ID: 1106305117

View in Genome Browser
Species Human (GRCh38)
Location 13:28502841-28502863
Sequence ATTTATTTGAAAATGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 627
Summary {0: 1, 1: 1, 2: 7, 3: 57, 4: 561}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106305112_1106305117 7 Left 1106305112 13:28502811-28502833 CCTTTAAAAATCCCTTTTCTTCT 0: 1
1: 0
2: 7
3: 85
4: 828
Right 1106305117 13:28502841-28502863 ATTTATTTGAAAATGATGGCTGG 0: 1
1: 1
2: 7
3: 57
4: 561
1106305113_1106305117 -4 Left 1106305113 13:28502822-28502844 CCCTTTTCTTCTCCATGTTATTT 0: 1
1: 0
2: 7
3: 124
4: 1300
Right 1106305117 13:28502841-28502863 ATTTATTTGAAAATGATGGCTGG 0: 1
1: 1
2: 7
3: 57
4: 561
1106305114_1106305117 -5 Left 1106305114 13:28502823-28502845 CCTTTTCTTCTCCATGTTATTTA 0: 1
1: 2
2: 5
3: 86
4: 758
Right 1106305117 13:28502841-28502863 ATTTATTTGAAAATGATGGCTGG 0: 1
1: 1
2: 7
3: 57
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106305117 Original CRISPR ATTTATTTGAAAATGATGGC TGG Intergenic
901444625 1:9300522-9300544 AGTTATTTGTGGATGATGGCAGG - Intronic
903436474 1:23353750-23353772 ATTTTTTTGAAAAAATTGGCTGG - Intergenic
905397917 1:37679237-37679259 ATTTATATAAAAATGAAGGGAGG + Intergenic
906501675 1:46345851-46345873 ATTTATTAAAAAATATTGGCCGG + Intronic
907129027 1:52078357-52078379 ATTTATTCTAAAATCATGGCTGG - Intronic
907364774 1:53949124-53949146 TTTTTTTTGAAAATGATCCCTGG + Intronic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
908389713 1:63673515-63673537 AATTATCTGGACATGATGGCGGG - Intergenic
909179403 1:72402641-72402663 ATGTAATTGAAAATGGTGGAAGG - Intergenic
909758329 1:79256365-79256387 ATGTATTTGAGATTGATGGTAGG - Intergenic
910141286 1:84029987-84030009 AGTTATTTGTGAAGGATGGCAGG - Intergenic
910565674 1:88640074-88640096 AGTTATCTGAGAATGATGGCAGG + Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911010123 1:93272051-93272073 ATGTGTTTGAAAATGATGTTAGG - Intronic
911253477 1:95607211-95607233 ATTTATTTAAAATTGATGTTAGG + Intergenic
911437119 1:97875513-97875535 ATTTATTTTAAAATAATAACTGG - Intronic
911512465 1:98824446-98824468 ATTTTCTTGAGAATGATGACAGG - Intergenic
911578295 1:99604329-99604351 ATTCATTTGGGAATGCTGGCTGG - Intergenic
912479386 1:109968732-109968754 AATTAACTCAAAATGATGGCCGG + Intergenic
912718252 1:111997990-111998012 ATTTGTTTCAAAATTATGGTGGG - Intergenic
912829201 1:112936081-112936103 ATTGGTTTGAAAATGAGGACTGG - Intronic
913023263 1:114808681-114808703 GTTTATTAAGAAATGATGGCTGG + Intergenic
913142415 1:115954745-115954767 ATTTATTTGTAAATAAAGGCAGG - Intergenic
913652698 1:120933566-120933588 AAGTATCAGAAAATGATGGCTGG + Intergenic
914168402 1:145195483-145195505 AAGTATCAGAAAATGATGGCTGG - Intergenic
914642880 1:149627687-149627709 AAGTATCAGAAAATGATGGCTGG + Intergenic
914732932 1:150388217-150388239 TTTTATTTAAAAATTATGTCTGG - Intronic
915782317 1:158566442-158566464 AAAAACTTGAAAATGATGGCTGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916392982 1:164352749-164352771 ATTTATCTGATATTGATGGTGGG - Intergenic
916609874 1:166381176-166381198 TTTTTTCTGAAAATGGTGGCAGG + Intergenic
916943787 1:169703567-169703589 ATTTTCTTGAGAATGATGGTGGG + Intronic
918111923 1:181462562-181462584 ATTTATTTGAAAATGGGAGAGGG - Intronic
918533267 1:185546667-185546689 ATTTATTTGCAAATAATCTCTGG + Intergenic
918993335 1:191726662-191726684 ATAAATTTGAAAAAAATGGCAGG - Intergenic
919122617 1:193360013-193360035 ATTTATTAGAAAATAATCACTGG + Intergenic
921039740 1:211418323-211418345 ATTTCTTTAAAAATTATGGGGGG + Intergenic
921439757 1:215172081-215172103 ATGTGTTTGAATATGATCGCAGG - Exonic
923508371 1:234626658-234626680 ATTTATTTTAAAATCAGGGCCGG + Intergenic
923711729 1:236393079-236393101 GTTTATGTGAAAATACTGGCTGG - Intronic
924074068 1:240314826-240314848 ATTTATGTAAAAACAATGGCTGG - Intronic
924248005 1:242103715-242103737 ATTTATTTGAAAATCTGGCCTGG + Intronic
924329112 1:242924734-242924756 ATTTAGTTGGAAATGGTGGGTGG + Intergenic
1063153518 10:3357383-3357405 ATTTTCTTTAAAATGATGTCTGG - Intergenic
1063682357 10:8201076-8201098 ATTTATTTAAAAAAGAAGGTAGG + Intergenic
1063855804 10:10252416-10252438 ATTTAGCTGAGAATGGTGGCAGG - Intergenic
1063999223 10:11649490-11649512 TTTCATTTGGAAATGATGGCAGG + Intergenic
1064606512 10:17047020-17047042 TTATATTATAAAATGATGGCAGG - Intronic
1065043548 10:21723106-21723128 ATCTATTTTTAAAAGATGGCTGG - Intronic
1065473866 10:26112829-26112851 ATTTATTTTAAAACTATGGCAGG - Intronic
1066439471 10:35424520-35424542 AATTATTAGAAAATAACGGCTGG - Intronic
1068257115 10:54526311-54526333 ATTCATTTGAAAATGTAAGCTGG - Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1069351794 10:67535330-67535352 ATAAATTTGAAAATGATATCAGG + Intronic
1069516888 10:69084902-69084924 AATTATCTGGACATGATGGCGGG - Intergenic
1069903006 10:71716615-71716637 ATTGATTTGAAAATGCGGACAGG - Intronic
1070110097 10:73477618-73477640 ATATAATTTAAAAAGATGGCAGG + Intronic
1070436162 10:76396104-76396126 TTTTGATTGAAGATGATGGCTGG + Intronic
1071006866 10:80893573-80893595 ATGTATAAGAAAATGGTGGCTGG + Intergenic
1072126414 10:92449200-92449222 TATTATTTGAAAATCAGGGCTGG - Intergenic
1072303507 10:94085170-94085192 ATTTATTTAAACATGAGGACAGG + Intronic
1072590360 10:96823386-96823408 ATTTATTTGAAAATTACTGCTGG - Intergenic
1073342422 10:102755747-102755769 ATAGATTTTAAAATGTTGGCCGG + Intronic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073856440 10:107680420-107680442 ATTAATTTAAAAAATATGGCAGG + Intergenic
1074231635 10:111542364-111542386 ATATATTTTAAAATTATGTCAGG - Intergenic
1075626259 10:123966326-123966348 ATTAATTACAAAAAGATGGCGGG - Intergenic
1075885771 10:125897792-125897814 TTTTATGTCAAACTGATGGCAGG + Intronic
1078116238 11:8454447-8454469 ATTAATTTCAAAATTATGTCTGG - Intronic
1078175783 11:8968720-8968742 ATTTATTTGAAAATCTTAGGAGG - Intergenic
1078221758 11:9357078-9357100 ATGAAATAGAAAATGATGGCCGG - Intergenic
1078262822 11:9727092-9727114 TTTTATTTAAAAATTTTGGCTGG + Intronic
1078595501 11:12682915-12682937 ATGTGTTTGACAATCATGGCTGG + Intronic
1079189217 11:18264031-18264053 ATTTATTTAAAGATGAGGGAGGG - Intergenic
1079219575 11:18548339-18548361 ATTCATTTGTAAATGTTGACTGG - Intronic
1079584016 11:22102829-22102851 ATGAATTTAAAAATGAGGGCTGG - Intergenic
1079793451 11:24768404-24768426 CTTTATTTAAAAATTTTGGCAGG - Intronic
1080812004 11:35714000-35714022 ATTTATTTGAAACTGAGGCAAGG + Intronic
1080838872 11:35966129-35966151 CTTTATTTAAAAATGCAGGCTGG + Intronic
1081109456 11:39116721-39116743 ATATATTTGTAAAAGATGACTGG - Intergenic
1081640731 11:44751776-44751798 AATTATTTGGACATGATGGCAGG + Intronic
1081943679 11:46968482-46968504 ATTTATAAGAAAATGATAACTGG + Intronic
1082040392 11:47680091-47680113 ATTTAATTGGAAATGTTTGCGGG - Intronic
1084077855 11:66795596-66795618 ATATATTTGAAATTGTAGGCTGG - Intronic
1084478925 11:69405868-69405890 ATTTCTTTAAAGAAGATGGCCGG - Intergenic
1086163836 11:83753601-83753623 ATATATTTTAAATTGATGACTGG - Intronic
1086227626 11:84531316-84531338 ACCTACTTGAAAATGATGGGTGG + Intronic
1086338049 11:85819104-85819126 ATTGATATGAAAATTATGACAGG - Intergenic
1086420990 11:86637014-86637036 ATTGATTCAAGAATGATGGCAGG - Intronic
1087657234 11:100938971-100938993 ATTTATTTGATATTGATCACTGG - Intronic
1087724904 11:101705744-101705766 TTATATTTGGAAATGATGCCTGG + Intronic
1089479881 11:118795949-118795971 ATTAATTTGAAAATAATGTGTGG + Intergenic
1090514313 11:127409407-127409429 ATTTTCTAGAAAACGATGGCTGG - Intergenic
1090964216 11:131584307-131584329 TATTATTAGAAAATGCTGGCTGG - Intronic
1091051736 11:132378728-132378750 AATTATTTGTAGAAGATGGCAGG - Intergenic
1091085837 11:132720983-132721005 ATTTAATTTTAAATGATTGCTGG - Intronic
1091505376 12:1062291-1062313 CTTTTTTTGAAAATGAAGACGGG + Intronic
1091524571 12:1285473-1285495 ATTTATTTTAGAATGATAGAGGG + Intronic
1092622734 12:10290380-10290402 ATTTAATTTAAAATGATGTTAGG + Intergenic
1092853656 12:12653213-12653235 ATTTAATTTAAAATGGGGGCCGG - Intergenic
1093098821 12:15002744-15002766 ATTTAATTTAAAATGATAGTGGG + Intergenic
1093501163 12:19814026-19814048 AATTATTTGGATATGATTGCTGG + Intergenic
1093795033 12:23301160-23301182 ACATCTATGAAAATGATGGCAGG + Intergenic
1094069656 12:26398760-26398782 AATTATTTCAAAATGAAGGTTGG - Intronic
1095379253 12:41569591-41569613 ATTTTTTTGAAAATCTTGACAGG + Intronic
1095753789 12:45739752-45739774 ATTTATTTAAAATTAATCGCTGG - Intronic
1095972643 12:47913560-47913582 ATTTAATTTAAAATGATCCCAGG + Intronic
1096173055 12:49489448-49489470 ATTTATCTGGAAAAGATGACAGG - Exonic
1096354517 12:50928939-50928961 ATTTTTTTTAAAATCAGGGCCGG + Intronic
1097570696 12:61327337-61327359 TTTTTTTTGATAATGATGACTGG - Intergenic
1098650583 12:72962251-72962273 TTTTTTTTGAAAATGTGGGCCGG + Intergenic
1098901060 12:76112289-76112311 ACTGCTTTGAAAATAATGGCTGG - Intergenic
1099745926 12:86705022-86705044 ACTTATTTGAATATGATAGGTGG - Intronic
1099978572 12:89571901-89571923 ATTCATTTCAAAATGCAGGCTGG - Intergenic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1100203485 12:92324731-92324753 ATTTATCTGAAAAAGAATGCAGG - Intergenic
1100230799 12:92605049-92605071 ATTTAACTGAAACTGATGGTGGG - Intergenic
1101105651 12:101437477-101437499 GTTTATTTAAAAATGAATGCTGG + Intergenic
1101553358 12:105784190-105784212 AACTATTTGAGAATGAAGGCAGG + Intergenic
1101786974 12:107892853-107892875 ATTTATTTGAAAATCATGGCCGG - Intergenic
1101811118 12:108108697-108108719 ATTAATTTAAAAATGTGGGCTGG - Intergenic
1102327930 12:112004581-112004603 ATTTGTTTAAAAATATTGGCTGG - Intronic
1102331522 12:112035980-112036002 TATCATTTGAAAATGTTGGCTGG - Intronic
1103193013 12:119018691-119018713 ATTTAATTGAGAATGCTGGGTGG + Intronic
1104175836 12:126331900-126331922 TTATATGTGAAAATGATGGATGG + Intergenic
1105066976 12:133209401-133209423 ATTTATTTAAGATTTATGGCTGG - Intergenic
1105604351 13:21914454-21914476 ACATATTTGAGAAAGATGGCAGG - Intergenic
1105970288 13:25423205-25423227 ATTTTTTTAAAAATGAAGGAAGG - Intronic
1106305117 13:28502841-28502863 ATTTATTTGAAAATGATGGCTGG + Intergenic
1106725367 13:32478984-32479006 AATTAGTTGGGAATGATGGCGGG + Intronic
1106727087 13:32497116-32497138 ATCCATTTGAAAGGGATGGCAGG - Intronic
1106864232 13:33946233-33946255 ATTTATTTGATAACGATGGAAGG - Intronic
1107150230 13:37102765-37102787 ATTTGTCTGAAAATGCTGCCAGG - Intergenic
1107461938 13:40612527-40612549 ATTTCTTTCAAAAAGAAGGCTGG + Intronic
1107673060 13:42766680-42766702 ATTATTTTAAAAATAATGGCTGG - Intergenic
1108166380 13:47697512-47697534 AGTCATTTCAAAATGCTGGCAGG - Intergenic
1108337915 13:49465100-49465122 ATTTATTTTAAAAAGAAGGTTGG + Intronic
1108374346 13:49799291-49799313 AATTATTTGAAAATGATATTGGG - Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1108964788 13:56284509-56284531 ATTTATTTCAAAATGAAGATTGG - Intergenic
1111019704 13:82432749-82432771 ATTTATTTGGAGATAATTGCTGG + Intergenic
1111132795 13:83998717-83998739 ATTTGTTTTAAAATGAGGACTGG + Intergenic
1111234677 13:85393303-85393325 ATTACTCTGAAAATGTTGGCAGG - Intergenic
1111599531 13:90454026-90454048 ACTTATTTTAAAATGATCACTGG + Intergenic
1112831495 13:103458179-103458201 ATTTATTTAAAAACTTTGGCCGG + Intergenic
1113401971 13:110002486-110002508 ATTTACAGGAAAATAATGGCTGG + Intergenic
1114187803 14:20416269-20416291 ATTTATGGGAATATGATGGAAGG - Intergenic
1115726379 14:36221685-36221707 ATATATTTGAAAATAAGGGGTGG - Intergenic
1115934490 14:38536350-38536372 AATTATCTGAAAATGATTTCTGG - Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1117482421 14:56160933-56160955 ATTTGTGTGAAAATAACGGCAGG - Intronic
1117707521 14:58486897-58486919 ATATAATTTAAATTGATGGCAGG - Intronic
1117732421 14:58736731-58736753 ATTACTTAGAAAATGATGGGTGG + Intergenic
1118179886 14:63481936-63481958 ATTTTTTAGAAGATGATGGTAGG + Intronic
1118385505 14:65252570-65252592 AGTTATTTGTGAATGATGGCAGG + Intergenic
1118726916 14:68635152-68635174 ATTCATTTGAAATTGAGGGGGGG - Intronic
1118976778 14:70684602-70684624 ATATTTTTTAAAATGCTGGCTGG - Intergenic
1120250743 14:82059676-82059698 AATTATCTGCAAATGATGGCAGG + Intergenic
1120517357 14:85486677-85486699 ATTTATTTTAAAATGATCATAGG - Intergenic
1120853904 14:89196440-89196462 ACTCATTTTAAAATGATGGGTGG + Intronic
1120932725 14:89865474-89865496 CTTTATTTGAAAAGGATGGCTGG + Intronic
1121068443 14:90993143-90993165 GTATGTTTGAAAATGTTGGCTGG + Intronic
1121265330 14:92598821-92598843 ATTTATATTAAAATGATGTTAGG + Intronic
1121497762 14:94408162-94408184 AGTTTTTAGAAAATGTTGGCTGG + Intergenic
1121997911 14:98618980-98619002 ATTTATTAGAAATTGAAAGCTGG + Intergenic
1122197506 14:100100108-100100130 TCTTATCTGAAAATGAGGGCAGG - Intronic
1122512661 14:102282259-102282281 ATTAATTAAAAAATGAAGGCTGG + Intronic
1122748159 14:103912382-103912404 AATTATTTCACAATGATGGGTGG + Exonic
1123216706 14:106814773-106814795 ATGTATATGAAAATGTGGGCAGG - Intergenic
1202872304 14_GL000225v1_random:176154-176176 TTTTATGTCAAACTGATGGCAGG - Intergenic
1123540842 15:21288952-21288974 GTTTATTTAAAAATATTGGCCGG + Intergenic
1123916196 15:25030478-25030500 ATTTATTTTAAAATAATGATAGG + Intergenic
1124110946 15:26786221-26786243 ATGTTTTTGAAAATGTTAGCTGG - Intronic
1124241949 15:28036131-28036153 ATGTAATGGAATATGATGGCTGG - Intronic
1125144400 15:36449935-36449957 ATTTGTTTGAAAAGGATCACTGG - Intergenic
1126206814 15:46055007-46055029 ATTTATTTAAAATTGATCGCAGG - Intergenic
1126260036 15:46678567-46678589 TTCAATTTGAAAATGATAGCAGG - Intergenic
1126275760 15:46878724-46878746 GTTTATCTGAGAATGATGGTGGG + Intergenic
1126358358 15:47819862-47819884 ATTTACTTTAAAATGATGACTGG - Intergenic
1126570574 15:50146305-50146327 TTATATTTGAAAATGTAGGCCGG - Intronic
1127666460 15:61152670-61152692 ATTTATATAAAAATGAAGCCTGG + Intronic
1128784721 15:70386223-70386245 ATTTATAAGCAAATTATGGCCGG - Intergenic
1129017595 15:72482130-72482152 GTCTATTTGAAAATACTGGCCGG - Intronic
1129499481 15:76022245-76022267 CTTTTTTTTAAAAGGATGGCAGG - Intronic
1129529290 15:76249740-76249762 ATATATTTTAAAATGATTACTGG - Intronic
1129610794 15:77054417-77054439 ATCTATATGAAGATGAAGGCAGG - Intronic
1129941812 15:79504015-79504037 ATTAATTTAAAAATGTGGGCAGG - Intergenic
1130143238 15:81250650-81250672 ATTTAGTTTAAAATGATTCCAGG - Intronic
1130816089 15:87434519-87434541 ATTTATTTCTCAATGATTGCAGG - Intergenic
1130858069 15:87859179-87859201 ATTTATTTCAAAAAGATCGATGG - Intergenic
1202949155 15_KI270727v1_random:16094-16116 GTTTATTTAAAAATATTGGCCGG + Intergenic
1132763306 16:1521686-1521708 ATTTTTCTTAAAATGAGGGCTGG - Intronic
1134427024 16:14159631-14159653 CTTTATTTAAGAATCATGGCCGG + Intronic
1134647036 16:15877146-15877168 ATTTTTTTAAAAAAGAAGGCCGG - Intronic
1134835647 16:17358437-17358459 CTTTGTTTGAAAATGATGCTGGG - Intronic
1135741781 16:24981891-24981913 GTTAATTTGAAAAAAATGGCTGG - Intronic
1135889832 16:26347137-26347159 ATTTTTTTTAAATTTATGGCTGG + Intergenic
1135947658 16:26878943-26878965 ATTAACTTTAAAATGATGGATGG - Intergenic
1136678081 16:31932903-31932925 ATTAATTTGAAAATGATTAAAGG + Intergenic
1137509403 16:49085728-49085750 ATGTATTTGTAAATGATGTTAGG - Intergenic
1137672488 16:50287389-50287411 ATTTAATTTAAAATAGTGGCTGG + Intronic
1137849550 16:51725698-51725720 AATTATTTTAAAGTGGTGGCAGG + Intergenic
1140710145 16:77670180-77670202 ATATATTTGAAACTGTTGGAGGG + Intergenic
1141538068 16:84697245-84697267 AATTATTTGAAAATGAAGACTGG + Intergenic
1142650578 17:1348725-1348747 ATTTATTAAAAAATGTAGGCCGG + Intronic
1144016853 17:11204376-11204398 ACTCATGTGAAAATGAAGGCAGG - Intergenic
1146439159 17:32878231-32878253 ATTTATTTAAAAAAAATAGCTGG - Intergenic
1146658053 17:34646760-34646782 ATTTATTTGGAGCTGATGCCAGG + Intergenic
1146711643 17:35047187-35047209 ATTTTTTTTTAAATGAAGGCAGG + Intronic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1147251528 17:39155332-39155354 ATTTTTTTTAAAATCCTGGCCGG + Intergenic
1147295165 17:39476560-39476582 AATTAGTTGAACATGGTGGCAGG - Intronic
1147695811 17:42352042-42352064 ATTAATTTAAAAATGTAGGCTGG + Intronic
1147916102 17:43887643-43887665 ATTTATTAAAAATTCATGGCAGG + Intronic
1149891822 17:60396528-60396550 ATTCTTTTAAAAATGCTGGCTGG + Intronic
1150074057 17:62177519-62177541 ATTGAATTGAAAATGTTGGCCGG - Intergenic
1150729461 17:67679271-67679293 ATCAATTTTAAAATGATTGCAGG + Intronic
1150881071 17:69028645-69028667 ATTTTTTTTAAAATCATGCCAGG - Exonic
1152614304 17:81330860-81330882 TATTCTCTGAAAATGATGGCTGG - Intergenic
1203177639 17_KI270729v1_random:31070-31092 ATTTACTTGAATGTGATGGAAGG + Intergenic
1152968171 18:135973-135995 ATTTATTTAGAGATGATGCCCGG - Intergenic
1153567942 18:6439000-6439022 GTTAATTTGAAAAGAATGGCTGG + Intergenic
1153640316 18:7150964-7150986 ATTTATTTGTTATTCATGGCAGG - Intergenic
1154037542 18:10818524-10818546 GTTGATTTGAAAATGGTTGCAGG + Intronic
1155345647 18:24854153-24854175 ATTTAGTTGAACGTGATGTCAGG + Intergenic
1155648072 18:28105490-28105512 CTTATTTTGAAAATGATAGCAGG - Intronic
1156324489 18:36062019-36062041 ATGTATTTTAAAAACATGGCCGG + Intronic
1157095662 18:44683393-44683415 ATTTAGTTGAAAATGGTGAGTGG + Intronic
1157367836 18:47082579-47082601 ACTTATTTGAAAAGATTGGCAGG - Intronic
1157534171 18:48446480-48446502 ATTAATTTGAAAAAGGTGACTGG - Intergenic
1157640236 18:49205299-49205321 AATTATTTGAATGTGATTGCAGG - Intronic
1157889488 18:51401836-51401858 ATTTATTTGCAAATTTTTGCAGG - Intergenic
1158316531 18:56216999-56217021 ATTTATGTGAAATGGATGGGTGG - Intergenic
1158363593 18:56705696-56705718 ATTACTTTGAAAATAATGACTGG + Intronic
1158431131 18:57388634-57388656 TTTTCTTTGAAAATAATGACAGG + Intergenic
1159514674 18:69442965-69442987 ATTTATTTACAAATAATGGAGGG + Intronic
1159868570 18:73734894-73734916 ATATCTTTGAAAATTGTGGCTGG + Intergenic
1160481550 18:79245358-79245380 AATTATTTTAAATTGGTGGCTGG + Intronic
1160950506 19:1664754-1664776 ATTTCTTTTAAAATCAGGGCCGG + Intergenic
1160970082 19:1764083-1764105 ATGGATTTGAAAAAGATGACAGG - Intronic
1161996610 19:7716759-7716781 ACTTATATTAAGATGATGGCAGG + Intergenic
1162006359 19:7782690-7782712 ATTCATTTAAAAATGAAGACAGG - Intergenic
1163280489 19:16313730-16313752 ATTCATATAAAAATGTTGGCTGG + Intergenic
1163403616 19:17109359-17109381 TCTTATTAGAAAATGATGGCCGG - Intronic
1163702803 19:18794780-18794802 ATTCATATGATAATGTTGGCTGG - Intergenic
1164819001 19:31230083-31230105 ATTTATTTAAAAATGTTCCCTGG + Intergenic
1165530492 19:36396214-36396236 GTTTTTTTGAAAATAATGGGAGG + Intronic
1166910927 19:46156111-46156133 ATTTATCAGAAAGTGATGGTTGG - Intronic
1167714289 19:51131289-51131311 AATTTTTTAAAAATCATGGCCGG + Intronic
926782768 2:16490319-16490341 ATTTATTTTAAAATCATGATTGG - Intergenic
926854480 2:17239175-17239197 ATTCAAATGAAAATCATGGCAGG + Intergenic
929335643 2:40741532-40741554 ATATATTTGAAAATGAAAGCTGG - Intergenic
929468269 2:42166163-42166185 ATTTATTTTAAAATGTCTGCGGG + Intergenic
929633101 2:43486810-43486832 ATCTATTTTGAAATGCTGGCAGG + Intronic
930375933 2:50566549-50566571 ATTCATATTAACATGATGGCTGG - Intronic
930705241 2:54498767-54498789 ATTTATTTGATAAATATGTCTGG + Intronic
930975281 2:57451067-57451089 ATTAATTTAAAAATGTTGGCTGG - Intergenic
931020021 2:58033731-58033753 ATTTATTTTTAAAAGAAGGCAGG + Intronic
931061988 2:58540558-58540580 ATTGATTTGAAAATAAAGTCTGG + Intergenic
931507602 2:62948579-62948601 CTGTATTTGTAAATGATAGCGGG + Exonic
931991293 2:67793055-67793077 TTTTATGGGAAAATGTTGGCAGG - Intergenic
933682063 2:85110794-85110816 CTTAATTTAAAAATGCTGGCTGG - Intergenic
933995504 2:87665591-87665613 ATTTATTTCAAAATCATGAGAGG + Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
936060308 2:109291190-109291212 ATTCCTTTGAAAATGCTGTCAGG + Intronic
936298351 2:111285324-111285346 ATTTATTTCAAAATCATGAGAGG - Intergenic
936386534 2:112034687-112034709 CTTTAAAAGAAAATGATGGCTGG - Intergenic
936603079 2:113919097-113919119 ATTTACTTTAAAATAATTGCAGG - Intronic
936650306 2:114418480-114418502 ATTGGTTTGAAAATGAGGGCTGG + Intergenic
937060200 2:118975126-118975148 ATTTATATTAATAAGATGGCTGG - Intronic
937317157 2:120938931-120938953 TTTTTTTTTAAAAGGATGGCTGG - Intronic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937800324 2:126074699-126074721 ACTTATCTGAAGAAGATGGCAGG - Intergenic
938427567 2:131203691-131203713 TTTTATTTAAAAATATTGGCTGG - Intronic
938468507 2:131537729-131537751 TTTTATTTAAAAATATTGGCCGG - Intergenic
938612467 2:132962258-132962280 ATTATTTTTAAAATGATGCCTGG - Intronic
939498651 2:142952918-142952940 ATTTATTTAAAAAAAATGGCAGG - Intronic
939539272 2:143473702-143473724 ATTTATTTCTAAAATATGGCTGG - Intronic
939570534 2:143835232-143835254 ATTTTTTTAAAAATAATGGTAGG + Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939654700 2:144809190-144809212 GTTTATCTGAAAATGAGGGTTGG + Intergenic
939999141 2:148949635-148949657 ATTGAGAGGAAAATGATGGCAGG + Intronic
940026632 2:149215210-149215232 ATCTATTTGCAAATTATGGGGGG + Exonic
940415436 2:153414077-153414099 TTTTATTTAAAAATGATGGCCGG + Intergenic
941028159 2:160481294-160481316 ATTAATTGGAAATTGATTGCAGG + Intronic
941030551 2:160506774-160506796 ATTCTTATGAAAATGGTGGCTGG + Intergenic
941177979 2:162222850-162222872 ATTTGTTTGAAATTGAGGGAGGG - Intronic
941274072 2:163468584-163468606 AATTAATAGAAAATGAAGGCAGG - Intergenic
941307352 2:163887379-163887401 ATTTTTTTAAAAATAGTGGCTGG + Intergenic
941330671 2:164174594-164174616 ACTTATCTGACAAAGATGGCAGG + Intergenic
941343687 2:164339780-164339802 AATTATTTGAAAATGTTGACAGG - Intergenic
941546934 2:166862559-166862581 ATTCATTTCAAAATGATCCCTGG + Intergenic
941746855 2:169095944-169095966 TTTTCTTTGAAAAGGAGGGCTGG + Exonic
941988736 2:171534000-171534022 AATTATTAGAAAATGTCGGCTGG - Intronic
942011743 2:171770194-171770216 AAATATATGAAAATGAGGGCAGG + Intergenic
942132213 2:172891669-172891691 GTTTATTTGAAAAGGACGTCAGG - Intronic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942689926 2:178574466-178574488 CTTGATTTGAAAATGTTGCCTGG + Exonic
942935141 2:181546783-181546805 ATTCAATTGAAAATGTGGGCAGG + Intronic
943843796 2:192614376-192614398 ATTTATTTAAAAATAGGGGCTGG - Intergenic
944757988 2:202783888-202783910 ATTTATATGTATATGATGGGGGG + Intronic
945242747 2:207691236-207691258 AATTAGTTGGACATGATGGCGGG + Intergenic
945360555 2:208891297-208891319 TTTTACTTGAAAATTATGGCAGG - Intergenic
945382180 2:209154041-209154063 ATTTTTTTGAAGATGGTAGCAGG - Intergenic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
946985813 2:225271799-225271821 ATTAATTAGAAAATACTGGCTGG + Intergenic
947125486 2:226864209-226864231 ATTTCTTTGAAAAAAATGGAGGG + Intronic
947298835 2:228665515-228665537 AGTGATTTGAAAAGGAAGGCTGG - Intergenic
1169750151 20:8983542-8983564 ATTTAATGGAAAATGAAGGGAGG + Intergenic
1169776824 20:9264307-9264329 ATTGATTTAACAATAATGGCAGG - Intronic
1169909462 20:10635709-10635731 TTTTACTTAAAAATGATGTCAGG + Intronic
1169937549 20:10900554-10900576 ATATTTTTGAAAATGAAAGCAGG + Intergenic
1170341189 20:15329176-15329198 AATAATTTGAAAATGGTGGATGG - Intronic
1173589750 20:44215424-44215446 ATTTATTTTAGAAAGATGACTGG + Intergenic
1173878257 20:46390474-46390496 TGTTTTTTGAAAATGAAGGCTGG + Intronic
1174095520 20:48086342-48086364 ATTTATTTGGATATGATTGAGGG - Intergenic
1174902611 20:54516271-54516293 ATGAATTTGAAAATGATGTGGGG + Intronic
1175360940 20:58411973-58411995 AATAATATGAAAATGAAGGCTGG - Intronic
1175447815 20:59036609-59036631 AGTTTTTTGAAAATGAAAGCTGG - Intronic
1176947651 21:15003190-15003212 AGTTATTTGAAAATTAAGGCAGG - Intronic
1176948633 21:15016586-15016608 CTATATTTGAGAATGCTGGCCGG + Intronic
1177311889 21:19408377-19408399 ATTTAGTTGAAAATGATATATGG - Intergenic
1178269869 21:31179594-31179616 ATGTGTTTTAAAATAATGGCAGG + Intronic
1178342303 21:31796326-31796348 TTTTCTCTTAAAATGATGGCAGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180285802 22:10743324-10743346 TTTTATGTCAAACTGATGGCAGG + Intergenic
1180514579 22:16129726-16129748 AATTATCTGGACATGATGGCAGG + Intergenic
1181257711 22:21574661-21574683 GTTTGTTTAAAAATGTTGGCTGG + Intronic
1181298249 22:21859687-21859709 ATTGCTTTGAAAATGATGTTGGG - Intronic
1182339563 22:29608518-29608540 ATTTAGTTGGGCATGATGGCGGG + Intronic
1183288518 22:36983041-36983063 ATTTATTTGAAGAAGTTGCCTGG + Intergenic
1183805043 22:40201719-40201741 CTGTATTTGAAAATGGAGGCTGG - Intronic
949311809 3:2708180-2708202 ATTTACTTCAAAATGAAGGCTGG + Intronic
949407963 3:3734442-3734464 TATTATTTGAAATTGTTGGCAGG + Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
950250783 3:11463550-11463572 AATCATTTAAAAATGATGCCAGG - Intronic
950501513 3:13366811-13366833 ATTTTTTTAAAAATCAGGGCCGG - Intronic
950587121 3:13901401-13901423 ATTTATTTCAAAAGGAGGGGAGG + Intergenic
950763372 3:15254731-15254753 AATTAATTGAAAATGATTACTGG + Intergenic
951115923 3:18861647-18861669 AGTCACTTGAAAATGAGGGCAGG - Intergenic
951559914 3:23955527-23955549 ATTTAAAAGAAAATTATGGCTGG + Intronic
951607512 3:24452384-24452406 TTTTATGTGAAAATGTTGGATGG - Intronic
951906197 3:27710233-27710255 CTTTATTTGGAAATGATTGAGGG - Intergenic
952065407 3:29563726-29563748 ATTTAATAGAAAATGTTGACTGG + Intronic
952312594 3:32203605-32203627 ATGTATTTAAAAATGATAACAGG - Intergenic
952462456 3:33542895-33542917 ATTTATTTAAAAAGGCTGTCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
952760321 3:36907758-36907780 ATTTATTTAAAAATATTGGCCGG - Intronic
953260696 3:41336336-41336358 ACGTATCTGAAAATGATGGAGGG + Intronic
953270331 3:41436409-41436431 TTTTATTTGAAACTGATACCAGG + Intronic
953740906 3:45538192-45538214 ATCTATATGGAAATGTTGGCAGG + Intronic
954559970 3:51548482-51548504 ATATATATGAAAATGTTGGCTGG - Intronic
955142521 3:56283561-56283583 ATTTATTTGTAAAGGGTGGAGGG - Intronic
955246451 3:57228726-57228748 ATATTTTTTAAAATGTTGGCAGG + Intronic
955677016 3:61459375-61459397 ACTTATGTGAAAATGATGGCTGG - Intergenic
955708570 3:61754648-61754670 ATTTATCTGAATTTCATGGCAGG - Intronic
956574068 3:70731967-70731989 ATTTTTTTCAAAATGCTGTCAGG + Intergenic
956676945 3:71744267-71744289 ATTTATTGAAAAAATATGGCAGG + Intronic
957423158 3:79999385-79999407 TGTTATGTGAAAATGATAGCAGG - Intergenic
957473218 3:80688166-80688188 ATTTATTCCAAAAAGATAGCAGG + Intergenic
958797487 3:98721468-98721490 AAATATTAGAAAATGCTGGCCGG + Intergenic
958984772 3:100767550-100767572 ATTTGTTAGAAAAAGATGGAAGG + Intronic
959335484 3:105059332-105059354 ATTAAATTCAACATGATGGCTGG + Intergenic
959666935 3:108932965-108932987 ATTAATTTCAAAATAATGGAAGG + Intronic
959800473 3:110488227-110488249 ATTTATTTAAATATGATTTCTGG - Intergenic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
960508015 3:118516542-118516564 AATTAGCTGCAAATGATGGCAGG + Intergenic
960510685 3:118545381-118545403 ATCTATATGTAGATGATGGCAGG - Intergenic
960680839 3:120246082-120246104 ACTTATTTGAAAATGAGGAATGG - Intronic
960709727 3:120515800-120515822 ATTCATTTGAACATGATGGAGGG - Intergenic
960799020 3:121519378-121519400 ATATATATGAAAATTATGCCAGG + Intronic
962435569 3:135363330-135363352 ATTTCTTTGTAAAGAATGGCTGG - Intergenic
963008235 3:140746364-140746386 ATTTATTTTTAAATGAAGGAAGG + Intergenic
963220331 3:142802846-142802868 TTTTATTTAAAAATGACGGGAGG - Intronic
963426131 3:145127023-145127045 ATTTCTTTGAAACTGCTGTCTGG + Intergenic
963652690 3:148002919-148002941 ATTCATTTTATAATGATGGTGGG - Intergenic
963955582 3:151249983-151250005 TTTTATTTGATAATGATAACAGG - Intronic
964184371 3:153924830-153924852 TTTTATTTGAAATTGATGTGTGG - Intergenic
964443229 3:156733484-156733506 ATTTATTTAACACTGATGGTGGG - Intergenic
964574971 3:158155737-158155759 ATTCCTTTAAAAATAATGGCTGG - Intronic
965204675 3:165706081-165706103 ATATATTTGGCAATGTTGGCAGG + Intergenic
965318678 3:167224160-167224182 ATGTATTAGAATGTGATGGCTGG - Intergenic
965630115 3:170724454-170724476 ACTTATTTTAAAATGTTTGCTGG - Intronic
966134916 3:176686926-176686948 ATTTTTTTTCAAATGAAGGCCGG - Intergenic
966182818 3:177202563-177202585 TGGAATTTGAAAATGATGGCAGG - Intergenic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
967475847 3:189917418-189917440 ATTTTTATAAAAATAATGGCCGG + Intergenic
967869463 3:194218082-194218104 ACTTATTAAAAAATTATGGCTGG - Intergenic
968379551 4:78987-79009 GTATACTTGAAAATGTTGGCCGG - Intronic
968693982 4:2012058-2012080 ATTTATATGGAAATGCAGGCTGG - Intronic
968763586 4:2456378-2456400 ATATATTTTAAAATTATGGCTGG + Intronic
969148995 4:5152455-5152477 GTTTATTTGAAGATGATCCCAGG + Intronic
970612620 4:17739701-17739723 AATTAGTTGAACATCATGGCGGG - Intronic
970697189 4:18691918-18691940 CTATATTTGCAAATGTTGGCTGG + Intergenic
971137735 4:23888318-23888340 GTTTATTTGAAAATGACTGCAGG + Intronic
971463888 4:26933787-26933809 ATTTATTTTAAAATTATATCAGG - Intronic
971666931 4:29499434-29499456 ATTTTTTTTAAAATGATGTTAGG + Intergenic
971777857 4:30991280-30991302 ATTTAGGTAAAAATGATGGCTGG - Intronic
972098263 4:35377754-35377776 ATTTATTAAGAAATTATGGCCGG + Intergenic
972229846 4:37058913-37058935 ATTTATTTCAATAAGATGTCAGG + Intergenic
972575881 4:40351039-40351061 TATTATTTAAAAATGAAGGCCGG + Intronic
972782206 4:42295807-42295829 ATATATTTTTAAATGATGGGTGG - Intergenic
973024171 4:45246272-45246294 AGTTATTTGAAGATGATTACTGG - Intergenic
973088318 4:46097899-46097921 AGTTCTTGGAAAAAGATGGCTGG - Intronic
974008274 4:56582974-56582996 ATTTATTTGAAATTCCTGGCCGG + Intronic
974146894 4:57960049-57960071 TTTTCTTTGAAAAGAATGGCAGG - Intergenic
974773581 4:66449218-66449240 ATTTATCTGAAAATGATTTGGGG + Intergenic
975104992 4:70557639-70557661 ACATATTTGAAAATGCAGGCTGG + Intergenic
975528408 4:75375917-75375939 CTTTATTTGATAATATTGGCTGG - Intergenic
975569622 4:75801382-75801404 ATTTATTAGATAATGATGAGTGG + Intronic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976171097 4:82305426-82305448 TTTTAATTGAAAATTAGGGCCGG + Intergenic
976321488 4:83721603-83721625 ATTTATTTCAAACTGCTTGCTGG + Intergenic
976511751 4:85918073-85918095 ATTTATTATAAAATGATGCATGG + Intronic
976638295 4:87310408-87310430 TTTTATAAGTAAATGATGGCAGG + Intronic
976745392 4:88397961-88397983 TTTTATTTCAATATGATGGGAGG + Intronic
977392069 4:96424118-96424140 AATTATTTGAAAATGATAAATGG - Intergenic
977766423 4:100804004-100804026 ATTTAATTGAAATTCAAGGCAGG + Intronic
978111461 4:104968665-104968687 AAATATTTGAAAATGGTGACTGG + Intergenic
978416684 4:108484334-108484356 ATTGATTTGAAATTGGTGTCGGG - Intergenic
978507949 4:109480773-109480795 TCTTAATTGAAAATGAAGGCCGG - Intronic
979389671 4:120113449-120113471 ACTTATTTGAAAATAGAGGCCGG - Intergenic
980998517 4:139804881-139804903 ATTAATTTAAAAATGATGCTGGG + Intronic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981947989 4:150372311-150372333 ATATTATTGAAAATGTTGGCTGG + Intronic
981993205 4:150949087-150949109 ATTTATTTGGGAAAAATGGCAGG - Intronic
982334786 4:154222282-154222304 GTTTATTAGAAAATATTGGCTGG + Intergenic
983097273 4:163578328-163578350 CTTTCTTTGAAAATGATTGCTGG - Intronic
983507522 4:168571042-168571064 TCTTCTTTGAAAATAATGGCAGG + Intronic
983621973 4:169771583-169771605 ACTTATTTAAAAAATATGGCCGG - Intergenic
983800352 4:171920744-171920766 CTTTCTTTGAAAATGGTGTCAGG - Intronic
984281522 4:177676578-177676600 ATTGAGCTGAAAATGGTGGCTGG + Intergenic
984367211 4:178814842-178814864 ATTTCTTTAAATATTATGGCTGG + Intergenic
984414770 4:179444220-179444242 GTTTATTTGAACAAGATGACTGG + Intergenic
986550037 5:8943256-8943278 ATTTTTTTAAAAATGATGATAGG + Intergenic
987334058 5:16883209-16883231 AATTTTTTAAAAATGATGGCCGG - Intronic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
987790282 5:22557275-22557297 ATTTGTTTGTAAATGTTTGCAGG - Intronic
987962314 5:24825947-24825969 ATTTAAATGAAAATGATCGTTGG - Intergenic
988028800 5:25735644-25735666 ATTTATTTGTAAGTGATTGATGG - Intergenic
988053190 5:26056755-26056777 GTCTAGATGAAAATGATGGCAGG + Intergenic
988386160 5:30567771-30567793 ATTTATTTGTACATGATTGGTGG + Intergenic
988445246 5:31279269-31279291 ATTTTTAAGAAAATCATGGCTGG + Intronic
988552860 5:32212269-32212291 ATGAATTTAAAAATCATGGCCGG - Intergenic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
989829396 5:45895728-45895750 ATTTATTTGATGCTGGTGGCTGG - Intergenic
990555417 5:56929633-56929655 ATTTATTTGAAATTGGTGTGTGG + Intronic
990808432 5:59694121-59694143 AGATATTTGAAAATGGAGGCTGG - Intronic
991155875 5:63434342-63434364 AATTATCTGAGAGTGATGGCAGG - Intergenic
991373861 5:65945136-65945158 ATTTATTTCAAAATGTATGCAGG + Intronic
991709826 5:69397819-69397841 ATGTATTTGAAAATCATGGCCGG + Intronic
991946675 5:71904595-71904617 AATTAGATGAAAATGCTGGCAGG - Intergenic
991981832 5:72239879-72239901 ATTGATTTGAAAATGTTGCCTGG - Intronic
992036737 5:72786637-72786659 CTTTATTTGATGATTATGGCAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992392757 5:76344406-76344428 ATTTATTTAAAAATGATTTTAGG + Intronic
993136194 5:83967307-83967329 ATTTATTTTGAGATGATGTCTGG - Intronic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994517508 5:100789484-100789506 ATTCATTTTAAAATGCTGTCAGG + Intergenic
994527087 5:100919405-100919427 ATTAATTTGAAAAGGATAACAGG - Intergenic
994539518 5:101076899-101076921 ATTTAATTGCAGATGATGGCAGG - Intergenic
995103571 5:108347036-108347058 CTGTATTTGAAAATGTTGTCAGG - Intronic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995518721 5:112979231-112979253 ATATATTTAAAAATTAGGGCTGG + Intronic
995897522 5:117032014-117032036 AATTAATTGAAAGTGCTGGCCGG - Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996738939 5:126781323-126781345 ATTTATTCAGAAAGGATGGCAGG + Intronic
996754322 5:126920179-126920201 ATTTTTTTGAAAGGGTTGGCAGG + Intronic
996863566 5:128091834-128091856 ATTTTTTTAAAAATTAAGGCAGG - Intronic
997798919 5:136840425-136840447 CTTTGTTTGAAAATGATGTATGG + Intergenic
998650460 5:144114579-144114601 ATTTATATGAAAATGCAGGGGGG + Intergenic
1000197042 5:158969624-158969646 AATTAGTTGAACATGGTGGCAGG + Intronic
1000627060 5:163550754-163550776 AATTAGTTGGAAATGGTGGCAGG + Intergenic
1001055076 5:168442538-168442560 TGTTATTTGAAAATCTTGGCCGG + Intronic
1001601207 5:172929889-172929911 AGTTCTTAGAAAAAGATGGCTGG + Intronic
1001720060 5:173849646-173849668 ATTTATTTAGAGATGGTGGCTGG + Intergenic
1002147810 5:177199556-177199578 ATTAAGTTGAATATGAAGGCTGG - Intronic
1002403967 5:179014415-179014437 TTTTTATTAAAAATGATGGCTGG - Intergenic
1002679986 5:180954077-180954099 ATTTATTTTAAAATGAAGTTGGG + Intergenic
1004872498 6:19921207-19921229 ATCTATTTTAAAATGGTGCCTGG + Intergenic
1005891696 6:30145799-30145821 ATTTATTGGATAATGATGGGGGG - Intronic
1005919200 6:30383768-30383790 AATTATTTTAAAATGATCGGCGG - Intergenic
1006125321 6:31834256-31834278 ATTTATTTAAAAATTAGGCCGGG - Intergenic
1006563864 6:34937325-34937347 ATTTTTTTAAAAAGAATGGCTGG + Intronic
1007057745 6:38904492-38904514 ATTAATCTGAAAATGCTGGCCGG + Intronic
1007844655 6:44743160-44743182 ATTTATATGAAGATGATTGCAGG - Intergenic
1007906997 6:45471732-45471754 ATAGCTTTGAAAATGTTGGCCGG - Intronic
1008914148 6:56768772-56768794 AAATATTTGCAAATCATGGCTGG + Intronic
1009234136 6:61102531-61102553 ATCTCTTTGATAATGCTGGCTGG + Intergenic
1009466090 6:63970802-63970824 TTTTATTTAAAAATGATGAGAGG + Intronic
1009941708 6:70297214-70297236 AATTAATTTAAAATGATGGAGGG + Intronic
1010190636 6:73192770-73192792 ATTTATTTTAAAATAATCACTGG - Intronic
1010925705 6:81743330-81743352 GTTTATTTAAAAATGAAGACTGG - Intronic
1010928488 6:81772201-81772223 CCTTATTTGAACATGAGGGCAGG - Intergenic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011555968 6:88571859-88571881 ATGTATGTGAAGATGATGGAAGG + Intergenic
1011873696 6:91929238-91929260 ATTGATTTGAATATTATGGCTGG - Intergenic
1011906197 6:92371523-92371545 ATTTATAAGAAAATCATGGGTGG + Intergenic
1013949097 6:115757895-115757917 ATGTGTTTGAATATGTTGGCAGG + Intergenic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014384238 6:120781004-120781026 CTTTGTTTGAACATGGTGGCAGG - Intergenic
1014579638 6:123121210-123121232 ATTTAAGTGGAAATGATGGTAGG + Intergenic
1015172837 6:130273175-130273197 ATATATTTACAAATGATGGTAGG + Intronic
1015625458 6:135177225-135177247 TTTTATTTTAAAATGATTCCTGG - Intergenic
1015856601 6:137631720-137631742 ATTTATTTGTAAAAGATAGATGG - Intergenic
1016111005 6:140223361-140223383 ATTTCTTTGAAAATAATTTCTGG - Intergenic
1016522898 6:144966494-144966516 ATTTTTTTGCAAATGAGGGATGG - Intergenic
1016622958 6:146133934-146133956 ATGTTATCGAAAATGATGGCAGG - Intronic
1016652408 6:146477621-146477643 ATTGATTTTAAGATGATGGTAGG + Intergenic
1016712214 6:147186606-147186628 ATTTTCTGGAAAATGCTGGCAGG + Intergenic
1016951974 6:149589098-149589120 ATTTTTTTTAAAAAAATGGCTGG - Intronic
1017376034 6:153769209-153769231 ATATATTTAAAAAAGAAGGCTGG + Intergenic
1017730090 6:157307715-157307737 ATTCATTTAAAAATGATTCCAGG + Intronic
1018567762 6:165173836-165173858 ACCTATTTGCAAATGATAGCAGG + Intergenic
1018732881 6:166666093-166666115 ATTGATCCGCAAATGATGGCAGG + Intronic
1021449640 7:20771267-20771289 ATTTATTTTAATATTATGGCGGG + Intronic
1021927879 7:25550799-25550821 TTTTAAATGGAAATGATGGCTGG + Intergenic
1021984602 7:26086343-26086365 AGTCATTTGAAAATGATGAGGGG + Intergenic
1022020125 7:26391317-26391339 ATTTCTTTAAAAAAGTTGGCTGG - Intergenic
1022084777 7:27056335-27056357 GTTTATTTGAAGATCAAGGCTGG - Intergenic
1022405002 7:30080774-30080796 ATTAGTATGAATATGATGGCAGG + Exonic
1022663703 7:32388936-32388958 ATTTCATTGAAAGTGATGCCAGG + Intergenic
1023065398 7:36372806-36372828 ACATATGTAAAAATGATGGCTGG + Intronic
1023425009 7:40026748-40026770 TTTCATTTTAAAATGAAGGCTGG - Intronic
1024866099 7:53906315-53906337 AGTTATCTGAAAAAGGTGGCAGG - Intergenic
1025172648 7:56774004-56774026 TTTTATTTGAAAAATGTGGCTGG - Intergenic
1027698871 7:81443923-81443945 ATTTATTTGAAAATTGTGCGTGG + Intergenic
1028024048 7:85814237-85814259 ATTTATTATAAAATTATGGATGG + Intergenic
1028151129 7:87373587-87373609 ATTTAGTTGGAAATGTTGGCAGG + Intronic
1028330636 7:89586847-89586869 AGTTATTGGGAAATCATGGCAGG - Intergenic
1028485827 7:91356161-91356183 ATTTGTTTGTAAATGAGAGCAGG - Intergenic
1028890804 7:95986595-95986617 ATTTACTTGTAAATGCTGACAGG - Intronic
1029300232 7:99577019-99577041 ACTTATTTAAAAAATATGGCTGG - Intronic
1030152626 7:106422014-106422036 AGTTATTTGAGAATGAAAGCAGG + Intergenic
1030226123 7:107153013-107153035 AATTATTTTAAAATGCTGGCTGG + Intronic
1031059879 7:117039279-117039301 ATATATTTAAAAATATTGGCTGG + Intronic
1031262738 7:119542961-119542983 ATTTATTTCTAAATGTTGCCTGG + Intergenic
1031761416 7:125717088-125717110 AGTTATCTGAAAATAATGGTAGG - Intergenic
1031849091 7:126841932-126841954 ATTTGTTTGAAAATAAAGGCTGG - Intronic
1032613910 7:133445273-133445295 TTGTATTTGAAAGAGATGGCTGG + Intronic
1032628214 7:133616602-133616624 ATTTTTGTGACAATGATGGCAGG + Intronic
1033029166 7:137808318-137808340 ATTTATTTCAAAAAAATGGTAGG + Intronic
1033372268 7:140720334-140720356 ATGCATTTTAAAATGAAGGCAGG + Intronic
1033886391 7:145952884-145952906 TTTTAATTTAAAATGAAGGCTGG - Intergenic
1034310004 7:150079106-150079128 TTTTATGTGAAAATGATTGTAGG + Intergenic
1034833193 7:154327851-154327873 ATTTCTTTGCAAATGATCACAGG - Intronic
1035087315 7:156271628-156271650 ATTTATCTGAAACTTGTGGCTGG + Intergenic
1035729602 8:1844769-1844791 TTTTAATTGAAAATGAGGTCGGG + Intronic
1035924910 8:3716960-3716982 ATTTTTTTGTAAATGATTGTAGG - Intronic
1036023313 8:4873159-4873181 ATTCATTTCAAAATGATAGGAGG + Intronic
1036028850 8:4943197-4943219 CTTTATTTGAAAATCATGGCCGG + Intronic
1036123375 8:6041545-6041567 CTTTCTTTGAAAATGATGTGAGG - Intergenic
1037146166 8:15575616-15575638 AATTAATTGAGAATGGTGGCGGG + Intronic
1037845604 8:22279319-22279341 AATCTTTTGAAAATGATGGCAGG + Exonic
1038591383 8:28841293-28841315 ATTTGTTTAAAAATGATGCTAGG - Intronic
1040030987 8:42823460-42823482 ATTTATCTGTGGATGATGGCAGG + Intergenic
1041346897 8:56908938-56908960 ATGTATTCTAAAATAATGGCAGG - Intergenic
1042009193 8:64220940-64220962 ATTTATTTGAAAATGATCTCAGG - Intergenic
1042666568 8:71213243-71213265 AATAATTTGAAAATGATAACAGG - Intronic
1043083855 8:75802245-75802267 GTTTATATAAAAAGGATGGCTGG - Intergenic
1043557051 8:81442894-81442916 ATTAATTTTAAAATGTTGGCTGG + Exonic
1044743883 8:95353917-95353939 ATTGAGTTGAAAGTGATGGCTGG + Intergenic
1045304382 8:100945736-100945758 ACCTATTTGAAAAAGATGGTAGG + Intronic
1045686412 8:104717094-104717116 ATTTTTATCAAAATGATAGCTGG - Intronic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047414901 8:124656473-124656495 TTTTAAATGAAAATGAAGGCTGG + Intronic
1047595608 8:126374880-126374902 GTTTATTTACAAAAGATGGCTGG + Intergenic
1047990003 8:130276211-130276233 ATTTGTTTAAAAAAGAAGGCTGG + Intronic
1048179331 8:132180777-132180799 ATTTATTGGAAGATGATGTTAGG + Intronic
1051816371 9:21111535-21111557 ATTAATTTGAACATAATGTCAGG - Intergenic
1051882685 9:21855839-21855861 ATTTACTTCACAATGAGGGCAGG - Intronic
1052452566 9:28650892-28650914 ATATATTTGAAAATTATGGCTGG + Intronic
1053090033 9:35266762-35266784 ATTTATTTTAAAATGTTGTAGGG + Intronic
1053182492 9:35985676-35985698 TTTTATTGGAAAATGATGTTTGG - Intergenic
1053190315 9:36060411-36060433 ATGTATTTGAAAATTTGGGCTGG - Intronic
1053300381 9:36944808-36944830 ATTTATTTTAAAATCATTACCGG - Intronic
1053582104 9:39415691-39415713 ATCAATTTGAAAATGGAGGCTGG - Intergenic
1053846521 9:42243017-42243039 ATCAATTTGAAAATGGAGGCTGG - Intergenic
1054103682 9:60974430-60974452 ATCAATTTGAAAATGGAGGCTGG - Intergenic
1054582668 9:66932416-66932438 ATCAATTTGAAAATGGAGGCTGG + Intergenic
1054718590 9:68581628-68581650 AATTAGTTGGACATGATGGCGGG + Intergenic
1055646345 9:78364905-78364927 ATTCATTTGCAAATGATCTCTGG + Intergenic
1055707864 9:79027072-79027094 ATTTTTGTGAAAATGTTGGATGG + Intergenic
1056438007 9:86591545-86591567 ATTAATTTGAAAAGCAAGGCTGG - Intergenic
1058559721 9:106213072-106213094 ACTCATTTAAAAATGTTGGCTGG - Intergenic
1058597384 9:106629709-106629731 ATGTGTTTGAAAATGAGGTCAGG - Intergenic
1058704706 9:107628679-107628701 ATTTATTTGAAAAATTTGGCTGG - Intergenic
1058929073 9:109700717-109700739 ATTTATTTGAAAATTTTTGCTGG + Intronic
1059000429 9:110342894-110342916 GTTTATTTGAAATTAGTGGCTGG + Intergenic
1059126326 9:111689867-111689889 ATTTATTTAAAAATGACTTCTGG + Intronic
1059611430 9:115901571-115901593 ACTCATTATAAAATGATGGCTGG + Intergenic
1060366436 9:123019978-123020000 GTTTATATAAAAAAGATGGCCGG - Intronic
1060390875 9:123275655-123275677 GTTGATTTAGAAATGATGGCAGG - Intergenic
1062507063 9:136883017-136883039 AATTAACTGAACATGATGGCAGG - Intronic
1203732150 Un_GL000216v2:100386-100408 TTTTATGTCAAACTGATGGCAGG + Intergenic
1185599691 X:1330308-1330330 ATTTAGCTGGACATGATGGCAGG + Intergenic
1186234806 X:7496184-7496206 ATTTATTTAAAAATGAGGTGGGG + Intergenic
1186757911 X:12692189-12692211 ATTTCTTTTAAAATGTTGGAAGG + Intronic
1186887921 X:13933295-13933317 AATAATTTTAACATGATGGCTGG - Intronic
1187413598 X:19072685-19072707 ATTTTTTTCAAGATGATTGCTGG - Intronic
1187700201 X:21957580-21957602 CATTATTTGAAAAAGAAGGCCGG - Intronic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189976725 X:46468237-46468259 ATCTACTTTAAAATGATGCCAGG + Intronic
1191032201 X:55986847-55986869 TGTTATTTGAGAGTGATGGCTGG - Intergenic
1192120815 X:68453931-68453953 AATTATTTAATAATCATGGCCGG + Intergenic
1192724863 X:73738710-73738732 ATTTATTTAATAATGAGAGCAGG + Intergenic
1192788870 X:74360464-74360486 ATTCCTTTGAAAATGAAGGAAGG + Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193463979 X:81824771-81824793 TTTTATTTCAAAATGTTGCCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194893493 X:99408970-99408992 ATTTATTTTAATATGATAGTGGG - Intergenic
1195739357 X:108047236-108047258 ATGTATGTGAAAATGATGTCTGG - Intronic
1195824624 X:108984861-108984883 ATTTATGTGAAAAATATTGCTGG + Intergenic
1196374878 X:115022439-115022461 ATTTATTAGAAAATGATAAATGG + Intergenic
1197293817 X:124692708-124692730 AGTTATTTGAAAATTCTGGCCGG + Intronic
1197475115 X:126913372-126913394 TTATATTTTAAAAGGATGGCTGG + Intergenic
1197996354 X:132379507-132379529 TTTTATTTGAATTTGCTGGCTGG + Exonic
1198265248 X:135002909-135002931 ATTTATTTAAAAAAGCAGGCTGG + Intergenic
1198848715 X:140941946-140941968 ATATTTTTGAAAATGAAAGCGGG + Intergenic
1199204620 X:145134370-145134392 ATTCCTTGGCAAATGATGGCAGG - Intergenic
1199532207 X:148862431-148862453 ATTTTTTAAAAAATGATGGGAGG + Intronic
1199532941 X:148870254-148870276 TGTTATTTGAAAATGACTGCAGG - Intronic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1201226488 Y:11823845-11823867 ATTTAGTTGGAAATGGTGGGTGG + Intergenic
1202101411 Y:21311866-21311888 ATCTTTTTCAAAATGATGGTAGG + Intergenic