ID: 1106294765

View in Genome Browser
Species Human (GRCh38)
Location 13:28401799-28401821
Sequence GTATGAGACAAATCCATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106294765_1106294768 8 Left 1106294765 13:28401799-28401821 CCTGTCATGGATTTGTCTCATAC 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1106294768 13:28401830-28401852 TTTCTCAAGGTACACTCAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 173
1106294765_1106294767 -5 Left 1106294765 13:28401799-28401821 CCTGTCATGGATTTGTCTCATAC 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1106294767 13:28401817-28401839 CATACAGGACACATTTCTCAAGG 0: 1
1: 0
2: 0
3: 19
4: 188
1106294765_1106294769 18 Left 1106294765 13:28401799-28401821 CCTGTCATGGATTTGTCTCATAC 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1106294769 13:28401840-28401862 TACACTCAGAAGGATTTCAATGG 0: 1
1: 0
2: 1
3: 12
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106294765 Original CRISPR GTATGAGACAAATCCATGAC AGG (reversed) Intronic
902677333 1:18017957-18017979 GGATTAGACAAACCCAGGACTGG + Intergenic
907362442 1:53929482-53929504 GTATCAGACAAAATCATGGCGGG - Intronic
908774679 1:67628405-67628427 ATATGATACACATCCATTACTGG + Intergenic
908925884 1:69254665-69254687 GTATGGAACACATACATGACTGG - Intergenic
911139845 1:94487732-94487754 GGATGAGACAAATCTAAGAAAGG - Exonic
922132020 1:222789187-222789209 TTATGTGACAAATCAAGGACAGG - Intergenic
923422519 1:233832390-233832412 ATATGAGAAAAATGCATGAAGGG - Intergenic
1064637477 10:17384290-17384312 TGATGGCACAAATCCATGACTGG + Intronic
1070843694 10:79505448-79505470 GGATGAGACCCATCCCTGACTGG - Intergenic
1074927546 10:118088630-118088652 GTCTGAGATAAATCCAAGAGGGG + Intergenic
1075407811 10:122206229-122206251 GAAAGAGACAAAGCCAGGACAGG - Intronic
1079175447 11:18136083-18136105 GTATGAGAGGAGTCCATGAGTGG - Intronic
1079259599 11:18865587-18865609 GTATGAGAGGAGTCCATGAGAGG + Intergenic
1079264007 11:18912498-18912520 GTATGAGAGAAGTCCATGATGGG + Intergenic
1095266268 12:40161855-40161877 TAATGACACAAATCCATGGCTGG - Intergenic
1097380023 12:58883701-58883723 CTATGTGTCAAATACATGACTGG + Intronic
1099084868 12:78233063-78233085 GTCTTAGAGAAAGCCATGACTGG + Intergenic
1102289466 12:111687092-111687114 ATATGGGACACATACATGACAGG + Intronic
1106294765 13:28401799-28401821 GTATGAGACAAATCCATGACAGG - Intronic
1108806503 13:54163006-54163028 GTATAAGACAATTACAAGACAGG + Intergenic
1114598358 14:23933666-23933688 GCATGAGACAAACCTCTGACTGG - Intergenic
1116009586 14:39334930-39334952 GAAAGAGAGAAAACCATGACAGG - Intronic
1116474018 14:45318852-45318874 GAAAGAGATAAATCCATGGCTGG - Intergenic
1117201271 14:53392475-53392497 GTATTAAACAAAGCCATGACTGG - Intergenic
1118042063 14:61928133-61928155 GTATGATACAGATCCATAAGGGG - Intergenic
1118442336 14:65823054-65823076 GTATGAAATAAATACATGATTGG - Intergenic
1119687153 14:76641985-76642007 TTATGTGGCAAATCCAGGACAGG + Intergenic
1123822276 15:24042972-24042994 GTATGAAAAAAATTCATGAAGGG + Intergenic
1123894614 15:24816217-24816239 GAATGAGAAATATCAATGACAGG + Intergenic
1124907419 15:33884050-33884072 GTTTGAGAAAAATCGATGCCAGG - Intronic
1129679160 15:77648270-77648292 CTGTGAGGCAGATCCATGACTGG + Intronic
1134322307 16:13174929-13174951 ATATGAGAGAAATTTATGACTGG + Intronic
1135953042 16:26933118-26933140 GTTAGAGACAGATGCATGACAGG - Intergenic
1137390871 16:48080463-48080485 TTATGTGACACATCCATCACAGG - Intergenic
1146045794 17:29505220-29505242 GTATGAAAAAAATCCAAGGCAGG - Intronic
1146441480 17:32899305-32899327 TGATGGTACAAATCCATGACTGG - Intergenic
1147617218 17:41836518-41836540 GTTTGTGACAAAAACATGACTGG + Intronic
1148951495 17:51317126-51317148 CGATGGTACAAATCCATGACTGG + Intergenic
1149477055 17:56971431-56971453 TGATGGTACAAATCCATGACTGG + Intergenic
1149519958 17:57311222-57311244 GTGTCACACACATCCATGACTGG - Intronic
1154107950 18:11540428-11540450 GTCTGGCACAAATTCATGACTGG + Intergenic
1166657317 19:44621923-44621945 GTAAGAGCCCAATCCATGGCCGG + Intronic
1167407726 19:49324789-49324811 GTTTGAGCCAATTCCTTGACAGG - Intronic
1168079994 19:54003070-54003092 GTATGAGAAAAATGTATGACAGG + Intronic
926535970 2:14113118-14113140 GCAAGAGAAGAATCCATGACTGG - Intergenic
926596013 2:14790400-14790422 GTATGAGAGGAATCCATAAATGG - Intergenic
927184293 2:20471049-20471071 GTATGTGACACCACCATGACTGG - Intergenic
929443482 2:41984672-41984694 GTATGTGGGAAAACCATGACAGG + Intergenic
932416358 2:71575880-71575902 GTGTGAGACAAGGCCAAGACAGG - Intronic
933421981 2:82060059-82060081 GTATGAGACAAATGACTGTCAGG - Intergenic
937112938 2:119380927-119380949 TGATGATACAAATCCATGGCTGG - Intergenic
939098550 2:137866169-137866191 GTATGAGCTAAATCCATAACTGG - Intergenic
941358541 2:164522848-164522870 GTATGGGTCAAAGCAATGACAGG - Intronic
941431310 2:165417574-165417596 GTGTGAGATAAAGCCATGAATGG + Intergenic
1173703292 20:45092182-45092204 GTTTGTGCCAAATCCAGGACTGG + Intergenic
1184135475 22:42546859-42546881 GTTTTAGATAAATACATGACTGG + Intergenic
953899553 3:46832178-46832200 GTAAGAAACAAAACCAAGACAGG + Intronic
958454917 3:94318681-94318703 GTTTGAGAAAAATCCCTGAAGGG - Intergenic
961904980 3:130253633-130253655 GTCTGAGACAACTCCATGGATGG - Intergenic
963756682 3:149241686-149241708 GAATTAGACACATCCATGAATGG - Intergenic
972853439 4:43077017-43077039 TGATGGCACAAATCCATGACTGG - Intergenic
975741072 4:77429502-77429524 TTATGTGACAAATCCATTACAGG - Intronic
981568194 4:146123518-146123540 TAATAAGATAAATCCATGACAGG - Intergenic
982646493 4:158030390-158030412 GTATAAGACAAATCCACAACTGG + Intergenic
984648550 4:182244684-182244706 GAATTACACAAATCTATGACAGG - Intronic
986411773 5:7488364-7488386 GTATTAGACATACCCAAGACTGG - Intronic
986700224 5:10400009-10400031 ATCTGGGACAAATCCATCACTGG + Intronic
987702939 5:21425249-21425271 GTATGAAACACATCCCTGCCAGG - Intergenic
987921515 5:24287720-24287742 GTAAAAGAAAAATACATGACTGG - Intergenic
988144344 5:27285768-27285790 GTATGAGACAAATAAATGCAAGG + Intergenic
988402721 5:30782780-30782802 GTATGAGATAAATCTATTATAGG - Intergenic
992957851 5:81928605-81928627 CTATGAGACAGATCAATGATGGG - Intergenic
994215429 5:97132197-97132219 GTAATAGAAAAATCCAAGACGGG + Intronic
995662283 5:114498780-114498802 GGATGAGCCAAATGCATAACAGG + Intergenic
995960960 5:117839189-117839211 GAATGAGACAAATCAAAGTCAGG + Intergenic
996899933 5:128533118-128533140 GTAAGAGTCAACTCCATGGCAGG - Intronic
999577692 5:152998014-152998036 GTGTGAGACAAATGCCTAACTGG + Intergenic
1001816250 5:174671736-174671758 GTATTAAAAAAATCCATTACTGG + Intergenic
1002703671 5:181145862-181145884 TGATGATACAAATCTATGACTGG + Intergenic
1003862455 6:10334870-10334892 GTATCAGACAGATAAATGACAGG + Intergenic
1004646100 6:17562333-17562355 TGATGATACAAATCCATGGCTGG - Intergenic
1008302049 6:49853329-49853351 GTAAGAAAAAAATCCATGATAGG - Intronic
1011246212 6:85323867-85323889 GTGTGAGGCAAATCGATGAGGGG + Intergenic
1014241599 6:119023781-119023803 TTGTGAGAAAAATCAATGACAGG - Intronic
1019839577 7:3426860-3426882 GGATGACAGAAAACCATGACAGG - Intronic
1020666329 7:11048025-11048047 GTATAATAAAAATCCATGTCAGG - Intronic
1021779909 7:24093666-24093688 GTATGACACAAATAAATGAAAGG - Intergenic
1022041562 7:26586674-26586696 GTAAGAGAGAAATGCAGGACAGG - Intergenic
1024089710 7:45925026-45925048 TTGTGAGAGAAAGCCATGACAGG - Intergenic
1024194153 7:47042536-47042558 GTAAGTGACACATCCAGGACAGG + Intergenic
1024539133 7:50461667-50461689 GTATGAAACAAATCCCTATCAGG - Intronic
1024672078 7:51605532-51605554 TTATGAGACACATCCATGTGGGG - Intergenic
1024906546 7:54388763-54388785 TGATGGTACAAATCCATGACTGG - Intergenic
1027362461 7:77423541-77423563 GTAGGAGAAGAATCCAGGACAGG - Intergenic
1028607075 7:92666525-92666547 GTATCAGACAAATAAATAACCGG + Intronic
1029055440 7:97735547-97735569 CAATGAACCAAATCCATGACAGG - Intronic
1031227278 7:119055687-119055709 TGATGGCACAAATCCATGACTGG - Intergenic
1031636229 7:124104383-124104405 GTATAACAGAAATCCATGAATGG - Intergenic
1033821283 7:145137479-145137501 GTATGACACAAATTCTTCACAGG - Intergenic
1035183808 7:157110488-157110510 GCGTGAGACAGATGCATGACTGG + Intergenic
1035969915 8:4236408-4236430 GTAGGAGAAAAATTCTTGACTGG - Intronic
1039596776 8:38797531-38797553 GCATGAGACACATCCATGGCAGG - Intronic
1044343580 8:91076137-91076159 GTTTGATACAAACCCAGGACTGG + Intronic
1046499221 8:115054199-115054221 GTATGACAAACCTCCATGACAGG - Intergenic
1047129168 8:121999599-121999621 GTATCAGGGAAATCTATGACTGG - Intergenic
1047848803 8:128833908-128833930 GGATGAGATAAATCTATGATGGG + Intergenic
1048875065 8:138830576-138830598 GAAGGAGCCAAATCCGTGACCGG + Intronic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1051981998 9:23031581-23031603 CTATGAGACAAAACCATGTTGGG + Intergenic
1055150198 9:72987843-72987865 TTATAAGACAAATCCAGGCCAGG - Intronic
1055399097 9:75904226-75904248 ATATGTGACAAATTCATGGCAGG - Intronic
1056745890 9:89302226-89302248 TAATGGTACAAATCCATGACTGG + Intergenic
1057347820 9:94267155-94267177 TGATGATACAAATCCATGGCTGG - Intronic
1059699823 9:116764281-116764303 GTATGACCCACAACCATGACTGG + Intronic
1061646100 9:132003417-132003439 GTCTGAGACAAACCCAGGTCAGG + Intronic
1191740434 X:64432134-64432156 TGATGATACAAATCCATGGCTGG + Intergenic
1193294006 X:79812257-79812279 AAATCAGACAAATCCATTACAGG - Intergenic
1194148007 X:90287266-90287288 TAATGGTACAAATCCATGACTGG + Intergenic
1195443533 X:104923761-104923783 CTAGGAAACAAAACCATGACAGG + Intronic
1196636121 X:118004799-118004821 GTATGGGACAAATCAATATCAGG + Intronic
1200494386 Y:3864025-3864047 TAATGGTACAAATCCATGACTGG + Intergenic