGGG + Intronic
910488121 1:87738286-87738308 CCACTGCATGGTCCCTCCTTGGG - Intergenic
915802011 1:158803690-158803712 CCCATGCATGATCCCTCAGAAGG + Intergenic
1062812314 10:476256-476278 CCAATGCATGATAGCTGAGCAGG - Intronic
1067104148 10:43354485-43354507 CCAATGGATGATATCACAGTGGG - Intergenic
1067801679 10:49363432-49363454 CCAGTGTCTGATCTCTCAGTTGG - Intergenic
1074496766 10:113986484-113986506 CCACTGCAGCATCCCGCAGTTGG - Intergenic
1077456298 11:2683185-2683207 ACAATGCATGAGCTGTCAGTGGG - Intronic
1077825052 11:5798041-5798063 CCACTGCTTGATACCTCAGATGG + Intronic
1080187141 11:29503483-29503505 CAGATGTATTATCCCTCAGTAGG - Intergenic
1087149976 11:94850535-94850557 GCAATGCATGATGACTGAGTAGG - Intronic
1088167606 11:106957012-106957034 CCAACCCATCATTCCTCAGTGGG - Intronic
1088511584 11:110580920-110580942 CCCTGGCATGATCCCGCAGTGGG + Exonic
1088874632 11:113924295-113924317 CTATTTCATGATCTCTCAGTTGG + Intronic
1090363049 11:126186565-126186587 GCACTTCATGATCCCTCAGCCGG - Intergenic
1095619972 12:44240954-44240976 CCAATGCATGATTCAATAGTGGG - Intronic
1105888375 13:24662535-24662557 CCCATCCCTGAGCCCTCAGTGGG + Intergenic
1106292272 13:28374971-28374993 CCAATGCATGATCCCTCAGTTGG + Intronic
1108969641 13:56357289-56357311 CCAATGCATGTAGCCTGAGTTGG - Intergenic
1113016976 13:105838592-105838614 ACATAGCATCATCCCTCAGTAGG + Intergenic
1113230636 13:108210568-108210590 CAACTGCATGATCCTTCTGTAGG - Exonic
1116325859 14:43533338-43533360 CCGCTGCATGAGCCCACAGTGGG - Intergenic
1116854214 14:49937674-49937696 CCACTACATGATGCCCCAGTAGG - Intergenic
1124190043 15:27566615-27566637 CCCATGCCTGGTCCCGCAGTGGG + Intergenic
1125402820 15:39322231-39322253 TCTATGCCTGAGCCCTCAGTGGG - Intergenic
1133361369 16:5176516-5176538 CAAATGCATGCTCACTCAGATGG - Intergenic
1140807355 16:78545259-78545281 CCAATACAACATCCCTGAGTTGG - Intronic
1141589451 16:85058187-85058209 CCAGTGCCAGATGCCTCAGTAGG - Intronic
1143873821 17:9976685-9976707 CCTAAGGATGATCCCTCAGTGGG + Intronic
1149333523 17:55610265-55610287 CCAAGTCAAGCTCCCTCAGTTGG - Intergenic
1155425721 18:25704853-25704875 CTAATGCTCGATCCCTCCGTGGG - Intergenic
1158995860 18:62918571-62918593 CCAATTAAAGATCCCTGAGTTGG - Intronic
1159699705 18:71609597-71609619 CTGATGCATTCTCCCTCAGTGGG - Intergenic
1167403261 19:49287013-49287035 CCAGTGGATGATCACTGAGTGGG - Intergenic
929332618 2:40701815-40701837 CCCATGAATGATCCCTTAGAGGG + Intergenic
941331817 2:164186723-164186745 CTAAAACATGGTCCCTCAGTAGG - Intergenic
941962117 2:171263703-171263725 CCAATGCCTGATTCCCCAGCAGG - Intergenic
946654394 2:221930321-221930343 GAAATGCATGATACCTCAGCGGG - Intergenic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1170428146 20:16255975-16255997 CCAATGGTGGAACCCTCAGTTGG + Intergenic
1179569369 21:42269042-42269064 CCGAGGCATGAACCCTCAGGTGG + Intronic
1182652057 22:31860117-31860139 CACATGCATGACCCATCAGTAGG + Intronic
955532607 3:59889833-59889855 CCAATGTATGTTCTCTCATTAGG - Intronic
959442819 3:106399580-106399602 CCAATCCTTGATCTCTCAGTTGG - Intergenic
963412610 3:144950367-144950389 TCAATGAATGATCACTCACTTGG - Intergenic
966418018 3:179708973-179708995 CCACTGCATGTTCCCAAAGTCGG - Intronic
969244484 4:5923616-5923638 GCCAGGCATGATCCATCAGTAGG + Intronic
971372986 4:26033128-26033150 CCAAGGAGTAATCCCTCAGTTGG - Intergenic
971393546 4:26207843-26207865 CAAATGCATGAGCCGTCAGGAGG + Intronic
976083579 4:81383905-81383927 AGAGTGGATGATCCCTCAGTAGG + Intergenic
979131701 4:117055343-117055365 ACAGTGCATGTTCCTTCAGTGGG - Intergenic
981829686 4:148985584-148985606 CCACTAGATGATGCCTCAGTAGG - Intergenic
988256259 5:28823507-28823529 CCAATAGATGATGCCCCAGTGGG - Intergenic
996225996 5:120997065-120997087 GCAAGGCATGATTTCTCAGTGGG + Intergenic
996998411 5:129727175-129727197 CTAATACATGATCTGTCAGTAGG + Intronic
1000338561 5:160259963-160259985 CCTAGCCATGATCCCCCAGTGGG - Intronic
1002624616 5:180516730-180516752 GCAATGAATGATCCCTATGTTGG - Intronic
1006828629 6:36955282-36955304 CAAATGCATGTGCCCTCAGTGGG + Intronic
1007094422 6:39204700-39204722 CCAATCCATTCTCCCTCATTAGG + Intronic
1007618777 6:43198864-43198886 CCAATGCATGGTGCCTCAACAGG - Intronic
1020378480 7:7514964-7514986 CCAATGCATGATCCAGGAGAAGG + Intronic
1024708217 7:51985087-51985109 CCAATGGATGCTACCTCAATGGG + Intergenic
1037325719 8:17688108-17688130 CCAAGGCAAACTCCCTCAGTAGG - Intronic
1037659321 8:20913500-20913522 GCAATACATGATCACTCAGGAGG - Intergenic
1041617231 8:59921499-59921521 CCAATGCACTATCCATCAGAAGG + Intergenic
1044537286 8:93371745-93371767 TCAGTGCATGGACCCTCAGTTGG - Intergenic
1045966592 8:108031991-108032013 CCAATACATCATCACACAGTTGG + Intronic
1049874351 8:145006422-145006444 CCAAAGCATGAAACCACAGTGGG - Intergenic
1053739859 9:41127115-41127137 CCACTGCCTGATACCTCAGCAGG + Exonic
1054688491 9:68304198-68304220 CCACTGCCTGATACCTCAGCAGG - Exonic
1056544870 9:87605263-87605285 CCAATTCCTGATCCCTCTCTCGG - Intronic
1186524237 X:10233658-10233680 CCAATGCATGATCTTTCATTGGG - Exonic
1186777905 X:12883905-12883927 CCAATGCAAGATGGCTCAGAAGG - Intronic
1195912726 X:109904814-109904836 CCAGTGCAGGATGCCTCTGTGGG + Intergenic
1199694125 X:150331533-150331555 CCAATGCATGATATCCCAGCGGG - Intergenic