ID: 1106303496

View in Genome Browser
Species Human (GRCh38)
Location 13:28490439-28490461
Sequence AGCCCCGTGAGCTAAGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106303490_1106303496 -4 Left 1106303490 13:28490420-28490442 CCTTAATGAACCCCCCTGCAGCC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1106303496 13:28490439-28490461 AGCCCCGTGAGCTAAGTCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 72
1106303489_1106303496 29 Left 1106303489 13:28490387-28490409 CCACTATCTTCAGCAGACTCAAT 0: 1
1: 0
2: 3
3: 9
4: 188
Right 1106303496 13:28490439-28490461 AGCCCCGTGAGCTAAGTCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106303496 Original CRISPR AGCCCCGTGAGCTAAGTCAG AGG Intronic
900366610 1:2314358-2314380 CGCCCCGTGCGCGAAGTCTGCGG + Intergenic
900467756 1:2834063-2834085 AGCCCCCTGAGCACAGTCAGAGG - Intergenic
902434876 1:16392035-16392057 AGCCCCGTGAGCAAATCCAGAGG - Intronic
903213161 1:21829758-21829780 AGCCCCGTGTGCAAGGGCAGGGG - Intronic
904034323 1:27550851-27550873 AGCCCCGTGGGCATAGGCAGGGG + Exonic
904497431 1:30895088-30895110 AGCCCCTGGAGCTGAGGCAGGGG + Intronic
905052083 1:35060554-35060576 AGACCTCTGAACTAAGTCAGAGG + Intronic
905749636 1:40450911-40450933 AGCCCTATGGGCTAAGACAGAGG + Exonic
906296381 1:44651426-44651448 AGCCCCATGAGCTAAGACTAAGG - Exonic
915728733 1:158037702-158037724 AGACCTGTGAGCTTAATCAGAGG - Intronic
1064798406 10:19040177-19040199 AGCCCCATGAGCTCTGTCACTGG - Intergenic
1066065273 10:31757169-31757191 AGAACCCTGAGCAAAGTCAGAGG - Intergenic
1070882383 10:79861375-79861397 AGCCATGTGGGCCAAGTCAGAGG - Intergenic
1071648953 10:87377686-87377708 AGCCATGTGGGCCAAGTCAGAGG - Intergenic
1076841449 10:133047831-133047853 AGCCCCGTCAGCTACGTCTCAGG + Intergenic
1089196230 11:116695398-116695420 AGCCCCCTGAGCTGTGACAGGGG - Intergenic
1090993455 11:131841748-131841770 AGCCCCCTGAGCTGAGTGAAGGG + Intronic
1102760624 12:115381692-115381714 AGCATCATGAGCTCAGTCAGAGG + Intergenic
1105434046 13:20362129-20362151 TGCTCTGTGAGCTAAGCCAGGGG - Intergenic
1106303496 13:28490439-28490461 AGCCCCGTGAGCTAAGTCAGAGG + Intronic
1108603136 13:52011858-52011880 AGCCCTGGGAGCTGAGTCTGCGG - Intergenic
1113086161 13:106571416-106571438 AGCACCAGGAGCTAAGTGAGAGG - Intergenic
1115330449 14:32191041-32191063 AGCCCCGTGAGATAAGAAAATGG + Intergenic
1115370801 14:32611983-32612005 AACCCCATGAGATTAGTCAGTGG + Intronic
1123827817 15:24101285-24101307 AGGCTCCTGGGCTAAGTCAGTGG + Intergenic
1124514532 15:30355200-30355222 AGGCCAGTGAGCAAAGCCAGGGG + Intergenic
1124728388 15:32175565-32175587 AGGCCAGTGAGCAAAGCCAGGGG - Intergenic
1127472075 15:59299049-59299071 AGGCCAGTGAGCTTATTCAGAGG + Intronic
1136533957 16:30888219-30888241 AGCCTCGTGAGAAATGTCAGAGG + Intronic
1141989255 16:87601330-87601352 AGCCCCGTGAGCCAAGAGTGGGG + Intergenic
1144042245 17:11422375-11422397 AGCCCAGTCAGCTAAGCCAGTGG + Intronic
1146055011 17:29576642-29576664 AGCCCCGTCAGACAAGTCCGAGG + Exonic
1147314764 17:39614400-39614422 GGTCCCGTGAGGTAAGCCAGAGG - Intergenic
1151277276 17:73044944-73044966 AGCCCAGTGAGTTTGGTCAGTGG - Intronic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1152538915 17:80965108-80965130 AGCCCCGTGGATTAAGGCAGGGG - Exonic
1155491905 18:26408132-26408154 AGCTCCGTGAGCTAGCTCTGTGG + Intergenic
1156099796 18:33578931-33578953 AGCCCCGAGAGCGAAGTACGGGG - Intronic
1160536558 18:79597652-79597674 ACCCCCGCGAGCTCAGGCAGAGG - Intergenic
1160745860 19:710352-710374 CGCCCCGGGAGCTCAGCCAGGGG + Intronic
1166609749 19:44180527-44180549 AGCTTAGTGAGTTAAGTCAGGGG + Intergenic
925083742 2:1091379-1091401 AGCCCTGGAAGCTAATTCAGAGG + Intronic
930018351 2:46986092-46986114 AGCACCTTAAGCTAAGACAGCGG - Intronic
932573999 2:72952859-72952881 AGCCCTGTGAGCTTAGTGAGTGG - Intronic
935056342 2:99570742-99570764 AGGCCCTTGACCAAAGTCAGAGG + Intronic
1168861336 20:1048152-1048174 AGCTCCATGAGCTAGGGCAGGGG - Intergenic
1171390399 20:24798115-24798137 CTCCCCGTGAGCTTAGTCATGGG - Intergenic
1174515700 20:51090834-51090856 AGGTACCTGAGCTAAGTCAGGGG - Intergenic
1175981529 20:62741149-62741171 GGCCCTCTGGGCTAAGTCAGGGG + Intronic
1176428630 21:6563305-6563327 AGCCCAGGGAGCTGAGTCTGCGG + Intergenic
1179154738 21:38840097-38840119 TGCCCCTTGTGCTGAGTCAGAGG - Intergenic
1179704120 21:43171621-43171643 AGCCCAGGGAGCTGAGTCTGCGG + Intronic
1181771516 22:25129081-25129103 AGTCCTTTGAGCCAAGTCAGTGG + Intronic
1182192648 22:28478782-28478804 ACCTCAGTGAGCTAAGGCAGAGG - Intronic
1184016644 22:41790912-41790934 TGCCCCGTGTGGGAAGTCAGAGG + Intronic
1184383310 22:44160067-44160089 TGCCCCATGAGCTATCTCAGAGG + Intronic
950599283 3:14017555-14017577 ACCCCTGTGAGATAAGTCAGAGG + Exonic
953498713 3:43412256-43412278 AGCCCTGTGTGCTTGGTCAGAGG - Intronic
961507294 3:127378417-127378439 AGCCCCGTTAGCCATGTAAGAGG - Intergenic
963205330 3:142628512-142628534 AGCCCAGTGAGCTAAGGAACAGG - Intronic
968707406 4:2086519-2086541 AGCCCCATGAGCTAAGGCATGGG + Intronic
971548408 4:27916895-27916917 AGCCCAGTGAGCAAAGGGAGAGG - Intergenic
972456025 4:39256324-39256346 AGCCCCTTGGCCTAAGGCAGGGG + Intronic
975209143 4:71678658-71678680 GGCCCCGAGAACTAGGTCAGGGG + Intergenic
979109985 4:116740855-116740877 AGCCCAAAGAGCTAAGTCATTGG + Intergenic
981042947 4:140239717-140239739 AGCCCTGTGAGATCAGTAAGTGG + Intergenic
982688852 4:158525957-158525979 AGGCCAGTGAGCTAGGTCAGGGG - Intronic
994414998 5:99458404-99458426 TGGCCCGTTAGCTAAGTTAGGGG + Intergenic
1001772937 5:174309403-174309425 AGCCCCGTGAGCAACCTCAGGGG - Intergenic
1002170483 5:177371662-177371684 AGAGCCTTGAGCTAAGGCAGGGG + Intronic
1003936259 6:10977826-10977848 AGCCCCATGAGCTGAGCAAGGGG + Intronic
1006720563 6:36147477-36147499 TGCTCTGTGAGCTAAGTCAAAGG - Intergenic
1017509789 6:155104135-155104157 AGCCCCGGGACTGAAGTCAGAGG - Intronic
1029727309 7:102415674-102415696 AGCCCTGTGAGGTTAGTCAGTGG + Intronic
1029878025 7:103773949-103773971 AGCACTGTGAGCTAGGACAGAGG + Intronic
1034672172 7:152867208-152867230 GGCCCCGTGAGCGCAGGCAGAGG + Intergenic
1035638046 8:1161930-1161952 AGATCCGTGTGCCAAGTCAGGGG + Intergenic
1049345827 8:142138070-142138092 AGCCAAGTGACCTCAGTCAGAGG - Intergenic
1056575948 9:87856304-87856326 AGCCACATGGGCCAAGTCAGAGG + Intergenic
1197760520 X:130024777-130024799 AGCCCTGTGAGGTCAGTAAGGGG + Intronic
1200067706 X:153512114-153512136 AGGCCTGGGAGCCAAGTCAGAGG + Intergenic
1200845898 Y:7831957-7831979 TGGGCCCTGAGCTAAGTCAGTGG - Intergenic