ID: 1106301636

View in Genome Browser
Species Human (GRCh38)
Location 13:28471573-28471595
Sequence ACACATGCATAGTCATAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106301633_1106301636 29 Left 1106301633 13:28471521-28471543 CCATCTTATTAGTGATTTATATA 0: 1
1: 0
2: 3
3: 35
4: 567
Right 1106301636 13:28471573-28471595 ACACATGCATAGTCATAGCATGG 0: 1
1: 0
2: 0
3: 8
4: 148
1106301632_1106301636 30 Left 1106301632 13:28471520-28471542 CCCATCTTATTAGTGATTTATAT 0: 1
1: 0
2: 1
3: 36
4: 379
Right 1106301636 13:28471573-28471595 ACACATGCATAGTCATAGCATGG 0: 1
1: 0
2: 0
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106301636 Original CRISPR ACACATGCATAGTCATAGCA TGG Intronic
900338532 1:2176774-2176796 ACACATGCACAGGCAAAGCAAGG - Intronic
901679878 1:10906716-10906738 ACACACTCATAGACAGAGCATGG + Intergenic
903333763 1:22611633-22611655 ACACAGGCAGATCCATAGCATGG + Intergenic
904331405 1:29760042-29760064 ACAAACTCATAGTCATATCAGGG - Intergenic
906779977 1:48564534-48564556 ACAAAAGCATAGACATAGAAAGG - Intronic
908632141 1:66120961-66120983 ACACATGCATAATCATTAAAGGG - Intronic
910339517 1:86169704-86169726 ACACTTGTATAGTCATGCCAGGG + Intergenic
913005355 1:114625049-114625071 ACACCTGCATGTTCAAAGCAGGG + Intronic
918196829 1:182230670-182230692 ACACATGTATATCCATACCAGGG + Intergenic
920165110 1:204030262-204030284 ACACATGTATTATCTTAGCAAGG - Intergenic
920670037 1:207996739-207996761 ACACATACATAGGCAAAGGATGG - Intergenic
922030440 1:221792369-221792391 AGAGATGAATAGTCATAACAGGG + Intergenic
922560921 1:226568991-226569013 GCACATGCATGGGCACAGCAAGG - Intronic
922843368 1:228663339-228663361 ATAAATGAAAAGTCATAGCATGG - Intergenic
924137952 1:240990372-240990394 ACACATTTATATTCATAGCAAGG - Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1066480507 10:35791161-35791183 ACAAATTCAAAGTCATAACAGGG + Intergenic
1068536099 10:58243289-58243311 ATACATGCATATGCATTGCATGG + Intronic
1071836335 10:89421791-89421813 ACATAAGCATAGTCACATCATGG - Intergenic
1078121062 11:8509307-8509329 ACACATACAAAGTTATAGAATGG - Intronic
1079561366 11:21824700-21824722 CCACATCCATATTCATATCAGGG - Intergenic
1080108883 11:28543291-28543313 ATACTTGCAAACTCATAGCATGG - Intergenic
1086504586 11:87491788-87491810 ACACACACACAGTGATAGCATGG - Intergenic
1086877255 11:92111750-92111772 ACACATGGAGAGCCAGAGCAAGG + Intergenic
1087183956 11:95166712-95166734 ACACATACACAGTCTCAGCAAGG - Exonic
1088782492 11:113149340-113149362 CCACATGCATAGTGATATTAAGG + Intronic
1089601717 11:119619842-119619864 ACACAGGCAAAGACAGAGCAGGG - Intergenic
1090277128 11:125428180-125428202 ACAGATGCGTAGTCAGTGCACGG + Intronic
1090863959 11:130678873-130678895 ACTCATGTTTATTCATAGCAGGG + Intronic
1091472487 12:741323-741345 ACACATGCATACCCATAGCCTGG + Intergenic
1092247417 12:6871490-6871512 ACACATCCCTAGTCAGAGCTGGG + Intronic
1093700747 12:22217885-22217907 ACAAATGCACAGACATACCAAGG - Intronic
1097603555 12:61724738-61724760 ACACACACATAGACATACCATGG - Intronic
1098380910 12:69868492-69868514 ACACATGCAAAGGGTTAGCATGG + Intronic
1098554739 12:71805269-71805291 ACACATGCAGAGTGATATGATGG - Intergenic
1100294454 12:93247885-93247907 ACACAGGCATAGTCATACTGTGG - Intergenic
1101670234 12:106864279-106864301 ACACATGCATCTCCATAGTAAGG + Intronic
1102586853 12:113929729-113929751 CCACATGCCTGGTCATGGCAGGG - Intronic
1103177376 12:118876491-118876513 ACACTTGCATAGCAAAAGCAGGG - Intergenic
1104231816 12:126892178-126892200 GCTCATGCATTGTCAAAGCAAGG - Intergenic
1106238158 13:27883396-27883418 ACACATACCTAGGCATATCATGG + Intergenic
1106301636 13:28471573-28471595 ACACATGCATAGTCATAGCATGG + Intronic
1109186820 13:59279594-59279616 AAACATGCAAAATAATAGCATGG - Intergenic
1112030021 13:95448464-95448486 TCACACGCATAGTCATCGGAGGG + Intronic
1116962935 14:50985638-50985660 TCACATGCAGTGGCATAGCACGG - Intronic
1120265492 14:82244305-82244327 TCAAATGCCTAATCATAGCATGG + Intergenic
1121431403 14:93890947-93890969 AAACATCCAGAGTCATAGCGGGG - Intergenic
1122921018 14:104880173-104880195 TGACATGCAAAGTCATAGCTGGG + Intronic
1126331979 15:47542877-47542899 ACAGATGCACAGTCATTGCTAGG - Intronic
1129431980 15:75505772-75505794 ACTCTTGGATGGTCATAGCATGG + Exonic
1131554498 15:93385446-93385468 ACACATGATTAGTGAGAGCAAGG + Intergenic
1132770536 16:1560184-1560206 AAACATGCATTGACAGAGCAGGG + Intronic
1142507603 17:374933-374955 ACTTATACATACTCATAGCAAGG + Intronic
1146015930 17:29233526-29233548 ACGCATGCAGAGTGATATCATGG - Intergenic
1147423046 17:40332020-40332042 ACGCATGCATGGTCTTGGCAGGG + Intronic
1148041902 17:44714133-44714155 AGACATGCAAAGTCATATAATGG + Intronic
1148712908 17:49694871-49694893 ACACCTGCACAATCATTGCAGGG - Intergenic
1155535566 18:26812869-26812891 ACATATGCTAAGTTATAGCAGGG + Intergenic
1157470416 18:47983968-47983990 ACAGACGCAGAGCCATAGCAGGG - Intergenic
1157971649 18:52276710-52276732 ACACATGCACACTTATACCAAGG - Intergenic
1162186561 19:8909697-8909719 AAACCTGCATTCTCATAGCATGG + Intronic
1163845839 19:19637711-19637733 ACCCAGGCATGGTCAGAGCAGGG + Intronic
1167514601 19:49915802-49915824 ACACATCCACAGTCCTGGCAGGG - Intronic
1168650329 19:58088330-58088352 ACACATGCATAATCAGGGCCTGG - Intronic
925551514 2:5080717-5080739 ACACATGCTTAGTGGTAGGATGG + Intergenic
926492358 2:13540266-13540288 ACATATGCAAAGAAATAGCATGG + Intergenic
930643325 2:53877063-53877085 ATACATTCATAGTCAAAGTATGG - Intronic
936171886 2:110184178-110184200 ACCCATGCATATTCGTATCATGG + Intronic
936282967 2:111158927-111158949 ACACAGACCTAGACATAGCATGG - Intronic
939024647 2:136997712-136997734 ACAAATGCCTAGTCATAGAGAGG + Intronic
939264548 2:139854248-139854270 GCACATACATGGTCAAAGCAGGG + Intergenic
940873166 2:158876977-158876999 ACACTTGCATATACATAGGATGG + Intergenic
943617581 2:190111132-190111154 ACGCATACATGGGCATAGCAAGG + Intronic
945845243 2:214936637-214936659 ACATATGCATAGGCATGGGATGG - Intronic
945896827 2:215492541-215492563 ACACACACATAGGCATAGCTGGG - Intergenic
948536824 2:238652858-238652880 AGACATGCATCTTCATAGAAGGG + Intergenic
948920023 2:241061209-241061231 AAACATGCATAGGCATTTCATGG + Intronic
1169555933 20:6750070-6750092 ACACATTTATAGTCTTATCAGGG - Intergenic
1173531281 20:43771701-43771723 ACATATGCATACACATAGCAGGG + Intergenic
1173844622 20:46180044-46180066 GCACCTGCGTAGTCAGAGCAGGG - Intronic
1175343264 20:58249121-58249143 ACTCATTTATAGTCAGAGCAAGG - Intergenic
1176686181 21:9850367-9850389 AGACATGCTTACTGATAGCATGG - Intergenic
1182071375 22:27466077-27466099 ACACATGCATGGTCACAAGAAGG + Intergenic
956488254 3:69743754-69743776 ACATAGGCATAGTCATGGCAGGG + Intronic
958059596 3:88462409-88462431 ACACAGGCATATGCAAAGCAAGG + Intergenic
958181254 3:90063679-90063701 ACAGATGCTTAGGCATGGCAGGG - Intergenic
963033633 3:141004640-141004662 GCATATGCGTAGTCATAGCAAGG + Intergenic
963580595 3:147122356-147122378 GAACATGCATAGTCATAGTCAGG + Intergenic
965001020 3:162953598-162953620 ACACATGCAGAGTGATATAATGG + Intergenic
965693167 3:171379562-171379584 ACACATTCAGAGTCAGAGAAAGG + Intronic
966168035 3:177043524-177043546 ACACTTGATTAGTGATAGCATGG + Intronic
969735157 4:8983695-8983717 ACACTTGCATATTCATAAGATGG + Intergenic
971779950 4:31020396-31020418 ACACATACACACACATAGCAAGG - Intronic
971952786 4:33376091-33376113 ACACATGAATAGACCTATCAGGG - Intergenic
973068399 4:45825925-45825947 ATAAAAGGATAGTCATAGCAAGG + Intergenic
980608354 4:135123129-135123151 ACACATGCAGAGGCCCAGCACGG + Intergenic
980754828 4:137144771-137144793 ACTCATTTATAATCATAGCATGG + Intergenic
980766336 4:137310442-137310464 AAACATTCATAATCATAGCCAGG + Intergenic
981788503 4:148507929-148507951 ACACATTCAGGGTTATAGCATGG + Intergenic
981788530 4:148508348-148508370 ACACATTCAGGGTTATAGCATGG + Intergenic
983647575 4:170007307-170007329 ACATTTGCAAAGTCATGGCAGGG - Intronic
984039859 4:174717959-174717981 TCACATGCATGGTGAGAGCATGG - Intronic
984150329 4:176122211-176122233 AGACATGCATACACACAGCAGGG - Intronic
984699366 4:182808449-182808471 ACACATGCAGCGTCTTGGCACGG - Intergenic
987111516 5:14692040-14692062 ATACATGAATGTTCATAGCAGGG - Intronic
988567438 5:32330461-32330483 ACACATGCATACGCATGGTATGG - Intergenic
990450733 5:55929699-55929721 ACACAGCCATAGTCGTGGCATGG + Intergenic
990543836 5:56802433-56802455 ACACATGAATAGGAATAGCTGGG + Intergenic
990759362 5:59111323-59111345 ATGCTTGCATAGTCATAGCTTGG - Intronic
991548751 5:67813330-67813352 ACACATGCATACACACACCATGG + Intergenic
991876473 5:71172872-71172894 ATACATGCATAATCACATCAGGG - Intergenic
994282679 5:97924720-97924742 ACACATGAAGGGTCAAAGCAAGG - Intergenic
996874759 5:128228325-128228347 ACACAGGCCTACTCAGAGCAGGG - Intergenic
999164602 5:149537754-149537776 ACACATGAATAGTCTTAACGGGG + Intronic
999619537 5:153458627-153458649 ATATATGCATATGCATAGCAGGG - Intergenic
999679716 5:154045322-154045344 ACACATACAATGTCATATCATGG + Intronic
1001102137 5:168823153-168823175 CCATCTGCCTAGTCATAGCATGG + Intronic
1002432092 5:179209600-179209622 ACACATGCATGTACACAGCAAGG + Intronic
1003443528 6:6164861-6164883 TGAAATGCAGAGTCATAGCAGGG - Intronic
1007458774 6:42001526-42001548 ATACATGTATAGTCTTAACAGGG + Intronic
1008882412 6:56394467-56394489 ACACATGCAGAGCTAGAGCATGG + Intergenic
1010274531 6:73953731-73953753 ACACATACATATACATACCATGG - Intergenic
1010313266 6:74413517-74413539 ACACATCCAGAGCCATAACATGG + Intergenic
1011216472 6:85011313-85011335 ACACATGCAAAAAGATAGCAAGG - Intergenic
1011325278 6:86143763-86143785 ACACATGCATACACATATAAAGG - Intergenic
1013731877 6:113177674-113177696 ACACATGCATACACACACCATGG - Intergenic
1014306237 6:119746354-119746376 ACAAATGAATAGTCTGAGCATGG - Intergenic
1016431552 6:143990885-143990907 AAACATTCATAGGCAAAGCAAGG - Intronic
1024008317 7:45243707-45243729 ACACATGCACAGTGACAGCGGGG - Intergenic
1024321138 7:48071140-48071162 ACACATGCTATGTGATAGCAGGG - Intergenic
1028015779 7:85710067-85710089 ACACATGCATAATTATACAAAGG - Intergenic
1028681352 7:93537689-93537711 ACACATGTATAATCAAAACAAGG - Intronic
1030764414 7:113391099-113391121 ACACATAGATAGTGATAGGAGGG + Intergenic
1032433241 7:131880009-131880031 AGAAATCCATAGTCATAGTAAGG - Intergenic
1039846714 8:41330618-41330640 AAACATGCAAAGGCAGAGCAGGG + Intergenic
1042254138 8:66786148-66786170 CTACATGTATAGTAATAGCAGGG + Intronic
1043273777 8:78367700-78367722 GCAGATGCATTGTTATAGCAAGG - Intergenic
1044290335 8:90461284-90461306 AAACATGCATAGGCATAGTGTGG + Intergenic
1045778986 8:105841415-105841437 ACACATGCAATGACATAGGATGG - Intergenic
1047525202 8:125627169-125627191 ACACATGCATACTCATACTCTGG + Intergenic
1047594916 8:126368518-126368540 GCACATGCAAAGGCATAGCATGG - Intergenic
1048618529 8:136106116-136106138 ACACAGGTATAGGCAAAGCAAGG - Intergenic
1048638318 8:136324393-136324415 TCACATTCACAGTCACAGCATGG + Intergenic
1050945157 9:11508503-11508525 AGATATCCATAGTCATGGCATGG + Intergenic
1052018256 9:23495254-23495276 CCAAATGCATACTCATATCAGGG + Intergenic
1055162310 9:73145234-73145256 CTACATGCATAATGATAGCAAGG - Intergenic
1059988253 9:119840605-119840627 GCACATGCATAATTATAGCGGGG + Intergenic
1062112188 9:134788230-134788252 ACACATGGATAGACATAGGTGGG + Intronic
1187256136 X:17644268-17644290 ACACATGCATTATCATTCCAAGG - Intronic
1192210558 X:69125212-69125234 ACACATGTTCAGTCCTAGCAAGG - Intergenic
1192911456 X:75608930-75608952 AAGCATGAATAGTCATTGCACGG + Intergenic
1193386883 X:80883266-80883288 ACACATGGAGAGTCTGAGCAGGG + Intergenic
1193962675 X:87945607-87945629 ACACATGCATACACATTGCAGGG - Intergenic
1194143939 X:90240965-90240987 ACATATGGAGAGTCAGAGCATGG + Intergenic
1200489701 Y:3810266-3810288 ACATATGGAGAGTCAGAGCATGG + Intergenic
1201918185 Y:19205141-19205163 ACACATCCACCTTCATAGCAGGG + Intergenic
1202056434 Y:20836598-20836620 ACACATGCATAATTATAGATAGG + Intergenic