ID: 1106300788

View in Genome Browser
Species Human (GRCh38)
Location 13:28462854-28462876
Sequence GCACAGAGCAGGCCCCTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 179}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106300785_1106300788 -9 Left 1106300785 13:28462840-28462862 CCACCTGCTTTGATGCACAGAGC 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG 0: 1
1: 0
2: 0
3: 14
4: 179
1106300781_1106300788 23 Left 1106300781 13:28462808-28462830 CCACGACCAAAGTGAACTCAGGA 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG 0: 1
1: 0
2: 0
3: 14
4: 179
1106300784_1106300788 -5 Left 1106300784 13:28462836-28462858 CCTTCCACCTGCTTTGATGCACA 0: 1
1: 0
2: 3
3: 14
4: 169
Right 1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG 0: 1
1: 0
2: 0
3: 14
4: 179
1106300778_1106300788 27 Left 1106300778 13:28462804-28462826 CCCACCACGACCAAAGTGAACTC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG 0: 1
1: 0
2: 0
3: 14
4: 179
1106300779_1106300788 26 Left 1106300779 13:28462805-28462827 CCACCACGACCAAAGTGAACTCA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG 0: 1
1: 0
2: 0
3: 14
4: 179
1106300782_1106300788 17 Left 1106300782 13:28462814-28462836 CCAAAGTGAACTCAGGACACCAC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG 0: 1
1: 0
2: 0
3: 14
4: 179
1106300777_1106300788 28 Left 1106300777 13:28462803-28462825 CCCCACCACGACCAAAGTGAACT 0: 1
1: 0
2: 0
3: 13
4: 127
Right 1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG 0: 1
1: 0
2: 0
3: 14
4: 179
1106300783_1106300788 -2 Left 1106300783 13:28462833-28462855 CCACCTTCCACCTGCTTTGATGC 0: 1
1: 0
2: 2
3: 36
4: 406
Right 1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG 0: 1
1: 0
2: 0
3: 14
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106300788 Original CRISPR GCACAGAGCAGGCCCCTATC TGG Intronic
900333126 1:2146471-2146493 GCACAGAGCTGAGCCCTATCTGG + Intronic
903631447 1:24776079-24776101 GCACAGAGCAGGCTCCAAGTAGG - Intronic
904408956 1:30313341-30313363 GTGCAGAGCAGGCACCTCTCAGG + Intergenic
904824170 1:33264003-33264025 AGACAGAGCAGGCCCCAAGCAGG - Intronic
907238864 1:53069720-53069742 GCACAAAGCAGGGCCCACTCTGG - Intronic
907726829 1:57027822-57027844 GCACACAGTAGGGCCCTATAAGG + Intronic
914976949 1:152374769-152374791 GCACAGGGCAGGCCCCTGTAGGG + Intergenic
915092544 1:153436683-153436705 GCAGAGAGCAAGTGCCTATCTGG + Intergenic
918082235 1:181216687-181216709 GCAGAGAGCATGTCCCTCTCAGG + Intergenic
920308927 1:205036861-205036883 GCACAGAACAGACGCCTACCTGG - Intergenic
923145174 1:231192746-231192768 GCACATGGCAGGCCCCAATGTGG + Intronic
923860205 1:237885470-237885492 TCACAGAACAGACCCCTACCTGG - Exonic
1065671824 10:28127735-28127757 ACACAGAGCCGAACCCTATCAGG + Intronic
1067031270 10:42879865-42879887 GCACAGGGCAGGGCACCATCAGG + Intergenic
1067287170 10:44914980-44915002 GGACAGAGGAGGCACCTCTCAGG + Intronic
1067755733 10:49002800-49002822 GCACATGTCAGGCCCCTGTCTGG - Intergenic
1069801635 10:71085404-71085426 GCACAGAGCAGGGCTCTCTCAGG + Intergenic
1073338186 10:102726401-102726423 GCACAGAGCTGGCCACCAGCAGG + Intronic
1073947090 10:108763789-108763811 TGACAGAGCAGGACCCTGTCTGG - Intergenic
1075864257 10:125704256-125704278 GCCCAGGGCAGGCACCTCTCTGG - Intergenic
1076579371 10:131496384-131496406 GCAGAGAGCAGGCCCCTCAGCGG + Intergenic
1076599368 10:131647020-131647042 GCTGAGAGCCGGCCCCTAGCAGG + Intergenic
1076784321 10:132742169-132742191 GAACAGAACAGGCTCCTATGAGG - Intronic
1077020768 11:416267-416289 GCACAGAGCAGCCGCCGAGCCGG - Intronic
1077233357 11:1468496-1468518 GCACCCAGCAGGCCTCTCTCTGG + Intergenic
1078082924 11:8217201-8217223 GACAAGAGCAGGCCCCTCTCAGG + Intergenic
1078510964 11:11983695-11983717 AGTCAGTGCAGGCCCCTATCTGG + Intronic
1079308662 11:19345749-19345771 ACACTGCGCACGCCCCTATCCGG + Intergenic
1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG + Intronic
1085302042 11:75464460-75464482 GCACGGAGCAGGCCCTTAGTGGG - Intronic
1089631977 11:119789546-119789568 CCACATGGCAGGCCCCTCTCTGG + Intergenic
1090201543 11:124861381-124861403 GCAAAGAGCAGGCACCCAGCTGG - Intergenic
1090440528 11:126721603-126721625 GCACAGAGTAGGTGCCTCTCTGG + Intronic
1091331864 11:134736876-134736898 GCACAGAACAGGACACCATCTGG - Intergenic
1092646791 12:10583254-10583276 GCACAAAGCAGGCCCTCACCAGG + Intergenic
1102025110 12:109709973-109709995 GCACAGAGAAGGCAACTAACAGG - Intergenic
1102240526 12:111321962-111321984 GCACATGGCAGGCACCTATGAGG + Intronic
1104025649 12:125024381-125024403 GCACAGAGCCAGTCCATATCAGG + Intronic
1105058968 12:133130317-133130339 GCACAGACCAGGCCCCTCTGCGG - Exonic
1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG + Intronic
1107035428 13:35897325-35897347 GCACAGCACAGGCCCCTGTCTGG - Intronic
1108686954 13:52827960-52827982 GCCCAGGGCAGGCCCACATCTGG - Intergenic
1109524017 13:63551885-63551907 GCATAGGGCAGGACCCTCTCTGG - Intergenic
1113535321 13:111061981-111062003 GCACAGAGCTTGCCCCTGTAAGG + Intergenic
1113810079 13:113135429-113135451 GCAGAGACCAGGCCCTCATCAGG - Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1115875233 14:37853939-37853961 ACACAGAGCCAGCCCATATCAGG - Intronic
1118171245 14:63391174-63391196 GCCCAGGCCAGGCCCCAATCAGG - Intronic
1120949780 14:90030272-90030294 GCACAGAGCAGGCACATCCCGGG - Intronic
1121287854 14:92750393-92750415 GCACAGAACAGGACCCCAACAGG - Intergenic
1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG + Intronic
1121691765 14:95883350-95883372 CCACAGAGCATGCCTCTCTCTGG + Intergenic
1124805520 15:32878118-32878140 GCTCAGAGCATGGGCCTATCTGG + Intronic
1128468012 15:67928909-67928931 GGACTGAGCAGGCTCCTCTCAGG + Intergenic
1128661115 15:69501719-69501741 GCACAGAGCAGGACCCTCGGAGG - Intergenic
1129317154 15:74751927-74751949 GCACACAGCAGGCACATAACAGG - Intronic
1132831848 16:1932332-1932354 GCACAGCCCAGGCCCCTGCCTGG + Intergenic
1135809875 16:25577393-25577415 GCACAGAGCAGGCCCCTGGGAGG - Intergenic
1137935030 16:52626669-52626691 ACACAGAGCAAGCCCTAATCAGG - Intergenic
1138388159 16:56650687-56650709 GCAGAGTGCAGGACCCTGTCAGG - Intronic
1140245641 16:73245675-73245697 GTCCAGAGCTGGCCCCTACCTGG + Intergenic
1141431041 16:83970299-83970321 GCCCAGAGCCGGCACCTACCTGG + Intronic
1141895001 16:86953712-86953734 ACACAGGGCTGGCCCCTGTCGGG - Intergenic
1142010717 16:87712435-87712457 ACACAGGGCAGGACCCTCTCCGG + Intronic
1142110285 16:88327505-88327527 GCACAGGCCTGGCCCCTAGCTGG - Intergenic
1142304599 16:89278390-89278412 GCTCAGAGCAGGGCCCCATTTGG + Intronic
1145006018 17:19338254-19338276 GCCCAGAGCAGGGCACCATCAGG - Intronic
1146728066 17:35171479-35171501 GCACAGACCAGACCCCTCCCGGG - Intronic
1149411243 17:56409579-56409601 TCACAGAGCAGTCAGCTATCAGG - Intronic
1152175737 17:78786008-78786030 GCACAGGGCAGGACCCTCTCTGG - Intergenic
1152227799 17:79100750-79100772 GCTCAAAGCAGGCCCCTTGCCGG + Intronic
1156370877 18:36470208-36470230 GTACTGAGCAGACCCCCATCCGG + Intronic
1157399779 18:47377738-47377760 ACACAGAGCAGGCACCTCTGGGG - Intergenic
1157948001 18:52002778-52002800 TCACAGAGCAGGTGCCTAACAGG - Intergenic
1158343326 18:56489549-56489571 GCACTAAGCTGGCACCTATCAGG + Intergenic
1159259619 18:65996163-65996185 AAACAGAGCAAGACCCTATCTGG - Intergenic
1159656169 18:71031771-71031793 GCACTGTGGAAGCCCCTATCTGG - Intergenic
1159955533 18:74516027-74516049 GCACAAAGGAGGCCCCTGACAGG - Intronic
1160007826 18:75081186-75081208 CCACAGAGCAGGCTGCTATTTGG - Intergenic
1160533050 18:79576716-79576738 GAACCGAGCAGCCCCCTCTCCGG - Intergenic
1161350796 19:3790399-3790421 TGACAGAGCAGTCCCCTTTCTGG + Intronic
1161438627 19:4278715-4278737 GCACAGAGCAGAGCCCTCTTGGG + Exonic
1163418576 19:17201701-17201723 ACACAGGGCAGGCCCCAATGTGG + Intronic
1164930089 19:32168685-32168707 GCACAGAGCATGCGCCTGTTGGG + Intergenic
1165141730 19:33703940-33703962 GCACAGCGCAGGCTCCTAGTGGG + Intronic
1166329199 19:42069099-42069121 GCGCAGAGCAGGCCCCTAGTGGG + Intronic
1168014259 19:53558613-53558635 GTACAGGGCAGGACCCTCTCTGG + Intronic
1168683164 19:58330911-58330933 GCACAGAGTAGGCACCTAATGGG + Intronic
1168685721 19:58347885-58347907 CCCCAGAGCAGGCCCGAATCTGG - Intronic
925031079 2:650183-650205 GGACAGAGCTGGTCCCCATCAGG - Intergenic
926227776 2:10980701-10980723 GCCCAGAGCAGGCCCCTGGCTGG - Intergenic
927971834 2:27310543-27310565 TCACAGAAAGGGCCCCTATCTGG + Intronic
928182595 2:29080084-29080106 GCACAGAGCCGGCACCTGTGCGG - Intergenic
932490409 2:72116359-72116381 GGACAGAGCAGGCCCCTCCTTGG - Intergenic
932795838 2:74695381-74695403 GCACAGAGCACTCCCCTGTCTGG + Intergenic
933521891 2:83384307-83384329 GCACAGAACAGACCCTTATTAGG - Intergenic
935310364 2:101777271-101777293 GCACAGAGCAGGACTCTCTGTGG - Intronic
936428161 2:112436634-112436656 ACCCAGACCAGGCCCCTCTCAGG + Intergenic
936975809 2:118221187-118221209 TCACAGACCTGGCACCTATCAGG + Intergenic
937330588 2:121025883-121025905 GCTCAGGGCAGGCCCCAAGCAGG + Intergenic
949051250 2:241898741-241898763 GCACAGAGCAGGGCCATCTACGG - Intronic
1171317214 20:24205828-24205850 GCACACACCTGGCCCCTATGGGG - Intergenic
1174410332 20:50330928-50330950 GCACAGAGATGATCCCTATCTGG + Intergenic
1175246120 20:57583104-57583126 GCACAGAGCAGCCCCCACACTGG - Intergenic
1175787844 20:61723329-61723351 GCACCGGGCAGGCCCCTCCCGGG + Intronic
1176124220 20:63468332-63468354 GCACAGAGCGGGGCCCTGGCAGG - Intronic
1176292630 21:5054274-5054296 ACACAGAGCAGGACCCCTTCAGG - Intergenic
1176374091 21:6078577-6078599 ACCCAGACCAGGCCCCTCTCAGG - Intergenic
1177653177 21:23983741-23983763 GCAGAGTGCAGGCACCTATGAGG + Intergenic
1179749386 21:43459666-43459688 ACCCAGACCAGGCCCCTCTCAGG + Intergenic
1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG + Intronic
1179864630 21:44209376-44209398 ACACAGAGCAGGACCCCTTCAGG + Intergenic
1180003153 21:45004203-45004225 GCACAGAGGTGGCCCCTCTCAGG + Intergenic
1180136150 21:45863276-45863298 GCATAAAGCAGGTCCCTACCCGG - Intronic
1180176609 21:46093569-46093591 GCACAGAGCAGGCCCTGACTGGG - Intergenic
1182481205 22:30609952-30609974 GCACAGTGAAGGCCACCATCAGG + Intronic
1182821818 22:33223002-33223024 GTAAAGAGCCTGCCCCTATCAGG + Intronic
1183369053 22:37422212-37422234 GCACAGTGCAGACCCCTTCCAGG + Intronic
1183512359 22:38243637-38243659 GCCCTGAGCAGGTCCCCATCTGG + Intronic
1184189616 22:42886031-42886053 ACACAGAGCAGCCCCATCTCAGG + Intronic
1184606738 22:45578695-45578717 GCACAGGGCTGGCCCCTTTGGGG - Intronic
950117904 3:10463284-10463306 GCACAGAACAGGCCTCCACCAGG + Intronic
950136147 3:10582402-10582424 GCACAGTGCAGGCAGGTATCAGG - Intronic
951518649 3:23589824-23589846 GCAGGCAGCAGGCCCCTATGTGG - Exonic
954640416 3:52094374-52094396 GCCCACAGCAGGCCCCGCTCTGG - Intronic
962481697 3:135803587-135803609 GCATAGAGAAGGCCCCTCTGAGG + Intergenic
967311800 3:188113237-188113259 GCACAGAGAAGGCCCAGAGCTGG + Intergenic
967828169 3:193895428-193895450 GCACAGAGGAGGGCCCTAATTGG - Intergenic
969362296 4:6672652-6672674 GCACTGTGGAGGCCCCTTTCTGG + Intergenic
970332529 4:15001934-15001956 GCACAGTGCAGGCGCCGGTCGGG + Intergenic
971798526 4:31259239-31259261 GCACTGTGGAGGCCCCTCTCTGG + Intergenic
972710727 4:41591915-41591937 GCACAGAGCAAGCAGCTTTCTGG - Intronic
972732252 4:41806508-41806530 GCACAGAGCCGGGCCCTCCCAGG - Intergenic
979527387 4:121731581-121731603 ACACAGAGCAGGCTTCTGTCAGG - Intergenic
980369653 4:131850729-131850751 GCCCAGGACAGGCCCATATCTGG - Intergenic
984953254 4:185021522-185021544 GCACAGAGCAGGCCAGCTTCGGG + Intergenic
987138409 5:14920910-14920932 GTACAGGGCAGGACCCTCTCTGG - Intergenic
987576817 5:19739339-19739361 ACACAAAGCAGGTCCCTACCTGG + Intronic
989365515 5:40651470-40651492 GTATAGAGCAGGACCCTCTCTGG - Intergenic
992654199 5:78892111-78892133 GAACAGAATAGGCTCCTATCTGG + Intronic
993619735 5:90153700-90153722 GCACAGTGCAGGCCTTTCTCAGG - Intergenic
1001288120 5:170438315-170438337 GCTCAGAGCAGGGCCCACTCTGG + Intronic
1001971373 5:175957464-175957486 GCCCAGAGCAGGCTCCTAGGAGG - Intronic
1002025314 5:176392759-176392781 GCACCTAGCAGGCACCTAGCGGG + Exonic
1002119405 5:176990349-176990371 GCACAGTGCAAGCCCTCATCAGG + Intronic
1002246069 5:177886313-177886335 GCCCAGAGCAGGCTCCTAGGAGG + Intergenic
1002281975 5:178136291-178136313 GCACATAACAGGCTCCTATTTGG + Intronic
1003171468 6:3724759-3724781 GCACAGTCCAGGCCCCTGGCCGG + Intronic
1003796865 6:9614613-9614635 AAGCAGAGCAGGCCCCTTTCAGG + Intronic
1004687060 6:17956751-17956773 GTATAGAGCAGGACCCTCTCTGG - Intronic
1005194934 6:23271410-23271432 GTAAAGAGCAGGACCCTCTCTGG + Intergenic
1008952425 6:57175488-57175510 GCATAGGGCAGGACCCTCTCTGG - Intronic
1010395991 6:75392661-75392683 GCACAGAGCAAAACCATATCAGG - Intronic
1010954161 6:82071318-82071340 GCACAGAGCAGGCACCGAGCAGG + Intergenic
1011514776 6:88141860-88141882 GTACAGAGCTGGCATCTATCTGG - Exonic
1013510553 6:110840694-110840716 GTATAGAGCAGGGCCCTCTCTGG + Intronic
1015896477 6:138021922-138021944 GTACAGAGTAGGCTACTATCAGG + Intergenic
1018515830 6:164579238-164579260 GCACAGAGCAGAACCCAAGCAGG + Intergenic
1018845371 6:167551911-167551933 GAACAGAGCAGGCCCCTGGGTGG - Intergenic
1019334513 7:476672-476694 GCTCACAGGAGGCCCCGATCTGG + Intergenic
1020590024 7:10123993-10124015 GCAGAGACCAGGCCCTTACCAGG - Intergenic
1020756801 7:12212745-12212767 CCACCAAGCAGGCTCCTATCAGG + Intronic
1023727231 7:43156286-43156308 GGACAGAGCAGGCCCCCAGTAGG + Intronic
1026027849 7:66761630-66761652 GTACAGAGCTGGACCCTCTCTGG + Intronic
1028586740 7:92459474-92459496 ACACAGACCAGGGCCATATCAGG - Intergenic
1033586608 7:142779153-142779175 GCACAGAGCAGCCCCTTGGCTGG - Intergenic
1034656209 7:152731434-152731456 CCACAGAGCAGCCCCTTCTCAGG + Intergenic
1034684570 7:152958917-152958939 GCACAGAGTGGACCCCCATCTGG + Intergenic
1035704809 8:1667455-1667477 GCATAGAGCTGGCCCCTTTCCGG + Intronic
1037295055 8:17390941-17390963 GCACAGAGCCAGACCATATCAGG + Intronic
1039835995 8:41256727-41256749 GCACAAATCAGGCCCCGAGCTGG - Intergenic
1041149777 8:54919406-54919428 CCACAGAGCAGGACCCCAACAGG - Intergenic
1042793955 8:72639564-72639586 GGAAAGAGCATGCTCCTATCCGG - Intronic
1046356591 8:113094292-113094314 GCATAGAGCAGCCCCCTAAATGG + Intronic
1047418830 8:124689261-124689283 GCACAGAGGAGGCATCTATGTGG + Intronic
1048875623 8:138835063-138835085 GGCCAGAGCAGGCCTCTACCTGG - Intronic
1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG + Intronic
1049189820 8:141280811-141280833 GCAGAGAGCAGGTCCCTGTCCGG + Intronic
1049442863 8:142617185-142617207 GAGCAGGGCAGGCCCCTGTCAGG - Intergenic
1049599421 8:143500109-143500131 GCTCAGAGAAGGCCCCTTTGAGG - Intronic
1054325791 9:63711738-63711760 GCAGAAAACAGACCCCTATCTGG - Intergenic
1057271037 9:93651625-93651647 CCACAGAGCAGGCATCTCTCCGG - Intronic
1057948445 9:99350570-99350592 GCACACTGCAGGCACCTGTCTGG - Intergenic
1059389338 9:113988968-113988990 GCTCAGAGCAGTACCCCATCAGG + Intronic
1059432591 9:114259058-114259080 GCCCAGAGGAGGACCCTACCTGG + Intronic
1059455862 9:114399793-114399815 TCACAGAGCAGGCCCTTAGTGGG - Intergenic
1060295314 9:122339227-122339249 GCCCAGAGCTGGCCTCTGTCTGG + Intergenic
1061027959 9:128062842-128062864 GCACAGCGCAGGCCCTTGTTAGG - Exonic
1190138104 X:47815724-47815746 GCACAGAGCATGTCCCTGTATGG + Intergenic
1192143388 X:68663675-68663697 GGACAAAGCAGGCCCCTGTGAGG - Intronic
1195872603 X:109501670-109501692 GCACCCAGCAGGCCCCTAAAAGG + Intergenic
1197375821 X:125680985-125681007 TCACTGGGCAGGCCCCTCTCAGG + Intergenic
1199672656 X:150160044-150160066 CCACAGGGCATGCCCCTACCTGG + Intergenic
1199750119 X:150807698-150807720 GTACAGAGCAGCCCCCTCTTGGG - Intronic