ID: 1106293722

View in Genome Browser
Species Human (GRCh38)
Location 13:28390736-28390758
Sequence GGCAAGTGACACTGGCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106293715_1106293722 23 Left 1106293715 13:28390690-28390712 CCTGGCCTCATTTCCTATTTTTA 0: 1
1: 2
2: 52
3: 462
4: 2812
Right 1106293722 13:28390736-28390758 GGCAAGTGACACTGGCAAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1106293716_1106293722 18 Left 1106293716 13:28390695-28390717 CCTCATTTCCTATTTTTAAAATC 0: 1
1: 1
2: 5
3: 113
4: 1077
Right 1106293722 13:28390736-28390758 GGCAAGTGACACTGGCAAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 162
1106293717_1106293722 10 Left 1106293717 13:28390703-28390725 CCTATTTTTAAAATCATGTACAG 0: 1
1: 1
2: 1
3: 49
4: 515
Right 1106293722 13:28390736-28390758 GGCAAGTGACACTGGCAAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106293722 Original CRISPR GGCAAGTGACACTGGCAAGT GGG Intronic
900700501 1:4045709-4045731 GGGTAGTGGCACTGGTAAGTTGG - Intergenic
903421435 1:23220224-23220246 GGTAAATGACACTGGAAAGCTGG + Intergenic
903458939 1:23507598-23507620 TTCAAGTGTCACTGGCAAGACGG + Exonic
905929808 1:41779125-41779147 GGCAAGTGATCCAGGCAGGTGGG - Intronic
906195123 1:43925518-43925540 GGTAAATAACAGTGGCAAGTAGG - Intronic
906618870 1:47257126-47257148 TGCAAATGCCAATGGCAAGTAGG + Intronic
907713280 1:56904234-56904256 GGAAAATGACACTAACAAGTTGG - Intronic
907923658 1:58935850-58935872 GGCAAGTCAGACTGGCGAGATGG + Intergenic
907923972 1:58938798-58938820 GGCAAGTCAGACTGGCCAGTAGG + Intergenic
911653103 1:100411837-100411859 GGTCAGTGATAATGGCAAGTTGG + Intronic
918378019 1:183928656-183928678 GGCTTGTGACACTTGCCAGTGGG - Intergenic
919967147 1:202539218-202539240 GGCAGGGGACACTGGAAGGTTGG + Intronic
920712533 1:208308986-208309008 GAGAAATGACACTGGGAAGTGGG - Intergenic
1065264116 10:23957252-23957274 AGCAAGTGACACTGGAGAGCAGG - Intronic
1066579137 10:36861002-36861024 AGCAAGTGACACAGGGAAGGTGG - Intergenic
1070300202 10:75198086-75198108 GGAAAGTCACACAGGCAATTTGG - Intergenic
1071090385 10:81911479-81911501 AGCAAGTGACACTGTCGAGAGGG - Intronic
1072507690 10:96085250-96085272 GGCATGGGACACTTGCAAGGAGG - Intergenic
1073842794 10:107517233-107517255 GAGAAGTGATACTGGCAATTTGG + Intergenic
1074211877 10:111342795-111342817 GGCATGTGTCACTTCCAAGTGGG - Intergenic
1076491832 10:130867011-130867033 GGCGAGTGACTCTGGGATGTTGG + Intergenic
1077892605 11:6430349-6430371 AGCAAATGTCACTGGCAAGGAGG - Intergenic
1078425159 11:11243781-11243803 GGCGAGTGACCCTGACCAGTGGG - Intergenic
1078749003 11:14142427-14142449 GGGAGATGACACTGTCAAGTGGG - Intronic
1080695461 11:34599917-34599939 GACAAGTGACAGTGGAAAGGAGG - Intergenic
1082058419 11:47839485-47839507 GGCAAGACACAGTGGCAACTTGG + Intronic
1084006420 11:66325864-66325886 GAGAAGTGTCCCTGGCAAGTGGG - Intergenic
1084998227 11:73004506-73004528 GGCAAGAGACAATGGAAAGGGGG - Intronic
1089422521 11:118342467-118342489 GGCAAGAAACACTTTCAAGTGGG + Intronic
1090241982 11:125190335-125190357 GGCTAGTGGCACTGGGAAGGCGG - Intronic
1090575879 11:128103153-128103175 GCCAAGTAAAACTGTCAAGTAGG + Intergenic
1093284833 12:17245935-17245957 GGCAAGTGATAGGGGCAAATGGG - Intergenic
1093293739 12:17361907-17361929 TGGAAGTGACACTGTCTAGTGGG - Intergenic
1093650411 12:21637570-21637592 GTTAGGTGACAGTGGCAAGTGGG - Intronic
1098679262 12:73329433-73329455 GACAAGTGTCACTGGCATATCGG + Intergenic
1100267131 12:92988202-92988224 GGCAAGTGAGCCTGGCAGGAGGG + Intergenic
1104051375 12:125196093-125196115 GGCAAGTGACAATGGCTGCTTGG + Intronic
1105257437 13:18753372-18753394 TGCAAGTGACACAGCCAAGATGG - Intergenic
1106293722 13:28390736-28390758 GGCAAGTGACACTGGCAAGTGGG + Intronic
1106783867 13:33087728-33087750 GCCAAGGGACACTGGCTATTTGG - Intergenic
1107108368 13:36671010-36671032 GAGTAGTGATACTGGCAAGTCGG + Intergenic
1107760107 13:43669231-43669253 AGCAAGGGACACTGGCTATTTGG + Intronic
1108120414 13:47179648-47179670 TGCAAATGACCCTGGCATGTAGG - Intergenic
1108297128 13:49033515-49033537 GGTAATTTTCACTGGCAAGTTGG - Intronic
1110049169 13:70873115-70873137 GTCAAGTGATACTTGAAAGTGGG - Intergenic
1113055438 13:106262199-106262221 GGCAAGGGACACTGGTGGGTAGG - Intergenic
1116478452 14:45368462-45368484 GGCATATGACATGGGCAAGTGGG + Intergenic
1120615988 14:86705529-86705551 GTCATGTGACACTGGCATTTTGG + Intergenic
1122824769 14:104364282-104364304 GACAGGTGACAATGGAAAGTAGG - Intergenic
1125201790 15:37106771-37106793 GGCTAGTAACTCTCGCAAGTGGG + Intergenic
1126430993 15:48584422-48584444 GTCATGTGATACTGACAAGTTGG + Intronic
1127782608 15:62330556-62330578 GGACAGGGACACTGGCAAGCCGG - Intergenic
1128669349 15:69562917-69562939 GGCAGGTGACAGTGGCGAGATGG - Intergenic
1128742466 15:70093373-70093395 GGCAGGTGACCCTGGAAAGTGGG - Intronic
1131598442 15:93823346-93823368 GGAAAGTGACACTGGGGAGATGG + Intergenic
1132684003 16:1154669-1154691 GGCAATTGGCACTGCCAAGGGGG + Intronic
1132933403 16:2469818-2469840 AGCAACTGACACTGGCTGGTGGG - Intergenic
1134373518 16:13648087-13648109 GGCAGGTGCCAGTGGAAAGTGGG + Intergenic
1135066367 16:19313605-19313627 GGAAAGAGGCAGTGGCAAGTGGG + Intronic
1136469803 16:30472673-30472695 GGCTGGTGACACTGGCAGGCGGG - Exonic
1136635881 16:31522604-31522626 GGCAGGTGAGATTGGCAATTGGG - Intergenic
1140323252 16:73974484-73974506 GGCAAATGAGTCTGGCAAGCTGG + Intergenic
1142407686 16:89900186-89900208 GGCAAGAGAAACTGGCACGGTGG + Intronic
1147910775 17:43854652-43854674 GGCTGGTGTCACTGGCATGTGGG - Intronic
1150502569 17:65665203-65665225 GGCCAGTGACACAGCAAAGTGGG - Intronic
1151610803 17:75173400-75173422 GGAAACTGACACTGGCAGGAGGG - Intergenic
1158045696 18:53153008-53153030 GGCAAGGGGCAATGGCAAGCAGG - Intronic
1159422150 18:68235062-68235084 GGCAAGTGAAACAGGGAAGGAGG + Intergenic
1161466260 19:4432270-4432292 GGCAAGAGTCACAGGCTAGTGGG + Intronic
1163642293 19:18468697-18468719 GGCAGGAGCCACTGGCAACTTGG - Intronic
1164895481 19:31873631-31873653 GGTAAGTGCCACTGGAAGGTGGG - Intergenic
1165214629 19:34261753-34261775 GGGAAATGACATTGGAAAGTGGG + Intronic
1165610409 19:37146650-37146672 GGCAGGTGACACTGACAATGGGG + Intronic
1167304817 19:48701662-48701684 GGCACTGGACTCTGGCAAGTAGG + Intronic
925705927 2:6684759-6684781 GGCAAGTGAAACAGGGAAGCTGG + Intergenic
927371114 2:22356152-22356174 TGCAGGTGACAGTGGCAAATGGG + Intergenic
927742595 2:25585483-25585505 GGGAAGTGAGAATGGCATGTAGG - Intronic
931390708 2:61841142-61841164 GGACAGTGACTCTGGAAAGTGGG - Intronic
933104692 2:78309564-78309586 GGAAAGTCACACAGGCAAGAGGG - Intergenic
938200800 2:129371526-129371548 GCCCAATGCCACTGGCAAGTAGG - Intergenic
941748461 2:169111366-169111388 TGCTAGTGCCACTGGCAGGTTGG - Intergenic
946169837 2:217888321-217888343 TGCAAGTGACACTGACAAGAAGG + Intronic
946236969 2:218330128-218330150 GGCAGGTGACCCTGGCAATAGGG + Intronic
948935170 2:241159172-241159194 GACAATTGACACAGGCAAGGGGG - Intronic
1169136443 20:3200559-3200581 GGCTAGTGACATTTGCAGGTGGG - Intronic
1174958585 20:55129768-55129790 GGCAAGCGAGATTGGCAAATGGG + Intergenic
1177036849 21:16055111-16055133 GTCAAGTGTCATTGGCAAGTGGG + Intergenic
1178342164 21:31794835-31794857 ACCAAGTGATACAGGCAAGTGGG - Intergenic
1179045559 21:37842050-37842072 TGCTAGTGCCACTGGCAAGCTGG - Intronic
1180022445 21:45136794-45136816 GGCCAGGGACACTGGTAGGTAGG + Intronic
1180867231 22:19126575-19126597 AGAAGTTGACACTGGCAAGTAGG + Intergenic
1181930667 22:26398805-26398827 GGCCGGTGTCACTGGCAAGCTGG + Intergenic
1184564900 22:45285957-45285979 CGAAAGTCACACTGGCCAGTTGG - Exonic
950000703 3:9653914-9653936 GACAAGTCAGACTGGCAAGGTGG + Intronic
952227332 3:31391873-31391895 GGCAAGTGACACTGAAGAGTGGG - Intergenic
952261238 3:31742534-31742556 AGCAAGTGACAATGGCACCTTGG - Intronic
955047258 3:55372107-55372129 GGCTAGGGGCACTGGCAAGATGG - Intergenic
956977387 3:74597005-74597027 TCCTAATGACACTGGCAAGTAGG + Intergenic
957431289 3:80111481-80111503 GGTTAGTGACCCCGGCAAGTAGG + Intergenic
957662257 3:83174862-83174884 TGCAAAAGACACTGGAAAGTTGG + Intergenic
961508581 3:127387759-127387781 AGCAAGTGACACTGGCAGGTGGG - Intergenic
961713655 3:128845068-128845090 GGCAACTGAAAATGACAAGTAGG + Intergenic
961813442 3:129534929-129534951 GGCAAGGGAAACTGGAAACTGGG - Exonic
962270056 3:133971037-133971059 GGCAAATGCCACTGGCATGTGGG + Intronic
964952180 3:162308806-162308828 GGCAAGTGACATAAGCAAGATGG - Intergenic
968539060 4:1153777-1153799 TGCAAGTGCCACTGGTTAGTGGG + Intergenic
970247384 4:14077613-14077635 GGCAAGTGACTCTGATCAGTAGG - Intergenic
974061772 4:57042018-57042040 GGCAGGAGGCATTGGCAAGTGGG + Intronic
976502891 4:85812866-85812888 GGCAGGTGACCCTGGAGAGTAGG - Intronic
980829790 4:138116106-138116128 TGCCAGTGATACTGGCCAGTTGG - Intergenic
982042688 4:151410583-151410605 GGCAGGTGACCCTGACAAGCAGG - Intronic
982595414 4:157377366-157377388 GGCAAGTGACACAGTCAAGCGGG + Intergenic
984261036 4:177443846-177443868 GGCAGGTGAAACTGGAAACTTGG + Intergenic
985823665 5:2177991-2178013 GTCATGTGACAATGGCAAGGTGG + Intergenic
987069254 5:14320532-14320554 GCCAAGAGACACTTGCAAGGGGG - Intronic
988434547 5:31158579-31158601 GGAAAGTGACAGTGGCAGGATGG - Intergenic
988967494 5:36433938-36433960 GGCAAGTGACACTGGATATCTGG - Intergenic
991269167 5:64759022-64759044 GGCAAGTGACACAATAAAGTGGG + Intronic
993560473 5:89401229-89401251 TGCAACAGACACTGGCACGTGGG + Intergenic
994027758 5:95104581-95104603 GGCAAGGGTCCCTGGCAAGAAGG - Intronic
995615887 5:113963440-113963462 GGCAACTGACAATGCCTAGTTGG - Intergenic
999165242 5:149544061-149544083 GGCCAGTGACACTTTTAAGTAGG + Intronic
1002379910 5:178819389-178819411 TGGAAGTGAGACTGGCAACTAGG - Intergenic
1002933699 6:1653125-1653147 GGGAAGTGACACTGGCACCTTGG - Intronic
1003260083 6:4509110-4509132 GGCAAGAGACAATGGCAGCTTGG - Intergenic
1003897562 6:10622101-10622123 GGCAGGTTACACTAGCAAGAAGG + Intronic
1008408660 6:51147542-51147564 GGAAATTGACACAGGAAAGTGGG + Intergenic
1009193573 6:60658469-60658491 GGCAGATGATACTAGCAAGTCGG - Intergenic
1012937385 6:105382729-105382751 GGCAAGTGCCATTGGCAGGCAGG + Intronic
1014308430 6:119770119-119770141 GGCAAGTGACACAGGTGAGGGGG + Intergenic
1014480478 6:121929968-121929990 GGCAATGCACACTGGGAAGTTGG - Intergenic
1015813672 6:137186157-137186179 GGCAGGGGACACTGGCCAGTTGG + Intergenic
1017154312 6:151309259-151309281 GGCATGTGACACTGACCTGTAGG + Intronic
1017414770 6:154208049-154208071 TGCAACAGACACTGGGAAGTGGG - Intronic
1018681197 6:166267139-166267161 GGCAAGTGAGACCGCCAGGTGGG + Intergenic
1018774671 6:167001815-167001837 GGAAACGGAGACTGGCAAGTAGG - Intronic
1020717573 7:11695714-11695736 GGTAAGTGATACTGAAAAGTAGG + Intronic
1021928933 7:25560742-25560764 GGAACGTCACACTCGCAAGTGGG - Intergenic
1024158666 7:46651839-46651861 AGCAAGTGAGACAGGCAGGTGGG - Intergenic
1024212117 7:47215326-47215348 GGCAAGAGACACTTACAACTGGG - Intergenic
1027830449 7:83170401-83170423 GGCAAGGGAGACGGGCAAGCAGG - Intergenic
1030460198 7:109825790-109825812 GGCAAGTAGCACTGGCAAGGGGG + Intergenic
1031141537 7:117948473-117948495 GGCCAATGACAGTGGCTAGTTGG - Intergenic
1032099250 7:128959605-128959627 GACAGGTGACACTGTCAACTTGG + Intronic
1036608540 8:10329644-10329666 GACACATGACACTGGCAGGTTGG - Intronic
1039221081 8:35331500-35331522 GGCAAGTGATACAGGCGAGGAGG - Intronic
1040842163 8:51795811-51795833 TGTAAGTCTCACTGGCAAGTCGG - Intronic
1040919421 8:52599760-52599782 GGCAGGGGACACTGGCCAGCCGG - Intergenic
1043569276 8:81584143-81584165 GGAGAGTGACACCAGCAAGTTGG + Intergenic
1043915636 8:85919612-85919634 GGCAAGTGGCTGTGTCAAGTAGG - Intergenic
1044334200 8:90958777-90958799 GGGAAGTAACACTGGAAAGTAGG - Exonic
1048243124 8:132764343-132764365 GCCAAGTGACTTTGGCATGTTGG - Intergenic
1048877384 8:138847526-138847548 TGCAAGTGAGACTGGAAAGGTGG - Intronic
1048991475 8:139762876-139762898 GGCAACTGAGACTGGGAACTTGG - Intronic
1051028782 9:12648313-12648335 GGCACTTTACACTGGTAAGTTGG - Intergenic
1051377580 9:16419282-16419304 GGCGAGTGACAGTGGGGAGTCGG - Exonic
1051715652 9:19980437-19980459 AGGAAGTGACACTGGAAAGCTGG + Intergenic
1052396379 9:27943729-27943751 GAGAAGTGACAGTGGTAAGTAGG + Intergenic
1054738588 9:68780958-68780980 GGCAGGTGACACAGGAGAGTCGG - Exonic
1055042428 9:71889526-71889548 GGCAAATTACACAGGGAAGTTGG + Intronic
1057459263 9:95244753-95244775 TGCAAGTGAAGCTGGCTAGTGGG + Intronic
1058399286 9:104595161-104595183 GGCAATTGTCACTGGGAACTGGG - Intergenic
1058735936 9:107894133-107894155 GGCAAGTGATGTTGGCAATTTGG + Intergenic
1062083536 9:134636919-134636941 GGCAGGGGACCCTGGCCAGTGGG - Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1188233605 X:27698365-27698387 GGCAAGAGACATTGGTAACTTGG - Intronic
1189320031 X:40082324-40082346 GTCAAGTGGCACTGACAATTTGG + Intronic
1189846310 X:45141856-45141878 GGCAAGTCACACTGAAAACTAGG - Intergenic
1195365285 X:104118389-104118411 GGCAAAAGACACTGAGAAGTAGG - Intronic
1196588416 X:117457994-117458016 GGAAAGTGACATTAGCAAGATGG + Intergenic
1197860955 X:130969661-130969683 GGCAAGTAACAATGGTGAGTAGG + Intergenic
1198464374 X:136891513-136891535 GCCAAGTGATAATGTCAAGTGGG - Intergenic
1199771964 X:150980919-150980941 GGCAAGTGACACGGCACAGTTGG - Intronic
1202302746 Y:23434981-23435003 GGCAGGGGACACTGGAAGGTTGG + Intergenic
1202568065 Y:26235613-26235635 GGCAGGGGACACTGGAAGGTTGG - Intergenic