ID: 1106308229

View in Genome Browser
Species Human (GRCh38)
Location 13:28532295-28532317
Sequence CAGGGTGGACAGCGGGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 407}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106308229 Original CRISPR CAGGGTGGACAGCGGGCGGG TGG (reversed) Intergenic
900094616 1:935192-935214 CCGGGGGGACAGCGGGAGGTTGG + Intronic
900245499 1:1634354-1634376 CGGGGTGGGCAGCCCGCGGGCGG + Intronic
900256730 1:1701513-1701535 CGGGGTGGGCAGCCCGCGGGCGG + Intronic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
900663375 1:3797416-3797438 CAGGGTGGGGTGCGGGCGGATGG + Intergenic
901007706 1:6179861-6179883 CAGGGCGGAGCGCGGGCGGCGGG - Intronic
901078428 1:6569996-6570018 CAGGGAGGAGAGAGGGAGGGAGG + Intronic
901131229 1:6963278-6963300 CGGGATGGAAAGCGGGGGGGGGG - Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
903800269 1:25961992-25962014 CAGGCTGGACAGATGGTGGGGGG + Exonic
904625611 1:31800225-31800247 CAGGGTGGACTGGAGGAGGGAGG - Intronic
905167192 1:36089592-36089614 CGGGGTGGAGAACGGGCTGGTGG - Intronic
905449381 1:38046920-38046942 CAGGGTGGCGGGCGGGCGCGCGG - Intergenic
905485381 1:38292420-38292442 CAGGCTGGGCAGCGGGCCGGTGG - Intergenic
905797509 1:40823934-40823956 CAGGGTGGACAGTGGGAGACTGG - Intronic
906484820 1:46226160-46226182 CAGGGTGGAAAGTGGGCAGGAGG + Intergenic
907046292 1:51302245-51302267 CAGGATAGACTGGGGGCGGGGGG - Intronic
907406710 1:54258241-54258263 AAGGGTGGGCGGCGGGCGTGCGG + Intronic
910038909 1:82823744-82823766 CAGGGTGGAGTTGGGGCGGGGGG - Intergenic
910118635 1:83760274-83760296 CAGGGTGAACAGCTTGCAGGAGG + Intergenic
910374318 1:86552524-86552546 AAGGCTGGGCAGCGGGCGGCAGG + Intronic
910712957 1:90200685-90200707 AAGGGTGGACATTGAGCGGGAGG + Intergenic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
912745144 1:112239750-112239772 CAGGGTGGACCGCAGGCGCAGGG + Intergenic
913077215 1:115350958-115350980 CAGGCTGGACATGAGGCGGGAGG + Intergenic
913331631 1:117672523-117672545 CAAGGTGGTCAGCAGGCTGGTGG + Intergenic
915444431 1:155966788-155966810 CAGGGAGGGCAGAGGGCTGGGGG - Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
916502205 1:165396681-165396703 CAGGGTATACAGCGAGAGGGAGG - Intergenic
917484959 1:175447383-175447405 GAGGGTGGGCAGCGGGAAGGAGG + Intronic
917642748 1:176998656-176998678 CTGTGTGCACAGCGGTCGGGTGG - Intronic
920685306 1:208104656-208104678 TAGGGTGTACAGTGGGTGGGAGG + Intronic
922187149 1:223285840-223285862 GAGGGTGGAGAGCGGGAGAGAGG + Intronic
922315140 1:224434927-224434949 GAGGGAGGCCAGCGGGCCGGCGG + Intronic
922778673 1:228232078-228232100 CAGGGTGGCCAGATGGTGGGGGG - Intronic
922937856 1:229434809-229434831 CAGGATAGACAACTGGCGGGGGG + Intergenic
923506522 1:234609928-234609950 CCGGGGGGGCAGGGGGCGGGGGG + Intergenic
1063434341 10:6018304-6018326 CAGGGAGGACAGGGTGAGGGTGG + Intronic
1063960365 10:11301402-11301424 CAGGGTGGGGTGCGGGAGGGGGG - Intronic
1069692634 10:70363946-70363968 CAGGGAGGAGAGGGGGCTGGAGG - Intronic
1070711305 10:78685253-78685275 CAGGGATGAAAGCTGGCGGGAGG - Intergenic
1070760945 10:79024098-79024120 AAGGGTAGACAGAGGGGGGGGGG + Intergenic
1074884617 10:117684447-117684469 CAGGGTCGGCAGCCGCCGGGAGG - Intergenic
1075518199 10:123126484-123126506 AAGGCTGGACAGAGGGCAGGAGG - Intergenic
1075666424 10:124234001-124234023 CCTGGTGGACAGAGGGCTGGGGG - Intergenic
1075705381 10:124497311-124497333 CAGGGTCCACGGCGGGCAGGGGG - Intronic
1075724602 10:124604904-124604926 CAGGGTAGAGAGGAGGCGGGTGG + Intronic
1075748609 10:124744689-124744711 CGTGCAGGACAGCGGGCGGGTGG + Intronic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076687352 10:132204112-132204134 CTGGGCAGACAGCGGGCAGGAGG - Intronic
1076790678 10:132775196-132775218 CAGGGAGGAGAGGGGGCAGGGGG + Intronic
1077017764 11:404463-404485 CAGGAGGGACAGCGGGCAGAGGG + Intronic
1077063310 11:627014-627036 CAGGGCGCACTGGGGGCGGGTGG + Intronic
1077210813 11:1370236-1370258 CGTGGAGGGCAGCGGGCGGGGGG - Intergenic
1077231606 11:1460287-1460309 CAGGGTGGGCAGGCGGCGGCCGG - Intronic
1077249980 11:1556789-1556811 GAGGGCGCACAGGGGGCGGGCGG - Exonic
1078536921 11:12182768-12182790 CAAGGTGGACAGTGGGAGGAGGG - Intronic
1078655875 11:13238575-13238597 GAGGGTGGGCAGCGGGAGGATGG + Intergenic
1078771923 11:14359092-14359114 CAGGGGCGGCAGCGGCCGGGGGG + Exonic
1080765149 11:35289164-35289186 CAGGGAGGACAGAGGGAGTGGGG - Intronic
1083272918 11:61580998-61581020 CAGCGTGCTCCGCGGGCGGGCGG - Intronic
1083458375 11:62794329-62794351 GAGGGTGGGCACCGGGCTGGAGG + Exonic
1083849029 11:65354808-65354830 CTGCGCGGACGGCGGGCGGGCGG - Exonic
1083883129 11:65558076-65558098 CAGCGGGGGAAGCGGGCGGGAGG + Exonic
1084086394 11:66857171-66857193 GAGGGTGGGCGGCGGGCGGCCGG + Intronic
1084153549 11:67302183-67302205 CTGGGTGGACCGGGGGCTGGGGG - Exonic
1085298336 11:75443434-75443456 CAGGGAAGACAGTGGGCTGGTGG + Intronic
1089305166 11:117521934-117521956 CATGGAGGACAGCTGGGGGGAGG - Intronic
1089573000 11:119422610-119422632 CTGGGTGGAAGGCGGGCGGACGG - Intronic
1089573834 11:119427399-119427421 AAGCATGGACACCGGGCGGGGGG - Intergenic
1090770534 11:129915682-129915704 CAGTGGGGACAGCAGACGGGAGG + Exonic
1095688566 12:45063027-45063049 CAGGGTGGGAAGTGGGAGGGTGG - Intergenic
1096515341 12:52152420-52152442 CACGTTGGCCTGCGGGCGGGCGG + Intergenic
1098382597 12:69884492-69884514 GAGGGTGGACAGGGGCAGGGAGG - Intronic
1102150988 12:110689088-110689110 CAGCGGTGACCGCGGGCGGGTGG - Intronic
1102452193 12:113050191-113050213 CAGGGAGGTCAGTGGGCTGGAGG - Intergenic
1102466993 12:113135756-113135778 CTGGGCGGGCAGGGGGCGGGAGG + Intronic
1102534534 12:113570653-113570675 CAGGGTGGGCAGGGGGGCGGGGG + Intergenic
1103793146 12:123485719-123485741 CAGGGTGAACCGGGGGCGGTTGG + Exonic
1104858996 12:131915140-131915162 CAGCGTGGGCAGGGGGCGAGGGG - Exonic
1104972722 12:132539308-132539330 CTGGGTGGGCATCGGGCTGGAGG - Intronic
1104972732 12:132539337-132539359 CTGGGTGGGCATCGGGCTGGAGG - Intronic
1104972742 12:132539366-132539388 CTGGGTGGACATGGGGCTGGAGG - Intronic
1104972752 12:132539395-132539417 CTGGGTGGACATGGGGCTGGAGG - Intronic
1104972775 12:132539458-132539480 CTGGGTGGGCATCGGGCTGGAGG - Intronic
1104972805 12:132539545-132539567 CTGGGTGGGCATCGGGCTGGAGG - Intronic
1104972815 12:132539574-132539596 CTGGGTGGGCATCGGGCTGGAGG - Intronic
1104972922 12:132539880-132539902 CTGGGTGGGCATCGGGCTGGAGG - Intronic
1104972932 12:132539909-132539931 CTGGGTGGGCATCGGGCTGGAGG - Intronic
1104972964 12:132539996-132540018 CTGGGTGGGCATCGGGCTGGAGG - Intronic
1104972974 12:132540025-132540047 CTGGGTGGGCATCGGGCTGGAGG - Intronic
1104984213 12:132587490-132587512 GAGGGTGGGCAGCTGGAGGGTGG + Intergenic
1105299430 13:19118906-19118928 CAGGGTGGGGAGCGGGAGGGAGG + Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1106308245 13:28532343-28532365 CGGGTTGGACAGTGAGCGGGTGG - Intergenic
1106308254 13:28532376-28532398 CGGGGTGGGCAGCAGGCGGGTGG - Intergenic
1106358279 13:29005523-29005545 CAGGGTGGAGAGGAGTCGGGAGG + Intronic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1111448326 13:88379948-88379970 AAGGGTGGATAGAGGGTGGGAGG - Intergenic
1112203497 13:97301530-97301552 AAGGGAGGACAGCGGGTTGGTGG + Intronic
1112331050 13:98477283-98477305 CTGGGTGGACAGTGGGGAGGAGG + Intronic
1112651034 13:101398778-101398800 CAGGGTGCACAGCGTGGGGAGGG + Intronic
1112690260 13:101885342-101885364 CAGGGTGGAGGGTGGGAGGGAGG + Intronic
1113285636 13:108845461-108845483 CAGGGCGGACAGCAGGAGGCAGG + Intronic
1113653806 13:112056103-112056125 CCGGGTGGACACGGGACGGGAGG + Intergenic
1113796623 13:113061951-113061973 CAGAGTGGACTGCGTGGGGGTGG - Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1113956467 13:114102199-114102221 CAGGATCCACAGCGGGCGGGTGG + Intronic
1114050937 14:18919470-18919492 CAGGGTGGGGAGCGGGAGGGAGG - Intergenic
1114111622 14:19482452-19482474 CAGGGTGGGGAGCGGGAGGGAGG + Intergenic
1117029280 14:51652059-51652081 CAGGGGGCACAGCGGGCGTCCGG - Intronic
1118846011 14:69548270-69548292 CAGGGAGCACAGAGAGCGGGGGG - Intergenic
1119704826 14:76776973-76776995 CTGGGAGGCCAGCGGGCGGTAGG + Intronic
1120976582 14:90254224-90254246 TAGGGTGGACAGAGGGGGCGGGG - Intergenic
1121129163 14:91429468-91429490 CAGAGTAGATAGCTGGCGGGAGG + Intergenic
1122840873 14:104461949-104461971 CAGCGAGGACAGCGGCAGGGGGG + Intergenic
1122886919 14:104714323-104714345 CAGGGTGGGCTGAGGGCCGGGGG - Exonic
1122900264 14:104779499-104779521 CAGGGTGGACAGCTGCCCCGGGG - Intronic
1123113134 14:105882242-105882264 CAGGGTGGAGAGGAGGTGGGCGG + Intergenic
1123115480 14:105892392-105892414 CAGGGTGGAGAGGAGGTGGGCGG + Intergenic
1124349390 15:28944032-28944054 CAGGGTGGAGAGTGGGCCAGAGG - Intronic
1124465599 15:29936514-29936536 CAGTTTGGAGAGCCGGCGGGTGG - Intronic
1124661713 15:31555138-31555160 CAGGATGGACAGCTGGATGGTGG + Intronic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1125541168 15:40470971-40470993 GGGGGTGGAGAGCGGCCGGGCGG + Intergenic
1125679848 15:41523741-41523763 CCTGGTGGACAGCCGGCAGGAGG + Intronic
1125892418 15:43276429-43276451 CAGGGAGGGCAGCTGGAGGGCGG + Exonic
1126048986 15:44669906-44669928 CTGGGTGGACAGAGTGTGGGAGG - Intronic
1126523222 15:49620901-49620923 CTGGGACGACAGCGGGGGGGGGG - Exonic
1128072473 15:64806508-64806530 CAGGCTGGACTGGGGGCTGGGGG - Intergenic
1129149658 15:73680160-73680182 CAGAGTGGAGTGCGGGTGGGTGG + Intergenic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131117425 15:89803710-89803732 GGGTGTGGACAGCGGGTGGGAGG + Exonic
1132211543 15:100027073-100027095 CAGGGTGAACAACAGTCGGGAGG + Intronic
1132514840 16:361448-361470 CATGGCGGACAGCGGGACGGTGG - Intergenic
1132534529 16:471510-471532 CACGGTGCACACAGGGCGGGAGG - Intronic
1132574555 16:658521-658543 CAGGGTGGACACCGGGCAGCTGG - Exonic
1132854831 16:2040069-2040091 CAGTGCTGACAGAGGGCGGGCGG + Intronic
1133103942 16:3494881-3494903 CAGAGGAGACAGCGGGAGGGTGG + Intronic
1133266387 16:4586912-4586934 CCGTGTGGACAGCAGGCAGGTGG - Intronic
1134188261 16:12100851-12100873 CAGGGAGGGCAGCTGGCAGGTGG + Intronic
1134241581 16:12510731-12510753 CAGGCTGGACAGCTGGGGGGTGG - Intronic
1135738627 16:24954510-24954532 AGGGGTGGACAGGGGGCTGGCGG + Intronic
1135940317 16:26816731-26816753 CAGGATGGACAGAGGGAGAGGGG - Intergenic
1136155619 16:28380210-28380232 CGGGGTGGGAAGCGGGCAGGTGG - Intronic
1136155637 16:28380261-28380283 CGGGGTGGGAAGCGGGCAGGTGG - Intronic
1136207447 16:28735028-28735050 CGGGGTGGGAAGCGGGCAGGTGG + Intronic
1136207465 16:28735079-28735101 CGGGGTGGGAAGCGGGCAGGTGG + Intronic
1136575764 16:31123932-31123954 CAGGGTGGATAACGGGCCAGTGG + Intronic
1137610214 16:49812902-49812924 CAGGGAGGACAGTGGGTGGCTGG + Intronic
1138496560 16:57412567-57412589 CAGGGTGGACTGTGAGAGGGTGG + Intronic
1139655639 16:68385597-68385619 CAGGGTGGTCACCAGGCTGGGGG - Intronic
1139908463 16:70381935-70381957 CAGGGAGGAGAGGGGACGGGAGG + Intronic
1141233958 16:82198028-82198050 CAGGGAGGTCAGCGGGACGGTGG + Intergenic
1142246547 16:88972802-88972824 AAGGGGGGACAGGAGGCGGGAGG + Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142805550 17:2369484-2369506 CAGGCTGGACGGGGGGAGGGGGG - Intronic
1143099950 17:4499332-4499354 CAGCTTGGGCCGCGGGCGGGGGG + Exonic
1144265246 17:13562410-13562432 CACGAGGGACAGCGGGTGGGGGG + Intronic
1144703407 17:17352680-17352702 CTGGGTGGTCACGGGGCGGGGGG + Intergenic
1144756002 17:17681244-17681266 CAGGCCGGCCAGCGGGCGGGGGG + Intergenic
1144836946 17:18161499-18161521 CTGGGTGGACAGCTGGTGGGAGG + Intronic
1145056650 17:19707658-19707680 CAGGGTGGTCAGCAGGCAGAGGG - Intronic
1147544968 17:41394062-41394084 CAGGGTGTGCAGGGGGCAGGAGG + Exonic
1148210653 17:45806586-45806608 CATGGTGGTCAGCGGGCCGGTGG + Intronic
1148228963 17:45919353-45919375 CAGGGAGGAGGGCAGGCGGGGGG - Intronic
1148337563 17:46851732-46851754 CAGGCCGGGGAGCGGGCGGGGGG - Intronic
1148930042 17:51120654-51120676 CATGGTGGCAAGCGGACGGGCGG + Exonic
1150226725 17:63528427-63528449 CAGGGAGGAAAGCGAGAGGGAGG + Intronic
1150431342 17:65120224-65120246 CAGGGTGGTCAGTGGGATGGAGG + Intergenic
1150676076 17:67246222-67246244 CAGTGTGGCCGGCGGGCTGGGGG - Intergenic
1151719735 17:75848164-75848186 GAGGGTGGACAGAGGCCGGGAGG + Intronic
1151725628 17:75882116-75882138 CAGGGAGGACAGCAGGCTGTGGG - Intronic
1151749256 17:76027360-76027382 CAGGTGAGGCAGCGGGCGGGCGG + Exonic
1152018491 17:77767924-77767946 GAGGGTGGTCAGTGGGCTGGAGG - Intergenic
1152508778 17:80771413-80771435 CAGGAGGGCCAGCGGGCGGCGGG - Intronic
1152539126 17:80966121-80966143 CAGGGTGGAGCGGGGGCGGGGGG - Exonic
1152810544 17:82379866-82379888 CGGGGTCGCCAGCGGGCGGGGGG - Intergenic
1154194442 18:12255025-12255047 CAGGGGGGACAAGGGGCGGGTGG + Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155537507 18:26832488-26832510 CAGCGAGGACAGCGGTCGGCAGG - Intergenic
1155570365 18:27185426-27185448 CAGGGCGGGCAGCGGGGGCGAGG - Intergenic
1157140168 18:45097781-45097803 GTGGGTGGATTGCGGGCGGGCGG + Intergenic
1157279032 18:46333949-46333971 CAGCGGGGACCGCGGGCGCGCGG - Intronic
1157335512 18:46734403-46734425 CAGGGTGGAGAGCAGGGGTGGGG - Intronic
1157492776 18:48136072-48136094 CGGGGTGGGCGGCGGGCAGGGGG + Intronic
1157544931 18:48540359-48540381 CATGGGGGAGGGCGGGCGGGGGG + Intronic
1157582647 18:48782424-48782446 CAGGATGGGGAGCGGGTGGGGGG - Intronic
1158900407 18:61957151-61957173 CAGGGTGGACAACTGGCAGAAGG - Intergenic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1160508876 18:79442294-79442316 GAGGGTGGACAGAGGTGGGGAGG - Intronic
1160548753 18:79679928-79679950 CATCGCGGACAGAGGGCGGGCGG - Exonic
1160584205 18:79903803-79903825 CAGGGTGGGCAGTGGGGGTGGGG - Exonic
1160747637 19:719464-719486 CGGGGTGGGCGTCGGGCGGGGGG + Intronic
1160991389 19:1861744-1861766 GAGGGTGGAGAGCAGGAGGGCGG - Intronic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161257999 19:3320417-3320439 CAGAGTGGGCGGCGGCCGGGCGG - Intergenic
1161333529 19:3699413-3699435 CAGGCGGGCAAGCGGGCGGGCGG - Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1161613365 19:5256551-5256573 GAGTGTGGACAGCGGGTGTGGGG - Intronic
1161815778 19:6498999-6499021 CTGGGTGGCCAGGGGGTGGGAGG + Intronic
1161959593 19:7516290-7516312 CTGGGTGGGGGGCGGGCGGGCGG + Intronic
1161975108 19:7604273-7604295 CCAGGTGGACAGTGGGCTGGGGG - Intronic
1162018518 19:7858161-7858183 CAGCGAGGACAGGGGGCAGGGGG - Intronic
1162095622 19:8308168-8308190 CGGGGTGGAAAGCGGGCTCGCGG + Exonic
1162164931 19:8745923-8745945 AAGGATGGAAAGCGGGAGGGAGG - Intergenic
1162166002 19:8753387-8753409 AAGGATGGAAAGCGGGAGGGAGG - Intergenic
1162167068 19:8760843-8760865 AAGGATGGAAAGCGGGAGGGAGG - Intergenic
1162373015 19:10290146-10290168 CGGGGTGGACAGGGCGGGGGCGG + Intronic
1162467028 19:10848579-10848601 CAAGGTGGACAGAGGATGGGGGG - Intronic
1162526521 19:11209756-11209778 GAGGGTGGACAGTGAGGGGGTGG - Intronic
1162572392 19:11480813-11480835 CGGGGTGGCCTGCGGGCGGCAGG + Exonic
1164710541 19:30354085-30354107 CAGGGTGGAGACCGAGGGGGAGG + Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165900574 19:39167546-39167568 CAGGATGGAGGGCGGACGGGGGG - Intronic
1166125844 19:40714999-40715021 CGGGGTGGGGATCGGGCGGGGGG - Intronic
1166329593 19:42070246-42070268 CAGGGAGGAGGGCGGGCAGGAGG + Intronic
1166567886 19:43776251-43776273 CAGAGTGGACAGAGGCCTGGGGG + Intronic
1166734241 19:45075325-45075347 TAGGGAGGGCAGCGGCCGGGGGG - Intronic
1166986217 19:46661146-46661168 CAGCCCGGCCAGCGGGCGGGCGG - Intergenic
1167509294 19:49887849-49887871 CAGGGGGGACAGGGCGGGGGCGG - Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1168152180 19:54455157-54455179 CAGGGTGGGCAGCTGGCCAGTGG - Intronic
1168292487 19:55363240-55363262 CAGGGTGGACAGCAGGGGTCTGG + Exonic
1168307357 19:55442756-55442778 CAGGGCGGGCAGCGGGCCCGCGG + Exonic
925154156 2:1637388-1637410 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154165 2:1637462-1637484 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154179 2:1637536-1637558 CAGAGTGGACAGCGTGCAGCAGG - Intronic
925154187 2:1637610-1637632 CAGAGTGGACAGCGTGCGGCAGG - Intronic
925154201 2:1637684-1637706 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154217 2:1637759-1637781 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925347858 2:3183238-3183260 GTGGGTGGATGGCGGGCGGGTGG - Intergenic
927596651 2:24403208-24403230 CTGGGGGGAGGGCGGGCGGGGGG - Intergenic
929544986 2:42849840-42849862 CAGGGTGCACAGTGGAAGGGAGG - Intergenic
930730368 2:54723423-54723445 TAGGGCGGACAGCGCGCGGAAGG - Intergenic
932597134 2:73101092-73101114 GAGGGTGGACTGCAGGCAGGTGG + Intronic
932667766 2:73710723-73710745 CAGGGTGGAGAGTGGGAGGAGGG + Intergenic
933943704 2:87266461-87266483 CTGTGTGGACAGTGGGCTGGAGG + Intergenic
934681018 2:96284001-96284023 CAGGCTGGAAAGAGGGAGGGAGG + Exonic
935065148 2:99641037-99641059 CAGGGTGGACAGGGAGTGGCAGG - Intronic
935211251 2:100940923-100940945 CAGGGTAGTCAGGGGGCAGGAGG + Intronic
935310506 2:101778459-101778481 CAGGGTGGACAGCATGCAGAAGG + Intronic
935645414 2:105329903-105329925 CGGGGCGGCCAGCGGGCGGAAGG + Exonic
936152664 2:110030177-110030199 CAGGGAGGGGAGCAGGCGGGAGG + Intergenic
936192016 2:110341235-110341257 CAGGGAGGGGAGCAGGCGGGAGG - Intergenic
936336516 2:111595118-111595140 CTGTGTGGACAGTGGGCTGGAGG - Intergenic
938287528 2:130129958-130129980 CGGGGTGGGGAGCGGGAGGGAGG + Intergenic
938407482 2:131040502-131040524 CAGCGCGGACAGCGGGTGGCTGG + Intronic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
941964990 2:171292187-171292209 CTGGGTGGAGAGCTGGAGGGTGG - Intergenic
942230320 2:173855057-173855079 CAGGAGGGACAGCTGGCAGGAGG - Intergenic
944060073 2:195563163-195563185 CGGGGTGGGGAGCGGGTGGGGGG - Intergenic
945203727 2:207310213-207310235 CGGGGTGGAGGGCGGGTGGGAGG + Intergenic
947592979 2:231395718-231395740 CCGGCGGGACGGCGGGCGGGTGG - Exonic
948494316 2:238337029-238337051 CAGGGTGGAGAGGGGGCAGAGGG + Intronic
949004370 2:241637064-241637086 CGGGGCGGTCCGCGGGCGGGCGG - Exonic
1168830362 20:842175-842197 CAAGGCGCACAGCGGGCGGGTGG + Intronic
1169367170 20:5001212-5001234 CAGGGTGGCCGGCGGGCGCGGGG + Intronic
1169435328 20:5582548-5582570 AAAGGTGGAAAGCGGGTGGGCGG - Intronic
1171137822 20:22712722-22712744 AAGGGAGGAGAGGGGGCGGGGGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172763692 20:37339510-37339532 CAGGGTGGAAAGAGGGGTGGGGG - Intergenic
1173851077 20:46218735-46218757 CAGGGAGGGCAGCAGGCGTGGGG + Intronic
1174172865 20:48627975-48627997 GAGGGAGGACAGCGGGTTGGCGG + Intronic
1174573911 20:51523782-51523804 CAGGGTGAACCTCGGGCTGGCGG + Exonic
1175724813 20:61310587-61310609 CAGGCTGGACAGCAGGAAGGGGG - Intronic
1175825400 20:61933991-61934013 CAGGGTGGAAGGGGGGCTGGCGG + Intronic
1175882706 20:62270116-62270138 CAGGGTGGACGGAGGGTGGGCGG - Intronic
1176357860 21:5967278-5967300 CTGCGTGGACAGAGGGCGGAGGG + Intergenic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179750818 21:43466534-43466556 CAGGGTGGTCGGAGGGGGGGGGG - Intergenic
1179765658 21:43571273-43571295 CTGCGTGGACAGAGGGCGGAGGG - Intronic
1179903452 21:44406881-44406903 CAGGGAGGACACCGGCCAGGTGG - Intronic
1179973098 21:44847190-44847212 CATGGTGGACAGCGGCCGCACGG + Intergenic
1180159170 21:45991408-45991430 GAGGGTGGCGAGTGGGCGGGAGG + Intronic
1180159187 21:45991451-45991473 GAGGGTGGTGAGCGGGTGGGAGG + Intronic
1180469414 22:15641845-15641867 CAGGGTGGGGAGCGGGAGGGAGG - Intergenic
1180559188 22:16601849-16601871 CCGGGCGGGGAGCGGGCGGGCGG - Intergenic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181458122 22:23070850-23070872 GAGGGTGGACAGAGGGCGCCGGG + Intronic
1182222961 22:28773054-28773076 CAGGGCGCAGGGCGGGCGGGCGG + Intronic
1183299508 22:37051960-37051982 CGGGGTGGGCGGCGAGCGGGCGG + Intronic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1183368158 22:37417974-37417996 GAGGGGGGACAGCAGGAGGGAGG + Intronic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183675573 22:39297214-39297236 CAGCGTGGAGACAGGGCGGGAGG + Intergenic
1184177605 22:42797866-42797888 CAGGGAGCAAAGTGGGCGGGAGG + Intronic
1184769462 22:46589073-46589095 CAGGGACGGCAGGGGGCGGGGGG + Intronic
1184822619 22:46921230-46921252 GAGGGTGGAGAGCGGGAGGAGGG - Intronic
1185302184 22:50087658-50087680 CTGGGTGGAGAGCAGGCTGGGGG + Intergenic
1185367657 22:50444256-50444278 CAGGGTGGGCCGTGGCCGGGCGG - Exonic
949987467 3:9552466-9552488 CTGCGTGGGCAGCGGGCTGGCGG - Exonic
950151212 3:10688940-10688962 CAGGGTGGACATTGGCCAGGTGG - Intronic
950583500 3:13878190-13878212 GAGGGCGGCCCGCGGGCGGGCGG + Intronic
952378681 3:32787714-32787736 CAGGGTGGACAGCAGTCCTGAGG + Intergenic
954076908 3:48188182-48188204 CCGCGAGGCCAGCGGGCGGGCGG + Exonic
954137670 3:48589546-48589568 CAGGGTGGAATGGGGGCTGGGGG - Intronic
955265259 3:57436815-57436837 CTGGGGGGCCAGGGGGCGGGCGG + Intronic
955380395 3:58433718-58433740 CAGGGTGGGCAGGGGTCGCGTGG + Intronic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
958533632 3:95366940-95366962 CACGGGGGACAGGGGGCGGAGGG - Intergenic
959760954 3:109964286-109964308 GAGGGAGGGCAGAGGGCGGGGGG + Intergenic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961474380 3:127137567-127137589 CAGTGTGGACAGTGGGGGTGGGG - Intergenic
966886411 3:184380086-184380108 CCGGGAGGAGCGCGGGCGGGCGG - Exonic
968474315 4:795789-795811 CCGGGTGGAGAGGGGGTGGGGGG + Intronic
968514933 4:1011927-1011949 CGGGGGGCTCAGCGGGCGGGCGG - Intronic
968593978 4:1473070-1473092 CAGGGTGGGCAGGTGGGGGGTGG - Intergenic
968725834 4:2247488-2247510 CACGGTGGACAGGTGGCCGGGGG + Exonic
968922537 4:3530150-3530172 CAGGGTGGTCAGGAGGCAGGAGG - Intronic
969468897 4:7374817-7374839 CTGGGTAGACCGCGGGTGGGGGG + Intronic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
969696895 4:8740075-8740097 CAGGCTGGGCAGGGGGAGGGTGG + Intergenic
970120435 4:12747108-12747130 CAAAGTGGACAGTGGGTGGGAGG - Intergenic
973317896 4:48780316-48780338 CAGGAAGGCCAGGGGGCGGGCGG - Intronic
977651562 4:99475820-99475842 CAGGGTGGAGAGTGGGAGGAAGG - Intergenic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
981878291 4:149576294-149576316 CAGGGTGGAGAGTGGGAGGAGGG - Intergenic
983522074 4:168719721-168719743 GAGGGTGGAGAGCGGGAGGAGGG - Intronic
985218781 4:187680955-187680977 CAGGGTGAAGAGCGGCTGGGAGG - Intergenic
985520952 5:373739-373761 CCGGGTGCACACGGGGCGGGCGG - Intronic
985604537 5:851275-851297 CCGGGTGGACAGTGGCTGGGAGG + Intronic
985604746 5:852660-852682 CACGGAGGACAGCGAGCCGGGGG + Intronic
985604772 5:852755-852777 CATGGAGGACAGCGAGCCGGGGG + Intronic
985604790 5:852819-852841 CACGGAGGACAGCGAGCCGGGGG + Intronic
985605374 5:855133-855155 CATGGAGGACAGCGAGCCGGGGG + Intronic
987075679 5:14379944-14379966 GTGGGTGGCCAGCAGGCGGGAGG - Intronic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
992470114 5:77043779-77043801 CAGAGTGGGCAGCTGCCGGGCGG + Intronic
993168439 5:84384922-84384944 CAGGGCGGGCGGAGGGCGGGCGG - Intergenic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
998132523 5:139658610-139658632 AAGCGTGGGCAGCGGGCGGGCGG - Intronic
998352923 5:141512715-141512737 GCGGGTGGGCAGCGGGCGGCGGG + Exonic
999300233 5:150486214-150486236 GGGGGAGGAGAGCGGGCGGGAGG + Intronic
1000341377 5:160279652-160279674 CCAGGTGGGCAGCGGGAGGGAGG + Intronic
1002298143 5:178242480-178242502 CAGGGGGGAAAGTGGGCGTGTGG - Intronic
1002635041 5:180603125-180603147 CAGGGCGGGCAGAGGGCTGGAGG - Exonic
1003047442 6:2746877-2746899 CAGGCTTGGCAGCGGGTGGGTGG - Intronic
1003545157 6:7052352-7052374 GAGGGTGGAGAGGGGGCGGCGGG + Intergenic
1003948179 6:11094076-11094098 CGGGGTGGCCAGAGCGCGGGAGG - Exonic
1006414086 6:33893116-33893138 GCGCGTGGACAGCGGGCGTGTGG - Intergenic
1006472200 6:34235572-34235594 GGGGGTGGGGAGCGGGCGGGGGG - Intergenic
1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG + Intronic
1007637138 6:43306389-43306411 CAGGGTGGGCAGCAAGGGGGAGG - Intronic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1008614907 6:53217457-53217479 CAGGGTGGACAGCAGTGGTGTGG + Intergenic
1010273738 6:73945179-73945201 CATGGAGGACAGAGGGTGGGAGG - Intergenic
1015965385 6:138692393-138692415 CAGGGCCGCCAGGGGGCGGGCGG + Intronic
1016050771 6:139527809-139527831 CAGGGGTGACAGGGGGCAGGTGG + Intergenic
1018929579 6:168231959-168231981 CAGTGTGGATAGCAGGCGCGGGG + Intergenic
1019051579 6:169187994-169188016 CAGGGGGGACGGGGAGCGGGGGG - Intergenic
1019131766 6:169882221-169882243 CATGCTGGACAACGGGAGGGCGG + Intergenic
1019384453 7:746677-746699 CAGGGTGGGCAGGGGGTGGCAGG - Intronic
1019438474 7:1033918-1033940 CAGTGGGGACAGTGGGAGGGTGG - Intronic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1019539807 7:1546533-1546555 CAGGCTGGGCAGCTGGAGGGAGG - Exonic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1020014038 7:4820751-4820773 CAGGCTGGACTGAGGGCGCGTGG - Intronic
1021030956 7:15735205-15735227 CAGGGTGGCCAGCCTGCAGGCGG - Intergenic
1021964627 7:25905517-25905539 CAGGGTGGACAGCTGGTGCCCGG + Intergenic
1022097108 7:27147972-27147994 CCGGGCGGGCGGCGGGCGGGCGG - Intronic
1022536553 7:31102187-31102209 CGGGGTGGACAGCAGGCATGAGG - Intronic
1024634730 7:51277620-51277642 CAAGTTGGACAGCGGGCTAGAGG + Intronic
1028985474 7:97005657-97005679 AAGGGGGGAAAGCAGGCGGGGGG + Exonic
1029274290 7:99395041-99395063 CAGGATGGACAGCAGTGGGGAGG - Exonic
1029696344 7:102215925-102215947 CATGGTGGACAGCAGGCTTGGGG - Intronic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1034884998 7:154792596-154792618 CAGGATGGAGAGCAGGGGGGAGG + Intronic
1035023010 7:155809818-155809840 CAGGGCGGACGGGGGTCGGGGGG + Intronic
1035207038 7:157300503-157300525 CAGGCTGGACACGTGGCGGGCGG - Intergenic
1035938823 8:3873552-3873574 CAGGGTGGACGGTGGGAGGAGGG + Intronic
1037482008 8:19313925-19313947 CAGGGGCCAGAGCGGGCGGGCGG + Intronic
1037802419 8:22042936-22042958 GAGGTTGGGCAGCAGGCGGGCGG - Exonic
1038459636 8:27705091-27705113 CAGGGTGGAAAGTGTGAGGGAGG - Intergenic
1040517127 8:48144432-48144454 CAGGGTGAAGAGCGGAGGGGAGG + Intergenic
1040969248 8:53115600-53115622 CTGGGTGGACAGTGGGCTGGGGG - Intergenic
1041586140 8:59522083-59522105 GAGGGTGGAGAGGGGGAGGGTGG + Intergenic
1041683611 8:60620734-60620756 CAGGGAGGACAGCAGGCTGGGGG + Exonic
1042695209 8:71547804-71547826 CACGGTGGGGAGCGGGCGCGGGG + Intronic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG + Intronic
1047754403 8:127907560-127907582 CATGCTGGACAGGGAGCGGGCGG + Intergenic
1048897253 8:139003214-139003236 GAGTGTGGACAGCAGGAGGGTGG - Intergenic
1048999531 8:139815989-139816011 CAGGCTGGGGACCGGGCGGGTGG + Intronic
1049189706 8:141280219-141280241 CAGGGTGGGCAGGGGGCACGTGG - Intronic
1049204849 8:141358908-141358930 CAGGGTGGGGGGCGGGCGAGGGG + Intronic
1049359174 8:142203856-142203878 CAGGGTGGTCAGCAGGGGCGGGG + Intergenic
1049359184 8:142203880-142203902 CAGGGTGGTCAGCAGGGGCGGGG + Intergenic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1049688471 8:143948718-143948740 CAGGGCGGGCAGCTGGCGGCAGG - Intronic
1049693562 8:143973151-143973173 TGGGGTGGGCCGCGGGCGGGTGG - Intronic
1049726190 8:144147590-144147612 CGGGGCAGACAGAGGGCGGGCGG + Intergenic
1049847131 8:144808295-144808317 GAGGGTGGACAGCCGGCTGCAGG - Exonic
1050070780 9:1811068-1811090 GAGGGTGGAGAGCGGGAGGAGGG + Intergenic
1051170226 9:14313969-14313991 CAGGAGGGCGAGCGGGCGGGCGG + Intronic
1052824995 9:33167716-33167738 CGGAGAGGACAGCTGGCGGGTGG + Intergenic
1052852549 9:33386843-33386865 CAGCCTGGCCACCGGGCGGGAGG - Intronic
1053055773 9:34992293-34992315 CAGGGTGGACTGGGGGCGTAGGG + Intronic
1053291377 9:36881796-36881818 CAGGGAGGACACCGGGGGCGAGG - Intronic
1053680648 9:40483394-40483416 CAGCCTGGCCACCGGGCGGGAGG - Intergenic
1053930635 9:43111706-43111728 CAGCCTGGCCACCGGGCGGGAGG - Intergenic
1054293730 9:63318909-63318931 CAGCCTGGCCACCGGGCGGGAGG - Intergenic
1054391754 9:64623398-64623420 CAGCCTGGCCACCGGGCGGGAGG - Intergenic
1054503973 9:65892930-65892952 CAGCCTGGCCACCGGGCGGGAGG + Intronic
1056587830 9:87939871-87939893 CAGGGTGGGGAGCGGGAGGGAGG + Intergenic
1056609037 9:88113074-88113096 CAGGGTGGGGAGCGGGAGGGAGG - Intergenic
1056992287 9:91423572-91423594 CAGGGCGCGCTGCGGGCGGGCGG - Intronic
1057305150 9:93907948-93907970 GAGGGTGAACAGCTGGCTGGAGG - Intergenic
1058612909 9:106794209-106794231 CAGGGGGGATCGGGGGCGGGGGG + Intergenic
1060147903 9:121268104-121268126 CGGGGTGGGCAGGGCGCGGGCGG - Intronic
1060149601 9:121279793-121279815 CAGAGTTGACAGAGTGCGGGAGG + Intronic
1060954565 9:127629375-127629397 CTGTGTGGAGAGTGGGCGGGAGG + Intronic
1061359575 9:130132421-130132443 CAGGGTGGACACAGGACGGCAGG - Intronic
1061506255 9:131033498-131033520 CTGGGTGGAGGGCAGGCGGGTGG + Intronic
1061619282 9:131800930-131800952 CAGGGTGCACAGCAGGCAGTGGG - Intergenic
1061970233 9:134040985-134041007 CAAGGAAGACAGAGGGCGGGTGG + Intronic
1062022733 9:134326859-134326881 GGGGCTGGGCAGCGGGCGGGCGG + Intronic
1062215301 9:135385894-135385916 CAGGGTGGGCACGGGGAGGGTGG - Intergenic
1062270763 9:135707325-135707347 TAGGGTGGACAGCCTGAGGGTGG - Intronic
1062343416 9:136103836-136103858 CAGGGTGGACAGGTGGAGTGTGG - Intergenic
1062389283 9:136327625-136327647 CAGGGCGGGCAGGGGGCGGACGG + Exonic
1062472579 9:136712850-136712872 CGGGGTGGGCAGCGGGGAGGGGG + Intronic
1062526252 9:136979130-136979152 CAGGTGGGACAGCGGGCAGGTGG + Exonic
1062580709 9:137228095-137228117 GGGGGTGGGCAGGGGGCGGGGGG + Intronic
1062599440 9:137313335-137313357 CAGGGTGGCCGGCAGGCAGGAGG - Intronic
1062615925 9:137395639-137395661 CAGGGAGGGCAGGGGGTGGGAGG + Intronic
1062633699 9:137478815-137478837 CAGGGCGGCCATCGGGCTGGGGG - Intronic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1187380612 X:18798556-18798578 AAGGGTGGACAGGGAGCAGGAGG + Intronic
1191630976 X:63321839-63321861 GAGGGTGGACGGCGGGAGGAGGG + Intergenic
1193947611 X:87757401-87757423 GAGGGTGGAGAGCGGGAGGAGGG - Intergenic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1196706831 X:118724275-118724297 CATGGGGGACAGTGGGTGGGTGG + Intergenic
1197445973 X:126552606-126552628 CATGGTGGGCGGCGGGCGAGCGG + Exonic
1197774617 X:130110984-130111006 CGGGAGGGACTGCGGGCGGGCGG + Intergenic
1199531170 X:148849377-148849399 AGGGGTGGTCAGCGGGGGGGGGG - Intronic