ID: 1106308965

View in Genome Browser
Species Human (GRCh38)
Location 13:28535894-28535916
Sequence CTGGAGGACCAGCAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 894
Summary {0: 1, 1: 1, 2: 23, 3: 155, 4: 714}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106308962_1106308965 2 Left 1106308962 13:28535869-28535891 CCTCTCTGCTTAGAGCAGCAGAT 0: 1
1: 5
2: 34
3: 139
4: 425
Right 1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG 0: 1
1: 1
2: 23
3: 155
4: 714
1106308959_1106308965 17 Left 1106308959 13:28535854-28535876 CCTTTTCCAGGACCTCCTCTCTG 0: 1
1: 8
2: 81
3: 197
4: 744
Right 1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG 0: 1
1: 1
2: 23
3: 155
4: 714
1106308961_1106308965 5 Left 1106308961 13:28535866-28535888 CCTCCTCTCTGCTTAGAGCAGCA 0: 1
1: 13
2: 99
3: 175
4: 443
Right 1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG 0: 1
1: 1
2: 23
3: 155
4: 714
1106308960_1106308965 11 Left 1106308960 13:28535860-28535882 CCAGGACCTCCTCTCTGCTTAGA 0: 1
1: 9
2: 149
3: 392
4: 542
Right 1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG 0: 1
1: 1
2: 23
3: 155
4: 714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106308965 Original CRISPR CTGGAGGACCAGCAGCAGAG AGG Intergenic
900184164 1:1325169-1325191 CTGGGGGGCCAGCAGGAGACGGG - Intronic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
900482404 1:2905539-2905561 CTGGAGGGGAAGCAGCAGAAGGG - Intergenic
900792535 1:4689840-4689862 GCGGATGCCCAGCAGCAGAGGGG + Intronic
901269390 1:7939944-7939966 GTTGAGGACCAGCAACAGAGTGG + Exonic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901919788 1:12527907-12527929 CTGGAGGGCCTGGAGCAGAGGGG - Intergenic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
901957714 1:12798323-12798345 CAGGAAGACCAGTGGCAGAGAGG + Intergenic
902225998 1:14996794-14996816 CTGGAGCACCAGGAGCGGGGAGG - Intronic
902412481 1:16219515-16219537 CCAGAGGACCAGGAGCAGTGGGG - Intergenic
902472163 1:16656731-16656753 CTGGAGGAGGAGCAGCAGGGAGG - Intergenic
902486640 1:16750715-16750737 CTGGAGGAGGAGCAGCAGGGAGG + Intronic
902640735 1:17764641-17764663 CTGGAGGATCATCAACAGCGTGG - Intronic
902933173 1:19745501-19745523 CAGGAGGACCAGAAGTGGAGGGG - Intronic
903003663 1:20284154-20284176 CTCGAGGACCAGCTACAGACAGG + Intergenic
903101774 1:21035970-21035992 CAGGATGACCAGCTGTAGAGAGG + Intronic
903337492 1:22634905-22634927 TTGGATGACCAGCTGCCGAGAGG - Intergenic
903779790 1:25813979-25814001 CTGGAGGAACTGCAGGTGAGCGG + Exonic
903855698 1:26336606-26336628 CTGTAGGACCGGCTGCAGCGAGG + Exonic
904344780 1:29860653-29860675 TTGGAGAAGAAGCAGCAGAGGGG + Intergenic
904358825 1:29959488-29959510 AAGGAGGACCAGCAGCAGGCAGG + Intergenic
904365709 1:30009905-30009927 TGGGATGACCAGCTGCAGAGGGG - Intergenic
904403938 1:30274291-30274313 TGGGAGAACCAGCTGCAGAGGGG - Intergenic
904577391 1:31513900-31513922 TGGGATGACTAGCAGCAGAGAGG - Intergenic
905001350 1:34672151-34672173 AAGGATGACCAGCTGCAGAGAGG + Intergenic
905276467 1:36821726-36821748 CTGGAGGACCAGGGGCTGTGTGG + Intronic
905811843 1:40918848-40918870 CTAGAGGAGCAGCAGCAGCTTGG - Intergenic
906537335 1:46558784-46558806 CTGCAGGAACAGCAGCACAATGG - Exonic
906544855 1:46613688-46613710 CTGCAGGCCCACCAGCAGACAGG + Intronic
907152984 1:52306256-52306278 CGGGATGACCAGCTGCAGAGAGG + Intronic
907252947 1:53155164-53155186 CTGGATGATCAGCTGCAGAGAGG + Intergenic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
907803331 1:57793507-57793529 CCTCAGTACCAGCAGCAGAGAGG - Intronic
908259296 1:62327311-62327333 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
909238269 1:73180585-73180607 CAGAACGACCAGCAGTAGAGAGG - Intergenic
910177309 1:84443958-84443980 CTAGCAGACCTGCAGCAGAGGGG + Intergenic
910231204 1:84988903-84988925 CTGGGGGAACAGCAGTAGGGTGG - Intronic
910654915 1:89609776-89609798 TGGGATGACCAGCTGCAGAGAGG - Intergenic
910873566 1:91856623-91856645 GTGGAGGTCTGGCAGCAGAGGGG - Intronic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
911025053 1:93427149-93427171 TGGGACGACCAGCTGCAGAGAGG + Intergenic
911232628 1:95377068-95377090 GTGCAGGCACAGCAGCAGAGAGG + Intergenic
911275582 1:95853909-95853931 TGGGATGACCAGCTGCAGAGAGG + Intergenic
911540054 1:99146864-99146886 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
912713509 1:111966076-111966098 CTGGGGAGCCAGCAGCAGGGTGG - Intronic
912740180 1:112187204-112187226 CTTGAAGACCAACTGCAGAGAGG + Intergenic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
913345879 1:117810713-117810735 CAGGAGGGAGAGCAGCAGAGAGG - Intergenic
914846483 1:151286587-151286609 CTGGAGGCTCAGCAGGAGACGGG + Exonic
915138962 1:153754397-153754419 CTGGAAGACCAGCAGAAGACAGG + Intronic
915185065 1:154098530-154098552 TGGGATGACCAGCAGCAGAGAGG - Intronic
915191870 1:154157604-154157626 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
915358259 1:155269436-155269458 CTAGAGGGCCTGCAGAAGAGTGG + Intronic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915654389 1:157347523-157347545 CCAGTGGACCTGCAGCAGAGGGG - Intergenic
915864764 1:159487142-159487164 CTGGAGGACCAGCATTCAAGGGG - Intergenic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916648807 1:166816438-166816460 CAAGATGACCAGCTGCAGAGAGG - Intergenic
916850278 1:168696228-168696250 CTGGAGCACCAGCTGCAGCCTGG - Exonic
917468653 1:175307283-175307305 ATGGAGAAACTGCAGCAGAGAGG + Intergenic
917959619 1:180131994-180132016 TTGGGGGACCAGCAGCAAAGTGG + Intergenic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
919523571 1:198619807-198619829 CAGGAGTACCAGAAACAGAGAGG + Intergenic
919834183 1:201562491-201562513 CAGGAGGCCCAGCTGCTGAGGGG - Intergenic
920857597 1:209675627-209675649 CAGGAGGAGCAGCAGGAGAGGGG - Intronic
921009694 1:211129014-211129036 CTGGAGAACCATCAGGAGGGAGG + Intronic
921097831 1:211902049-211902071 CAGGATGATCAGCTGCAGAGAGG + Intergenic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
921872026 1:220151708-220151730 CGTGAGCACCAGCAGCTGAGAGG + Exonic
922041650 1:221903671-221903693 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG + Intergenic
923235986 1:232033476-232033498 TGGGAGGACCTGGAGCAGAGGGG - Intronic
923450356 1:234111621-234111643 CTGAAGAGCCAGCAGCACAGTGG + Intronic
923755311 1:236786043-236786065 CAGGACAACCAGCTGCAGAGGGG + Intergenic
923980076 1:239311628-239311650 CTGCACTACCAGCAGCTGAGGGG + Intergenic
924208616 1:241742237-241742259 CTGGAGGAAATGCAGCAGAAAGG - Intronic
924650014 1:245917478-245917500 CTGGTGGAGCAGCAGCAATGAGG - Intronic
924679946 1:246220998-246221020 TGGGACGACCAGCTGCAGAGAGG + Intronic
924779489 1:247133315-247133337 CTGGAGTACCAGCAGGAGACAGG + Intronic
1063231571 10:4070767-4070789 CTGGAGGACCAACAGCTGCATGG + Intergenic
1064312090 10:14220697-14220719 ATAGAGGACCAGCAGAGGAGGGG + Intronic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065747221 10:28853518-28853540 CTTCAGGACCAGAAGCAGGGTGG + Intronic
1066715125 10:38278228-38278250 CTCCAGGTCCAGAAGCAGAGGGG + Intergenic
1067346082 10:45440094-45440116 CCGAAGGCCCAGCAGCGGAGGGG - Intronic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1067805100 10:49386674-49386696 CTGGAGGCCCAGCAGAGGTGAGG - Exonic
1068060575 10:52063806-52063828 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068060585 10:52063874-52063896 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068083614 10:52347846-52347868 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1068279858 10:54854599-54854621 CAGGATGATCAGCTGCAGAGAGG - Intronic
1068986872 10:63115644-63115666 CTGGTGCACCAGAAGCTGAGTGG + Intergenic
1069807391 10:71134445-71134467 CTGAAGGACCCACAGCAGGGAGG + Intergenic
1070684630 10:78471640-78471662 CTGGGGTCCCAGGAGCAGAGGGG - Intergenic
1070735838 10:78863139-78863161 CTGGAGGCCTAGCGGGAGAGGGG - Intergenic
1070808414 10:79284784-79284806 AGGGAGGCCCAGCAGGAGAGAGG - Intronic
1070859327 10:79638163-79638185 TGGGACGACCAGCTGCAGAGAGG - Intergenic
1071107284 10:82112970-82112992 CAGGAAGACCAGGAGCAGTGTGG - Intronic
1071306097 10:84299971-84299993 TTGGAGGACCAGCAGCAGCCAGG + Intergenic
1071957112 10:90771082-90771104 CGGGATGACCAGCTGCAGACAGG + Intronic
1072617128 10:97057282-97057304 CTGGAGAAAAGGCAGCAGAGAGG + Intronic
1072622607 10:97090051-97090073 CTGGATGAACAGCAGCGGCGAGG - Intronic
1072753338 10:97999825-97999847 CAGGACGACCAGCTGCAAAGAGG + Intronic
1072872402 10:99133625-99133647 CCAGCAGACCAGCAGCAGAGGGG + Intronic
1073818847 10:107237056-107237078 CTGAGGGACCAGCAGGAAAGGGG + Intergenic
1074247910 10:111713477-111713499 CAGGATGACCAGCTCCAGAGAGG - Intergenic
1074481611 10:113826931-113826953 CTGGAGGTGCAACAGCAGAGGGG - Intergenic
1074710329 10:116172153-116172175 CTGGAGGACGAGCAGGAGCCAGG + Intronic
1074985062 10:118651527-118651549 CCGGCAGACCTGCAGCAGAGGGG - Intergenic
1074991512 10:118712684-118712706 TGGGACGACCAGCTGCAGAGAGG - Intronic
1075002472 10:118808710-118808732 GAGGAGGAGGAGCAGCAGAGGGG - Intergenic
1075007837 10:118843066-118843088 TGGGAAGACCAGCTGCAGAGAGG + Intergenic
1075600595 10:123765793-123765815 CTGGAGGAGGAGCAGCAGGGTGG - Intronic
1075746938 10:124734619-124734641 CTCTAGGGCCAGCACCAGAGGGG + Intronic
1075941708 10:126395688-126395710 CTGGGGGACTTGCAGCAGTGGGG - Intergenic
1076372957 10:129966865-129966887 GGGCAGGAGCAGCAGCAGAGGGG + Intergenic
1076526709 10:131116735-131116757 CCGGGGGAACAGCAGCTGAGTGG - Intronic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1076750471 10:132539591-132539613 CAGGAGTACCAACAGCAGGGTGG - Intronic
1077012835 11:386427-386449 CGGGATGACCAGCTGCAGAAAGG + Intergenic
1077112264 11:867008-867030 CTGGAGCACCAGGACCAGTGGGG - Exonic
1077177956 11:1199090-1199112 TTCGAGTACCAGGAGCAGAGCGG + Intronic
1077198417 11:1293139-1293161 CTGGAGCACCAGCAGCACGAGGG + Intronic
1078042738 11:7883786-7883808 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1078042758 11:7883963-7883985 CTGGATGATCAGCCGCAGAGAGG - Intergenic
1078315127 11:10288486-10288508 TGGGATGACCAGCTGCAGAGAGG - Intronic
1078315134 11:10288542-10288564 CAGGACAACCAGCTGCAGAGAGG - Intronic
1078836394 11:15034861-15034883 ACGAAGGACCAGCTGCAGAGAGG - Intronic
1078860370 11:15240937-15240959 CTGGAAGAGCACCAGCAGATGGG - Intronic
1079103505 11:17556328-17556350 TTGGAGGACCACCAGAGGAGTGG + Intronic
1079243218 11:18735347-18735369 TTGGGGGACCTGCAGCAGAGAGG + Intronic
1079244543 11:18743022-18743044 CAGAAAGACCAGCAGCAGACTGG + Exonic
1079361015 11:19770403-19770425 AGGGAGGACCAGCAGCACGGAGG + Intronic
1079472288 11:20789956-20789978 CAGAAGGACCAGCTGCAGAGAGG - Intronic
1079481987 11:20890884-20890906 CTGGAGTACCAGAAGGAGACAGG + Intronic
1079733270 11:23962348-23962370 CGGGACCACCAGCTGCAGAGAGG + Intergenic
1079882296 11:25943673-25943695 ATGGAAGACCAGCTGCAGAGAGG - Intergenic
1080583954 11:33665489-33665511 TGGGACAACCAGCAGCAGAGAGG - Intronic
1080787333 11:35487477-35487499 CTGGAAGTGCAGCAGCAGAAGGG - Intronic
1080943205 11:36942646-36942668 CTGGAGCAGCAACATCAGAGAGG + Intergenic
1081163931 11:39785805-39785827 CAGGATCACCAGCTGCAGAGAGG - Intergenic
1081756908 11:45551287-45551309 CAGGAGGACCTGCAGGAGATGGG - Intergenic
1081979929 11:47259888-47259910 CTGCAGTACCCCCAGCAGAGTGG - Exonic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1083484957 11:62977388-62977410 CTGCAGGGCCCGCAGCAGATGGG + Intronic
1083622528 11:64056218-64056240 CTGGAGGAGCTGCAGCAGGTGGG + Intronic
1083971610 11:66080261-66080283 CTGGAGAAGCAGCAGCAGACAGG + Intronic
1084001389 11:66296953-66296975 CGGCATGCCCAGCAGCAGAGTGG - Intergenic
1084375384 11:68773280-68773302 CTGGAGGGCCAGCTGCACAAAGG + Exonic
1084729402 11:71063923-71063945 CTGGGGGTCCAGCAGCTGATGGG - Intronic
1085020045 11:73200873-73200895 CTGGAGGAAAAGGAGGAGAGAGG - Intergenic
1085783356 11:79429399-79429421 CCAGCGGACCAGCAGCTGAGAGG + Intronic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1086410824 11:86542039-86542061 CTAGCAGACCTGCAGCAGAGGGG + Intronic
1087239078 11:95755391-95755413 CTGGAGACCCAAAAGCAGAGTGG + Intergenic
1088135691 11:106552887-106552909 CAGGATGACCAGCTGCGGAGAGG + Intergenic
1088211840 11:107465790-107465812 CTAGCAGACCTGCAGCAGAGGGG - Intergenic
1088574415 11:111256520-111256542 GTGGAGGAACACCAGTAGAGAGG + Intronic
1088704230 11:112447575-112447597 CAGGAAGAGCAGTAGCAGAGTGG - Intergenic
1089344404 11:117781590-117781612 AATGAGGACCAGCAGAAGAGTGG + Intronic
1089546513 11:119231075-119231097 CTTGAGGAACAGGAACAGAGAGG - Intronic
1089615949 11:119694857-119694879 CTGAAGGAGCAGCTGGAGAGAGG - Intronic
1090124859 11:124075276-124075298 TGGGAGGACCCGCAGCAGAGAGG - Intergenic
1090124873 11:124075399-124075421 CAGGATGATCAGCAGCAGAGAGG - Intergenic
1090136982 11:124209397-124209419 CTGGGTGACCACCTGCAGAGAGG - Intergenic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090887897 11:130895310-130895332 CTGGGGGACCAGAAGCAAAATGG - Intronic
1091450779 12:570779-570801 CTCGAGGATCAGCAGAAAAGGGG - Intronic
1092074150 12:5659393-5659415 CTGGAGGCTCAGCTCCAGAGAGG - Intronic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1092447070 12:8567850-8567872 CTGGACAACCAGCTGCAAAGAGG - Intergenic
1092501432 12:9051264-9051286 CGGGATTACCAGCTGCAGAGAGG + Intergenic
1092501450 12:9051393-9051415 TGGGAAGACCAGCTGCAGAGAGG + Intergenic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1093108005 12:15112439-15112461 TTGGTGGATCAACAGCAGAGTGG + Intronic
1093483494 12:19628738-19628760 TGTGAGGACCAGCAGCAGAGGGG - Intronic
1093902715 12:24654308-24654330 CTAGCAGACCTGCAGCAGAGAGG - Intergenic
1094144506 12:27214421-27214443 CAGGAGGACTAGCTGCAGAGAGG + Intergenic
1094388080 12:29917181-29917203 CTGCAGAACCAGAAGAAGAGTGG - Intergenic
1095603220 12:44037807-44037829 CAGGACTACCAGCTGCAGAGAGG + Intronic
1095603236 12:44037908-44037930 TGGGAGTACCAGCTGCAGAGAGG + Intronic
1095826131 12:46531615-46531637 CAGGATGACCATCTGCAGAGAGG + Intergenic
1096602150 12:52736967-52736989 CAGGACGACGAGCTGCAGAGAGG - Intergenic
1096602157 12:52737021-52737043 AAGGAGGACCAGCTGCAGAGAGG - Intergenic
1096602901 12:52742712-52742734 AGGGAGGACCAGCTGCAGAGAGG + Intergenic
1096602907 12:52742766-52742788 CAGGACGACGAGCTGCAGAGAGG + Intergenic
1096941954 12:55356114-55356136 CTAGCAGACCTGCAGCAGAGGGG + Intergenic
1096944667 12:55391869-55391891 CTAGAGGACCAGCTGAAGAGAGG - Intergenic
1096983710 12:55743330-55743352 CAGGAAGCCCAGCAGCAGCGGGG - Exonic
1097130857 12:56809953-56809975 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1097140660 12:56900172-56900194 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1097298971 12:57998031-57998053 CAGGAGGACCAGCTTCAGAGTGG - Intergenic
1097410223 12:59243334-59243356 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1097749118 12:63332129-63332151 CTGGAGTACCAGAAGGAGACAGG + Intergenic
1098053039 12:66473717-66473739 CTAGCAGACCTGCAGCAGAGGGG + Intronic
1098465591 12:70783302-70783324 CTGCACAACCAGTAGCAGAGAGG - Intronic
1098522518 12:71449554-71449576 CTGGAAGGCCAGCAGCTGGGAGG - Intronic
1099071261 12:78048471-78048493 CCAGAAGACCTGCAGCAGAGGGG - Intronic
1099489982 12:83276487-83276509 CTAGTAGACCTGCAGCAGAGAGG - Intergenic
1099892328 12:88605214-88605236 CCAGCAGACCAGCAGCAGAGGGG + Intergenic
1099982132 12:89616877-89616899 CAGGAGAACCAGAACCAGAGTGG - Exonic
1100089494 12:90953682-90953704 CTGGAGGAGAACGAGCAGAGAGG - Exonic
1100847940 12:98679276-98679298 CAGGAGGACCAGCTGCAGAGAGG + Intronic
1101824604 12:108210326-108210348 CTGAGGGAGGAGCAGCAGAGAGG - Intronic
1102060451 12:109926990-109927012 CGGGACAACCAGCTGCAGAGAGG + Intronic
1102220477 12:111191025-111191047 CTTGAGGACAAACAGTAGAGGGG + Intronic
1102269126 12:111516193-111516215 CTGGAGAACCATGAGCAGAGGGG + Exonic
1102418711 12:112787091-112787113 CTGGAGGGCCAGAGTCAGAGAGG - Intronic
1102719475 12:115003703-115003725 GTGGAGGCCCAGGAGGAGAGTGG - Intergenic
1103920107 12:124394975-124394997 CTGGAGGATGAGCAGCAGAGGGG - Intronic
1104267703 12:127251929-127251951 CTGAAGGACAATAAGCAGAGAGG - Intergenic
1104709401 12:130974859-130974881 CAGGCAGACAAGCAGCAGAGAGG - Intronic
1104805573 12:131587177-131587199 AAGGACGACCAGCTGCAGAGAGG + Intergenic
1105048582 12:133027802-133027824 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1105737276 13:23284862-23284884 CTAGCAGACCTGCAGCAGAGGGG - Intronic
1106308945 13:28535723-28535745 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1106391055 13:29336395-29336417 CTAGTGGACCTGCAGCAGAGGGG - Intronic
1106489926 13:30211768-30211790 CTGGAAGAGCAACAGCAAAGTGG + Intronic
1107147077 13:37070500-37070522 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1107147087 13:37070552-37070574 TGGGAGGAACAGCTGCAGAGAGG + Intergenic
1107551372 13:41479559-41479581 CCAGCAGACCAGCAGCAGAGGGG - Intergenic
1107853482 13:44592297-44592319 CAGGAGGACCAGCTGCAAAGAGG + Intergenic
1107875796 13:44789751-44789773 CAGGATGAGCAGCTGCAGAGAGG - Intergenic
1108016982 13:46086478-46086500 GGGGAGGACCAGCTGTAGAGAGG - Intronic
1108160568 13:47633848-47633870 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1108240295 13:48457302-48457324 CAGGACGAGCAGCTGCAGAGAGG - Intronic
1108407100 13:50115468-50115490 CAGGAGTACCAGCAGCAGATGGG + Intronic
1109470538 13:62799021-62799043 CTTGGGGACCAGGAGCAGGGAGG + Intergenic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1109525274 13:63566709-63566731 CCAGACGACCAGCTGCAGAGAGG + Intergenic
1109562819 13:64075686-64075708 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1109891271 13:68617538-68617560 CTAGCAGACCTGCAGCAGAGGGG + Intergenic
1109939765 13:69346228-69346250 CTGGAATAACAGCAGTAGAGAGG + Intergenic
1109945005 13:69421143-69421165 CTGCAGGGCCAGCAGGAGACAGG - Intergenic
1110624494 13:77637632-77637654 GGGGATCACCAGCAGCAGAGGGG - Intronic
1111333569 13:86792396-86792418 CTGGGCGAGCAGCTGCAGAGGGG + Intergenic
1112674953 13:101690543-101690565 CTGTAGTACCATCAGCAGTGTGG - Intronic
1113550404 13:111188517-111188539 CCAGAGGATCAGCAGCCGAGAGG + Intronic
1113600093 13:111562495-111562517 CTTGAGGACCATGGGCAGAGGGG - Intergenic
1113885388 13:113656179-113656201 CTGCAGGGCCAGCACCAGGGAGG - Intronic
1113970723 13:114186190-114186212 CAGGATGACCAGCTACAGAGGGG + Intergenic
1114043584 14:18702283-18702305 CTGGAGGACCTGGATGAGAGCGG - Intergenic
1114047867 14:18892725-18892747 CTGGAGGACCTGAACGAGAGCGG - Intergenic
1114114652 14:19508918-19508940 CTGGAGGACCTGGACGAGAGCGG + Intergenic
1114116349 14:19626681-19626703 CTGGAGGACCTGGACGAGAGCGG + Intergenic
1114281074 14:21192751-21192773 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1114349557 14:21835516-21835538 CAGGATGACCAGCAGCAGAAAGG - Intergenic
1114354700 14:21894520-21894542 CTGGAGGGCCCTGAGCAGAGCGG - Intergenic
1114870017 14:26645058-26645080 CTAGCAGACCTGCAGCAGAGGGG - Intergenic
1115485027 14:33901937-33901959 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1116075739 14:40108487-40108509 CTGCAGGATAAGCAGCAGAGAGG - Intergenic
1116186344 14:41605502-41605524 CCGGAGTACCAGGGGCAGAGAGG + Intergenic
1116257247 14:42571514-42571536 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1116868489 14:50050372-50050394 CTGGAGGACGAGCTGCTGGGTGG - Intergenic
1118498553 14:66333631-66333653 CCAGCAGACCAGCAGCAGAGGGG + Intergenic
1119274313 14:73339851-73339873 CTGGAGGGCAGGCAGAAGAGTGG + Intronic
1119342730 14:73894243-73894265 TTGGATGAACATCAGCAGAGTGG + Intronic
1119387405 14:74266227-74266249 CTGGAGGGCCAGCAGGAGGCTGG - Intergenic
1119400258 14:74358148-74358170 GGGGAGTCCCAGCAGCAGAGAGG - Exonic
1119485061 14:74981598-74981620 CTGGAGGGCCACGTGCAGAGGGG - Intergenic
1119718322 14:76874339-76874361 CTGGAGGACCAGCAGAGCACAGG + Intergenic
1120405744 14:84091464-84091486 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1120745529 14:88147631-88147653 GAGGAGGACCAGCTGCAGAGAGG + Intergenic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121325637 14:93018134-93018156 CTGGAGGCACAGCAGAAGATGGG + Intronic
1121625619 14:95383718-95383740 TTGGAGGACAAGCTGGAGAGGGG - Intergenic
1121695321 14:95907866-95907888 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1121974083 14:98386043-98386065 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1122366282 14:101196811-101196833 CTGGAAGGCTGGCAGCAGAGGGG - Intergenic
1122627770 14:103092912-103092934 CTGCAGCACCATCTGCAGAGGGG - Intergenic
1122796101 14:104207026-104207048 CTGGTGGACCCTCAGAAGAGGGG + Intergenic
1123216585 14:106813789-106813811 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1123216596 14:106813845-106813867 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1124019320 15:25904868-25904890 CTGGAAGCTCAGCAGCTGAGTGG - Intergenic
1124179028 15:27456086-27456108 CTGCAGGACCAGAAGCAGTGCGG - Intronic
1124247671 15:28084880-28084902 CTGGAGAGCGAGCAGCAGTGAGG + Intronic
1124632191 15:31344299-31344321 CTGGAGGAGTGTCAGCAGAGTGG + Intronic
1124820893 15:33044635-33044657 GAGGATGACCAGCTGCAGAGAGG + Intronic
1125158246 15:36614213-36614235 AGGGAGGAGCAGCAGCAGGGTGG - Intronic
1125381562 15:39092258-39092280 CGGGAGGACCAGCTGCAGAGAGG - Intergenic
1125436081 15:39646169-39646191 TGGGAAGACCAGCTGCAGAGAGG + Intronic
1125752398 15:42037370-42037392 CAGGATGACCAGCTGCTGAGAGG + Intronic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1126720179 15:51569715-51569737 CTAGCAGACCTGCAGCAGAGGGG + Intronic
1127525891 15:59791886-59791908 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1127918724 15:63476524-63476546 CTGGAAGACCAGGAGCAGGGAGG + Intergenic
1128331013 15:66755746-66755768 CTGGAGTACCAGCAGAGCAGTGG - Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128552887 15:68609606-68609628 CTGGGAGACCAGCAGCAAAGAGG - Intronic
1128655144 15:69455265-69455287 CTGGAGCAGCAGCAGTGGAGGGG - Exonic
1128719751 15:69939760-69939782 TTGGGGCAGCAGCAGCAGAGAGG + Intergenic
1129126192 15:73443226-73443248 CCGGAGGAGAAGCGGCAGAGTGG + Exonic
1129172319 15:73815792-73815814 CTGGAGGAGCAGGGGCAGAAAGG - Intergenic
1129377704 15:75144677-75144699 CATGATGACCAGCTGCAGAGAGG - Intergenic
1129507853 15:76098334-76098356 CTAGCAGACCAGCAGCAGAGGGG - Intronic
1129800007 15:78406372-78406394 CTGGACTACCAGCTGGAGAGAGG + Intergenic
1130004817 15:80085063-80085085 CTTGAGGACCAGGAGGAAAGTGG - Intronic
1130028966 15:80295012-80295034 TAGGATGACCAGCTGCAGAGAGG - Intergenic
1130554902 15:84915757-84915779 CTGGAGGACGGCCAGAAGAGAGG - Intronic
1131509257 15:93040424-93040446 CTAGAGCAGCAGCAGCAAAGGGG - Intronic
1131540032 15:93268161-93268183 CTGGAGGATGAGCAGGAGTGAGG + Intergenic
1131764937 15:95665519-95665541 CTGGCAGACCAGCAGCACACTGG - Intergenic
1132543019 16:520170-520192 CTGGAGGCCGAGCAGCGGCGGGG + Exonic
1132849592 16:2019076-2019098 TTGGGGGACCATCACCAGAGAGG + Intronic
1132936246 16:2482809-2482831 GTGGAGGAGCAGCCGCGGAGAGG + Intronic
1133638519 16:7694576-7694598 TTGCAGGACCATCAGCAAAGAGG - Intronic
1135284636 16:21182801-21182823 ATGGAGGCCCAAGAGCAGAGAGG + Intergenic
1135976814 16:27113817-27113839 CTTTGGGACCAGCAGCAGTGGGG - Intergenic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872821 16:33824290-33824312 CAGGAAGACCAGCTGCAGGGAGG - Intergenic
1137238221 16:46633158-46633180 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1137256424 16:46778624-46778646 CAGGATGATCAGCTGCAGAGAGG + Intronic
1137334297 16:47533188-47533210 CGGGATGACTAGCTGCAGAGAGG - Intronic
1137698406 16:50478359-50478381 CTGGACGACCAGCTGCAGAGAGG - Intergenic
1137938221 16:52656063-52656085 AGGGAGGAGCAGCAGCAGGGTGG - Intergenic
1138394845 16:56695888-56695910 CAGGACAACCAGTAGCAGAGAGG + Intronic
1139314538 16:66057009-66057031 CTGGAGGTCCAAGATCAGAGTGG - Intergenic
1139360781 16:66398445-66398467 CTGCAGGACCAGCTGGAGTGTGG - Exonic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139991839 16:70945937-70945959 TTGGAGGAACAGCAGAGGAGGGG + Intronic
1140344639 16:74201102-74201124 CTGCAGGACCAGGAGCCGAAGGG - Intergenic
1141906210 16:87028664-87028686 CTGGAGGACAAATAGCAGCGAGG - Intergenic
1142246084 16:88970691-88970713 CTGAAGGACCAGGAGCACGGAGG + Intronic
1203099350 16_KI270728v1_random:1291764-1291786 CAGGAAGACCAGCTGCAGGGAGG + Intergenic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099374 16_KI270728v1_random:1291932-1291954 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1143029463 17:3959819-3959841 CTGCAGGCCCCGCTGCAGAGCGG - Intronic
1144060899 17:11582873-11582895 CAGGATGACCAGCTACAGAGAGG - Intergenic
1144073361 17:11694453-11694475 CTGGAGGAGCATCTGCAGAAAGG + Intronic
1144531654 17:16044861-16044883 CTGGAGCAGCAGCAGTGGAGTGG - Intronic
1144570006 17:16391597-16391619 CTGCAGGTCCTGCAGAAGAGCGG - Intergenic
1144872866 17:18381397-18381419 CTGCAGCACCAGCAGGAGACGGG + Exonic
1146006667 17:29164822-29164844 CAGGAGGCACAGGAGCAGAGAGG - Intronic
1146399945 17:32494394-32494416 CTGCAGGGTCAGCAGCAGGGAGG + Exonic
1146459475 17:33033934-33033956 CAGGACGACCAGCTGCAGAGAGG + Intronic
1146559660 17:33857183-33857205 CTGGTTGACCAGCAGCAGAAAGG - Intronic
1146718109 17:35103328-35103350 CAGGAGGAGGAGAAGCAGAGAGG + Intronic
1146761540 17:35483028-35483050 CAGGACAACCAGCCGCAGAGTGG + Intronic
1146964182 17:37010848-37010870 CTGGTGGGCCTGCAGCACAGAGG + Intronic
1147166413 17:38595957-38595979 CTGGAGGGCCAGAAACGGAGAGG - Intronic
1147507499 17:41034334-41034356 CAGGAGTAGCAGCAGCAGACTGG + Exonic
1147871585 17:43591471-43591493 CTGGTGCCCCAGCACCAGAGAGG + Intergenic
1147981857 17:44279832-44279854 CTGGCGGGGCAGCAGCAGACCGG + Intergenic
1148062829 17:44848476-44848498 CTGGAGCACCAACACCAAAGTGG + Intronic
1148640390 17:49183403-49183425 CAGGACGAACAGCTGCAGAGAGG - Intergenic
1148793612 17:50186976-50186998 CTGGAGGGCCATGAGCAGAGGGG + Intronic
1148794949 17:50192501-50192523 CTGGAGGACCAGCAGGACCAGGG + Exonic
1149085491 17:52710421-52710443 CTGGAGGACATGCTGCAGAGAGG + Intergenic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1149482885 17:57017840-57017862 CAGGATGACCAGTTGCAGAGTGG - Intergenic
1149482890 17:57017894-57017916 CAGGATGATCAGCTGCAGAGAGG - Intergenic
1150435038 17:65147086-65147108 CTGTAGGTCCAGCAGCAATGAGG - Intronic
1150529182 17:65959023-65959045 CAGGACAACCAGCTGCAGAGAGG + Intronic
1150951000 17:69802013-69802035 CAGGATGACCAGCTACAGAGAGG + Intergenic
1150952838 17:69822003-69822025 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1151010036 17:70483797-70483819 CTGGACGACCAGCTGCAAAGAGG - Intergenic
1151226821 17:72654199-72654221 CTGGCAGAGCAGCAGAAGAGGGG - Intronic
1151395267 17:73819193-73819215 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1151474083 17:74335660-74335682 CTGGAGCTGCAGCAGCAGATGGG + Intronic
1151748382 17:76023602-76023624 CTGCAGCACCAGCAGGAGACGGG - Exonic
1151995683 17:77607555-77607577 CTGGCGCACCAGCCGCGGAGAGG + Intergenic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152530403 17:80915179-80915201 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530421 17:80915317-80915339 CAGGAAAACCAGCTGCAGAGAGG + Intronic
1152530430 17:80915387-80915409 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530439 17:80915457-80915479 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530470 17:80915667-80915689 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530502 17:80915877-80915899 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1153515118 18:5895303-5895325 CTGGAGGATGAGCGGCGGAGAGG - Exonic
1155108527 18:22690697-22690719 CTGGAGGGCTTGGAGCAGAGGGG - Intergenic
1155120644 18:22816061-22816083 CAGGATGACCAGTTGCAGAGAGG - Intronic
1155168079 18:23247280-23247302 CAGAAGGACCTGCAGCTGAGAGG + Intronic
1155759405 18:29547471-29547493 CTAGAGGAGCCGCAGCAGAAGGG + Intergenic
1155830866 18:30513721-30513743 ATGGATAACCAGCTGCAGAGAGG - Intergenic
1156160386 18:34351308-34351330 TGGGAGGACCAGCTTCAGAGAGG + Intergenic
1156327305 18:36085760-36085782 CAAGACGACCAGCTGCAGAGGGG + Intergenic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1157043633 18:44068827-44068849 CTGGAGGACCTGGAGGAGATGGG - Intergenic
1157327553 18:46679986-46680008 CAGGAGGGACAGCAGGAGAGGGG + Exonic
1157728412 18:49983277-49983299 ATGGAGGACCAGAACCAGAAAGG - Intronic
1159569542 18:70096551-70096573 CCAGCAGACCAGCAGCAGAGGGG - Intronic
1159681149 18:71354207-71354229 CTGGAGGCTCAGCAGGAGAGTGG - Intergenic
1159832240 18:73291257-73291279 CTGAAGGACCAGTGGAAGAGTGG + Intergenic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1160313845 18:77822016-77822038 CTGGGGGCCCAGCTGCAGAGAGG - Intergenic
1161173185 19:2823714-2823736 CCGGACGACCAGCTGCAGAGAGG - Intronic
1161305663 19:3566189-3566211 CTGAGGGCCCAGCAGCAGTGGGG + Intronic
1161780214 19:6286707-6286729 CGGGACTACCAGCTGCAGAGAGG + Intergenic
1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG + Intronic
1162117775 19:8441988-8442010 CTGTAGGAAGAGCAGCAGGGAGG + Intronic
1162788737 19:13052222-13052244 CTGGAGGACCAACAGCACCTGGG - Intronic
1164821665 19:31255696-31255718 CAGGCAGAGCAGCAGCAGAGGGG + Intergenic
1165022663 19:32936696-32936718 TCAGAGGACCAGCAGCAGAGAGG + Intronic
1166120842 19:40685278-40685300 TGGGAGCACCAACAGCAGAGGGG + Intronic
1166206695 19:41274529-41274551 CTGGAGGACAGACAGCAGGGCGG - Intronic
1166748309 19:45152395-45152417 CTGGAGGACCGGCAGCAGACCGG - Exonic
1166944739 19:46390028-46390050 CTGCAGGGACAGGAGCAGAGTGG - Intronic
1167109117 19:47448410-47448432 CTGGAGGAAGGGCTGCAGAGCGG + Intronic
1167148316 19:47695255-47695277 CCGGAGGGCCAGGAGGAGAGCGG + Intronic
1167293560 19:48636941-48636963 CGGGCCGCCCAGCAGCAGAGGGG + Exonic
1167346275 19:48947351-48947373 CAGGATGACCAGCTACAGAGCGG + Intergenic
1167510077 19:49891165-49891187 CAGGAGGCCCAGCTGCGGAGGGG - Intronic
1167679890 19:50912689-50912711 GTGGGGGGCCAGGAGCAGAGGGG + Intergenic
1168299087 19:55393147-55393169 CTGGAGGGACAGCAGGGGAGCGG - Intronic
1168665553 19:58202284-58202306 CTGGAAGGGAAGCAGCAGAGAGG + Intronic
1202704559 1_KI270713v1_random:13525-13547 CTGGAGGAGGAGCAGCAGGGAGG - Intergenic
925048209 2:790320-790342 CTGGATGACCTGCTGCAGAGAGG + Intergenic
925067987 2:943987-944009 CAGGAGGAACTGCTGCAGAGAGG - Intergenic
925071321 2:969929-969951 CTGGAGAACCAGAAGCAGACAGG - Intronic
925173675 2:1767694-1767716 CTGGGGGACCAGCACCTGGGAGG - Intergenic
926061315 2:9806874-9806896 CCGAAGCACCTGCAGCAGAGGGG + Intergenic
926625469 2:15086207-15086229 CAGGAAGACCAGTTGCAGAGAGG + Intergenic
926953637 2:18271394-18271416 CGGGAGGACCAGTTGCAGAGAGG - Intronic
927159435 2:20243291-20243313 CTGGCAGAGCAGCAGTAGAGAGG - Intergenic
927226228 2:20767956-20767978 TGGGATGACCAGCTGCAGAGAGG + Intronic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
927533827 2:23836785-23836807 CAGGAGGACCAACTTCAGAGAGG - Intronic
927875111 2:26650099-26650121 CTGCAGAATGAGCAGCAGAGAGG + Intergenic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
929380786 2:41350557-41350579 ATGGAGGAGAAGCAGAAGAGTGG + Intergenic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
929601600 2:43208007-43208029 GTGGAGAAACAGCAGAAGAGGGG + Intergenic
929666572 2:43838502-43838524 CTGGGGGAGCAGCAGCAGCAAGG + Intronic
929838119 2:45426737-45426759 CCAGAAGACCTGCAGCAGAGGGG + Intronic
930957301 2:57217835-57217857 CAGGACTACCAGCTGCAGAGAGG + Intergenic
932187240 2:69708693-69708715 TTGGAGGACCATCTTCAGAGAGG - Intronic
932501613 2:72187620-72187642 CAGGACGACCAGCTGCAGAGAGG - Intronic
932558524 2:72846832-72846854 CTGGTGTAGCAGGAGCAGAGAGG + Intergenic
933624672 2:84585624-84585646 CGGGAAAACCAGCTGCAGAGGGG - Intronic
933801123 2:85961227-85961249 CAGGATGACCAGCTGCAGAAAGG - Intergenic
934014478 2:87864461-87864483 CTGGGGGACCAGAAAGAGAGTGG - Intergenic
934699901 2:96430789-96430811 CAGTATGACCAGCTGCAGAGAGG + Intergenic
935489497 2:103698857-103698879 ATAGAGAACCAGCAGCAGGGTGG - Intergenic
935506572 2:103911984-103912006 CTGGAGTACCAGAAGGAGACAGG + Intergenic
935518731 2:104078173-104078195 CAGGACGACAAGCTGCAGAGAGG - Intergenic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
937858682 2:126691360-126691382 CTGGAGTCCCAGCAGAAGTGAGG + Intronic
937859182 2:126694945-126694967 CTGGAGTCCCAGCAGAAGTGAGG + Intronic
937931664 2:127209890-127209912 CTGGAGCACCAGAAGGAGACGGG + Intronic
938180631 2:129179088-129179110 CAGGATGACCAGCTTCAGAGGGG - Intergenic
938425243 2:131181248-131181270 CTGGAGGACCTGGACGAGAGCGG - Intronic
938561064 2:132472316-132472338 CTGGAAGGCCAGCAGCAAGGAGG - Intronic
938690966 2:133788746-133788768 CTAGAAGAGCAGCAGAAGAGAGG - Intergenic
938690973 2:133788825-133788847 CTAGAAGAGCAGCAGAAGAGAGG - Intergenic
938770145 2:134494820-134494842 CTGGGGGACCCGGAGCATAGGGG - Intronic
939809126 2:146809409-146809431 CTGGAGTACCAGAAGGAGATGGG + Intergenic
940431784 2:153600105-153600127 CTGGAAGACCAGAACCATAGAGG + Intergenic
940821499 2:158360559-158360581 CTAGCAGACCTGCAGCAGAGGGG + Intronic
940857090 2:158737965-158737987 CTGCAGGTCCTGCAGCAGGGAGG - Intergenic
940964611 2:159822854-159822876 CCAGCAGACCAGCAGCAGAGGGG + Intronic
941762947 2:169264874-169264896 CTGGAGGAGCTGAAGCAGAATGG + Intronic
942010766 2:171760766-171760788 CTAGCAGACCTGCAGCAGAGAGG - Intergenic
942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG + Intergenic
942178163 2:173354868-173354890 CAGGAGGAGCAGCAGCAGCGCGG - Exonic
942465227 2:176200988-176201010 CTGGAGCAGCAGCAGTGGAGGGG + Intergenic
942498699 2:176565641-176565663 ATAGAGTACCAGGAGCAGAGGGG - Intergenic
942598661 2:177618277-177618299 CTGGTGGAGCAGCTGCTGAGTGG - Exonic
943182319 2:184560296-184560318 CAGGACTACCAGCTGCAGAGAGG - Intergenic
943820398 2:192314641-192314663 CAGGACAACCAGCTGCAGAGAGG - Intergenic
944335463 2:198528533-198528555 CTGAATGACCTGCAGCAGACTGG + Intronic
944586696 2:201179105-201179127 TGGGATGACCAGCTGCAGAGAGG + Intergenic
944901768 2:204223201-204223223 CAGGGTGACCAACAGCAGAGAGG - Intergenic
944901792 2:204223360-204223382 CGGGACGACCGGCTGCAGAGAGG - Intergenic
945168328 2:206969390-206969412 CAGCAGGCCCAGCAGCATAGTGG - Exonic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
946522868 2:220485730-220485752 CTGCAGGACAGGCAGCAAAGAGG + Intergenic
947098507 2:226593197-226593219 GTGGAGGCTCAGCATCAGAGTGG - Intergenic
947316708 2:228866622-228866644 CAGGACAACCAGCTGCAGAGAGG + Intronic
947395927 2:229686623-229686645 ATGGAGGAGCAGCAGAAGACAGG - Intronic
947488399 2:230573130-230573152 AGGGAGGAGCAGCAGCAGGGTGG + Intergenic
947642647 2:231715548-231715570 CTGGGGTTCCAGCAACAGAGAGG - Intergenic
948029031 2:234801293-234801315 CTGGGGAACCAGCAGCCGGGTGG + Intergenic
948449623 2:238061027-238061049 CTGGATGCCCGGCAGCAGTGGGG + Exonic
948575364 2:238946468-238946490 CAGGATAACCAGCTGCAGAGAGG - Intergenic
948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG + Intergenic
948786025 2:240353390-240353412 CTGGCAGACCACGAGCAGAGTGG + Intergenic
1169200211 20:3705613-3705635 CTGGAGGCCCAGGAGCAGCCTGG + Intronic
1169425630 20:5495145-5495167 CAGGAGGAGGAGCAGCAGGGAGG + Intergenic
1170080258 20:12467383-12467405 CTTGAGGAACTGCAACAGAGTGG - Intergenic
1170495046 20:16915732-16915754 CTGGACAACCAGCTACAGAGAGG + Intergenic
1170495062 20:16915866-16915888 GGGGAAGACCAGTAGCAGAGAGG + Intergenic
1170791214 20:19511054-19511076 CTGCAGGGTCAGCAGCAGGGTGG - Intronic
1171236875 20:23534690-23534712 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1172327184 20:34045434-34045456 CTGGAGTAGCAGCAGTAAAGAGG + Intronic
1172466984 20:35162450-35162472 CCAGAAGACCTGCAGCAGAGGGG + Intergenic
1172676723 20:36677532-36677554 CTGGACAACCAGCTGCAGAGAGG + Intronic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173179746 20:40796825-40796847 GGGCAGGAGCAGCAGCAGAGTGG - Intergenic
1173524435 20:43721289-43721311 AGGGATGACCAGCTGCAGAGAGG - Intergenic
1173639698 20:44592294-44592316 CTGAAGGAGCACCAGCAGAATGG - Intronic
1173750517 20:45471623-45471645 GAGGAGGACCAGAAGGAGAGAGG + Intronic
1173884535 20:46445804-46445826 TAGGATGACCAACAGCAGAGAGG - Intergenic
1174362611 20:50038450-50038472 ATGGAAGTCCAGAAGCAGAGAGG - Intergenic
1174860423 20:54086270-54086292 CTGGAGGACATGCAGGAGAAGGG - Intergenic
1175064395 20:56272742-56272764 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1175065136 20:56277706-56277728 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175478621 20:59295443-59295465 CTCCAGAACCAGCAGCAGAATGG - Intergenic
1175675847 20:60945954-60945976 CAGGATGACCAGCAGCAGACAGG + Intergenic
1175715950 20:61253920-61253942 CTGAAGGAGCAGGAGCACAGCGG - Intronic
1176074713 20:63243213-63243235 GTTTAGGATCAGCAGCAGAGTGG + Intronic
1176719569 21:10382162-10382184 CTGGGAGACTAGCAGAAGAGAGG + Intergenic
1177092084 21:16781800-16781822 CCGGTAGACCTGCAGCAGAGAGG + Intergenic
1177396048 21:20537852-20537874 CGGGACGACCAGCAGCACAAAGG - Intergenic
1177893295 21:26833076-26833098 CTGGAGGACCAGAAGAGGTGTGG + Intergenic
1178467051 21:32858568-32858590 CAGGATGACCAGCTGTAGAGAGG - Intergenic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG + Intronic
1179105716 21:38398552-38398574 ATGGAAGACCACCATCAGAGCGG + Intronic
1179683945 21:43042861-43042883 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1180178906 21:46109212-46109234 CAGGACGACCAGCTGCAGAGAGG - Intronic
1180300806 22:11035136-11035158 CTGGGGGACTAGCAGAAGAGAGG + Intergenic
1180466404 22:15615401-15615423 CTGGAGGACCTGGATGAGAGCGG - Intergenic
1181444334 22:22957219-22957241 CTGGAGGATCAGCCCCAGGGTGG - Intergenic
1182091826 22:27601152-27601174 CTTGGGGACCTGAAGCAGAGAGG - Intergenic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1183589664 22:38772667-38772689 CTGGGGAAGCAGCCGCAGAGGGG - Intronic
1184054239 22:42033759-42033781 TGGGACGACCAGCTGCAGAGAGG - Intronic
1184152810 22:42648496-42648518 CAGGAGTGACAGCAGCAGAGTGG + Intronic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1184279673 22:43429834-43429856 GTGGAGGACCAGCTGCACTGTGG + Intronic
1184729103 22:46363447-46363469 CTGAAAGACCAGCAACACAGAGG - Intronic
1184764531 22:46564569-46564591 CTGGAGGATCCTGAGCAGAGAGG + Intergenic
1184865801 22:47201383-47201405 CAAGACGACCAGCTGCAGAGAGG - Intergenic
1184869404 22:47225805-47225827 ATGGATGACCAGTTGCAGAGAGG - Intergenic
1185236462 22:49716420-49716442 TTGCAGCACCAGCAGCAGCGAGG - Intergenic
949105766 3:198064-198086 CCGGAGGAGCAGCAGCCGCGCGG + Intronic
949315413 3:2749093-2749115 CTGGAGGAAGGTCAGCAGAGAGG - Intronic
949640335 3:6029558-6029580 CCAGAAGACCTGCAGCAGAGGGG - Intergenic
949724486 3:7027580-7027602 GTGGAGAGCCAGCAGAAGAGAGG - Intronic
950637458 3:14324828-14324850 CTTCACGCCCAGCAGCAGAGTGG - Intergenic
951136193 3:19107114-19107136 TGGGATGACCAGCTGCAGAGAGG - Intergenic
951562431 3:23982063-23982085 AGGGATGACCAGCTGCAGAGAGG - Intergenic
951718440 3:25673727-25673749 TGGGATGACCAGCTGCAGAGAGG - Intergenic
951771128 3:26258822-26258844 AAGGAGGACCAGTAGCAGAATGG + Intergenic
952016162 3:28959340-28959362 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
953854543 3:46491087-46491109 CAGAAGGACCAGGAGCAGCGAGG + Intergenic
954035687 3:47849798-47849820 CCGGAGGAGCAGCTGCAGAGCGG - Intronic
954082812 3:48222357-48222379 CAGGAGGGACAGCAGGAGAGTGG + Intergenic
954099347 3:48357585-48357607 CAGGATTACCAGCTGCAGAGAGG - Intergenic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
954420725 3:50417728-50417750 CCAGAGGACAAGCAGCAGGGGGG - Intronic
955241485 3:57182524-57182546 CAAGACAACCAGCAGCAGAGAGG - Intergenic
955601045 3:60645316-60645338 CTGGAAGGCCAGGAGAAGAGGGG - Intronic
956462275 3:69484690-69484712 CTGGACAACCAGCAGCAGAGAGG - Intronic
956462280 3:69484744-69484766 TGAGAGGACCAGCTGCAGAGAGG - Intronic
956502131 3:69898340-69898362 CTGGAGGAGCAACAGCAAAGGGG + Intronic
957678783 3:83404511-83404533 CAGGAGTACCAGCTGCAGAGAGG + Intergenic
957845152 3:85722136-85722158 CAGGATAACCAGCTGCAGAGAGG - Intronic
957845162 3:85722204-85722226 CAGGATAACCAGCTGCAGAGAGG - Intronic
958586155 3:96091017-96091039 ATGGAGGACAAGCAGAAGTGGGG + Intergenic
958636264 3:96750642-96750664 CAGGAGGACCAGCTGCAGAGAGG + Intergenic
958675552 3:97265007-97265029 CAGGATGACCAGCTGCAAAGAGG - Intronic
958675556 3:97265063-97265085 CAGGATGACCAGTTGCAGAGAGG - Intronic
959091706 3:101910721-101910743 CTAGCAGACCTGCAGCAGAGGGG - Intergenic
959444985 3:106427773-106427795 CTGGAAGTCCAGAGGCAGAGTGG - Intergenic
959863660 3:111242810-111242832 TAGGATGACCAGCAGCAGAGAGG - Intronic
959991632 3:112638326-112638348 CTGGAGGACGAGCTGCAGGTGGG - Exonic
960634213 3:119767972-119767994 CTGAATGACCAGTTGCAGAGAGG - Intergenic
961493058 3:127268767-127268789 CTGCAGGAACAGCAGCACTGTGG + Intergenic
961493608 3:127274625-127274647 CTGGACAACCAGCTGCAGAGAGG + Intergenic
962817917 3:139019808-139019830 CTAGAGGGCCTCCAGCAGAGCGG + Exonic
962824500 3:139088269-139088291 TGGGATGACCAGCAGCAGAGAGG - Intronic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
963781998 3:149495694-149495716 CTGTGTGACTAGCAGCAGAGGGG - Intronic
963805195 3:149714957-149714979 TGGGAGGACTAGCTGCAGAGAGG + Intronic
964255018 3:154766335-154766357 TGGGATGACCAGCAGCAGAGGGG - Intergenic
964648986 3:158990823-158990845 CTAGCAGACCTGCAGCAGAGGGG - Intronic
965309863 3:167115424-167115446 GGGGAGGACAAGCTGCAGAGAGG - Intergenic
965793060 3:172410745-172410767 CTGGAAAACCAGCTGCAGAGAGG - Intergenic
966255245 3:177909355-177909377 CCAGAAGACCTGCAGCAGAGAGG + Intergenic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
966785209 3:183617326-183617348 CTGGAGGGTAAGCAGCCGAGAGG - Intergenic
966840189 3:184081781-184081803 CAGGACGACCAGCTGCATAGAGG + Intergenic
967010510 3:185428708-185428730 CTCGAGGACCAGCAGGAAAAGGG + Exonic
967649851 3:191973317-191973339 ATGGGTGACCAGCAGCAGAGAGG - Intergenic
967989869 3:195122787-195122809 TTGGTGGCTCAGCAGCAGAGTGG + Intronic
968044447 3:195616197-195616219 CTGGATGCCCAGAAGCACAGTGG - Intergenic
968060237 3:195722248-195722270 CTGGATGCCCAGAAGCACAGTGG - Intronic
968088368 3:195884932-195884954 CTGGGGGCCCAGCAGGGGAGGGG - Exonic
968438731 4:610596-610618 CTGGAGTAGCAGCAGCTGCGTGG + Intergenic
968600997 4:1509239-1509261 CTGGAGGGACAGCAGCACAGGGG + Intergenic
968692278 4:1998676-1998698 CTGGAGTACCAGAAGGAGACGGG + Intronic
968977122 4:3827816-3827838 GTGGAGGACCAGCCTCACAGGGG + Intergenic
968977428 4:3829300-3829322 GTGGAGGACCAGCCTCACAGGGG + Intergenic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
969591246 4:8123029-8123051 CAGGAAGAGCAGCAGCAGATAGG - Intronic
970155256 4:13134840-13134862 CTGGAGTACCAGAAGCAGATGGG + Intergenic
970264249 4:14263794-14263816 CTTGAAGACAAGCAGCATAGTGG - Intergenic
972072596 4:35039181-35039203 CCGGACGACCAGCTGCAGAAAGG + Intergenic
972158797 4:36198234-36198256 CAGGACGACCAGCTGCAGGGAGG - Intronic
972297200 4:37751351-37751373 ATTCAGGACCAGAAGCAGAGAGG - Intergenic
972369657 4:38410677-38410699 GCGGAGGAGCAGCAGCAGAGGGG + Intergenic
972637240 4:40895284-40895306 CTTGTGCACCATCAGCAGAGTGG - Intronic
972931029 4:44071908-44071930 TGGGAAGACCAGCTGCAGAGAGG - Intergenic
973661024 4:53106104-53106126 CTAGCAGACCTGCAGCAGAGGGG + Intronic
974972969 4:68853827-68853849 CAGGACAACCAGCTGCAGAGAGG - Intergenic
975245972 4:72120642-72120664 CTAGTAGACCTGCAGCAGAGGGG + Intronic
975253795 4:72211902-72211924 TTTGAAGACCAGCTGCAGAGAGG - Intergenic
975597759 4:76066568-76066590 TGGGATGACCAGCAGCAGAGAGG - Intronic
975638890 4:76478865-76478887 CTAGCAGACCTGCAGCAGAGGGG + Intronic
975910299 4:79258876-79258898 CTGGATGACCAGCTGCAGAAAGG + Intronic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
976363160 4:84203501-84203523 CTAGCAGACCTGCAGCAGAGGGG + Intergenic
976390716 4:84501323-84501345 CTGGAGGGCCAGGCGCAGAGTGG - Intergenic
976636620 4:87292678-87292700 CAGGGGGACAAGCGGCAGAGGGG + Intergenic
976679887 4:87745248-87745270 CCAGACGACCAGTAGCAGAGAGG - Intergenic
976734495 4:88296401-88296423 CAGGACAACCAGCTGCAGAGAGG - Intergenic
976868567 4:89762041-89762063 CTGGAGGATGAGCAGGTGAGAGG + Intronic
977192108 4:94013963-94013985 CTGAGGGTCCAGCAGCAGTGAGG + Intergenic
977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG + Intergenic
977471882 4:97452626-97452648 CAAGATGACCAACAGCAGAGAGG + Intronic
977471891 4:97452706-97452728 CAGGACTACCAGCTGCAGAGAGG + Intronic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
978249293 4:106610743-106610765 TGGGATGACCAGCTGCAGAGAGG + Intergenic
978885356 4:113761467-113761489 CAGGAGGAGTAGAAGCAGAGGGG + Intronic
979145397 4:117240119-117240141 CTGGAAGACCAGCTGCTGAGAGG + Intergenic
979145405 4:117240172-117240194 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
979417557 4:120461545-120461567 CTGGCAGACCTGCAGCAGAGGGG + Intergenic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
979671717 4:123366607-123366629 CTAGAGCAGCAGCAGCAGAGAGG + Intergenic
979993314 4:127401827-127401849 CCTGAGGACCAGGAGCATAGGGG - Intergenic
980180260 4:129392913-129392935 CAGGACAACCAGCTGCAGAGAGG + Intergenic
980701967 4:136442761-136442783 TCAGATGACCAGCAGCAGAGAGG + Intergenic
982158026 4:152540422-152540444 ATGGATGACCAGCTGCAGAGAGG - Intergenic
982355269 4:154459958-154459980 CTGATGGACCAGCAGCTGATTGG + Intronic
982392279 4:154877615-154877637 CTGCAGAACCAGCTGCTGAGAGG + Intergenic
983784597 4:171715696-171715718 CGAGATGACCAGCTGCAGAGAGG + Intergenic
984088404 4:175340401-175340423 CCTGAGAAGCAGCAGCAGAGAGG - Intergenic
985204580 4:187521363-187521385 CCAGAAGACCTGCAGCAGAGGGG + Intergenic
985705305 5:1397117-1397139 CTGGAGGACCTGGGGCAAAGTGG + Intronic
986005910 5:3669179-3669201 CCAGCAGACCAGCAGCAGAGGGG - Intergenic
986284099 5:6347349-6347371 CTGGAGCTGCCGCAGCAGAGAGG - Intergenic
986322973 5:6648977-6648999 CAGGCAGACCTGCAGCAGAGGGG - Intronic
986893850 5:12341541-12341563 CTGCAGGACTACAAGCAGAGAGG - Intergenic
987798886 5:22667280-22667302 CGGGACAACCAGCTGCAGAGAGG - Intronic
988059646 5:26150046-26150068 CTGGAGTACCAGAAGGAGACAGG + Intergenic
988093185 5:26569010-26569032 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
989279136 5:39621603-39621625 AGGGATGACCAGCTGCAGAGAGG - Intergenic
989520696 5:42396773-42396795 CGGGATGACCAGCTACAGAGAGG + Intergenic
990023769 5:51160188-51160210 CAGGAGGACCAGCTAGAGAGAGG + Intergenic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
991107599 5:62861943-62861965 AGGGATGACCAGCTGCAGAGAGG - Intergenic
991359277 5:65803019-65803041 CAGGACAACCAGCTGCAGAGAGG - Intronic
992077971 5:73207956-73207978 CTAGCAGACCTGCAGCAGAGAGG + Intergenic
994449922 5:99929317-99929339 TGGGATGACCAGCCGCAGAGGGG - Intergenic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
994654965 5:102581168-102581190 CTGGAGGAAAATCACCAGAGTGG + Intergenic
994790791 5:104223817-104223839 TGGGATGACCAGCTGCAGAGAGG - Intergenic
995695846 5:114877110-114877132 CCAGAAGACCTGCAGCAGAGGGG + Intergenic
995742446 5:115369012-115369034 GAGGATGACCAGCTGCAGAGAGG + Intergenic
995744941 5:115393532-115393554 CAGGACGACCAGCTGCAGATAGG - Intergenic
995790549 5:115882453-115882475 CCAGAAGACCTGCAGCAGAGGGG - Intronic
996234419 5:121108591-121108613 CCGGCGGACCAGCAGCAGAGAGG - Intergenic
996893992 5:128457327-128457349 CTGGAGTACCAGGAGGAGACAGG + Intronic
999859951 5:155634040-155634062 TGGGATGACCAGCCGCAGAGAGG + Intergenic
999875507 5:155801291-155801313 GTGGAAGACCAGATGCAGAGGGG - Intergenic
1000082390 5:157860381-157860403 ATGGAGGGCCAGCAGAGGAGTGG + Intergenic
1000426229 5:161093897-161093919 TGGGATGGCCAGCAGCAGAGAGG + Intergenic
1001746506 5:174096640-174096662 CTGGAGGCCCAGGAGCAGTGAGG + Intronic
1001936386 5:175708814-175708836 CTTGATGACAAGCACCAGAGAGG - Intergenic
1002001849 5:176200481-176200503 TAGGAGAGCCAGCAGCAGAGAGG + Intergenic
1002072385 5:176688001-176688023 TGGGATGACTAGCAGCAGAGAGG - Intergenic
1002252489 5:177938497-177938519 TAGGAGAGCCAGCAGCAGAGAGG - Intergenic
1002436656 5:179235753-179235775 ATGGGGGCCCAGCAACAGAGAGG - Intronic
1002902000 6:1417207-1417229 CTGGGCGCCCAGCAGCAGATGGG + Intergenic
1002986265 6:2192205-2192227 TGGGATGACCAGCTGCAGAGAGG + Intronic
1004013462 6:11711127-11711149 CTTGAGGAGCAGCACCACAGGGG - Intergenic
1004258840 6:14089892-14089914 CTGGAGGCCAGGCAGGAGAGAGG - Intergenic
1004279870 6:14271473-14271495 CAGGAAGACCAGCTGCAGAGGGG - Intergenic
1004302234 6:14469082-14469104 TTGCAGGACCAGCAGAACAGAGG - Intergenic
1004304515 6:14487803-14487825 CGGGACGACCAGCTGCAGAGAGG + Intergenic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1004883125 6:20028162-20028184 CTGGAGGACTGGCAGCAGATGGG - Intergenic
1004918223 6:20352307-20352329 GTGGAGGAAAAACAGCAGAGAGG + Intergenic
1005781962 6:29201731-29201753 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006416106 6:33904865-33904887 CTGGGAGCTCAGCAGCAGAGAGG - Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1006500968 6:34458490-34458512 CTCGATGACCAGCTGCAGAGAGG + Intergenic
1006789017 6:36686598-36686620 GGGGAGGGACAGCAGCAGAGGGG - Exonic
1006867578 6:37221978-37222000 TGGGAGGACCAGCTACAGAGAGG - Intronic
1006867585 6:37222032-37222054 TAGGACGACCAGCTGCAGAGAGG - Intronic
1006919015 6:37615411-37615433 CTGGAGGCCAAGGAGCAGACAGG + Intergenic
1007649978 6:43413228-43413250 CCAGGTGACCAGCAGCAGAGAGG + Intergenic
1009610138 6:65930903-65930925 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1009621556 6:66084647-66084669 CAGCAGGAGCAGCAGCACAGTGG + Intergenic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1009846878 6:69145845-69145867 CGGGATGAACAGCTGCAGAGAGG - Intronic
1010884068 6:81215349-81215371 CGGGATGACCAGCTGCAGGGAGG + Intergenic
1011199750 6:84822806-84822828 CCAGCAGACCAGCAGCAGAGGGG - Intergenic
1011530133 6:88312477-88312499 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1012052248 6:94361191-94361213 CAGGATGACCAGCTGCAGACAGG - Intergenic
1012141847 6:95635336-95635358 CGGGTCAACCAGCAGCAGAGAGG + Intergenic
1012644314 6:101660729-101660751 CCAGAAGACCTGCAGCAGAGGGG - Intronic
1013086350 6:106861216-106861238 CAGGATGACTAGCTGCAGAGAGG - Intergenic
1013375554 6:109510298-109510320 CAGGATGACCAGCTGCAGAAAGG + Intronic
1013375564 6:109510374-109510396 CAGGACGACCAACTGCAGAGAGG + Intronic
1013375584 6:109510544-109510566 CAGGACAACCAGTAGCAGAGAGG + Intronic
1014174766 6:118320052-118320074 CTGGGAGGCCAGCAGCACAGTGG + Intergenic
1014289302 6:119539843-119539865 CAGGAGGACCAGTGGCAGAGAGG + Intergenic
1014289317 6:119539977-119539999 CTGGACTACCAACTGCAGAGAGG + Intergenic
1014701936 6:124699621-124699643 CTGGAGCAGCAGCAAGAGAGTGG - Intronic
1015143326 6:129959007-129959029 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
1015549095 6:134393437-134393459 CAGGAGGGCCAGCTGCAAAGGGG + Intergenic
1015663766 6:135604051-135604073 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1015804411 6:137093861-137093883 CTGGAGCAGCAGCAAGAGAGAGG + Intergenic
1015880293 6:137865382-137865404 AAGGAGCACCAGCAGGAGAGTGG + Intergenic
1016272266 6:142302250-142302272 GTGGAGCAGCGGCAGCAGAGCGG + Exonic
1016339647 6:143049371-143049393 TGGGAGGACCAGCAGCATAGAGG - Intergenic
1016502461 6:144736935-144736957 CAGGATGACCAGCAGCTGCGTGG - Intronic
1017571520 6:155749474-155749496 CCGGCAGACCTGCAGCAGAGGGG + Intergenic
1017634557 6:156431145-156431167 GTGGAGGAACAGCAGTAGAAAGG - Intergenic
1017740959 6:157406225-157406247 CTGGAGGACCGGGTGCTGAGAGG + Intronic
1018064919 6:160118214-160118236 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1018184212 6:161251812-161251834 CAGGAGGAACAAAAGCAGAGAGG + Intronic
1018616622 6:165692558-165692580 CACGAAGACCAGCAGGAGAGAGG - Intronic
1018958915 6:168432288-168432310 CTGGAGGATGAGCAGGAGGGAGG + Intergenic
1019500019 7:1360122-1360144 CTGATGGACCAGCAGAGGAGAGG - Intergenic
1019628673 7:2034979-2035001 CCTGAGGCCCAGCAGCACAGGGG + Intronic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019897904 7:3997595-3997617 CAGGAGGACCAGCTGTAAAGAGG - Intronic
1020041804 7:5009247-5009269 CTGGAGGACCATCTTCAGAGAGG - Intronic
1020338884 7:7088529-7088551 CTAGCAGACCTGCAGCAGAGGGG - Intergenic
1020812415 7:12863848-12863870 CAGGATAACCAGCAGCATAGAGG - Intergenic
1021097281 7:16548083-16548105 CAGGACGACCAGCTGCAGAGAGG + Intronic
1021500746 7:21329872-21329894 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1023789159 7:43737931-43737953 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
1023790406 7:43749467-43749489 CGGGACTACCAGCTGCAGAGAGG - Intergenic
1023790412 7:43749533-43749555 CAGGACGATCAGCTGCAGAGAGG - Intergenic
1024038950 7:45534538-45534560 GTGCAGGACCAACTGCAGAGTGG + Intergenic
1024293830 7:47827266-47827288 CAGGAGGACCAGCGGCAGTGGGG + Intronic
1024832499 7:53477949-53477971 CTGGAGTAACTGCAGCAGAGGGG - Intergenic
1026846920 7:73703780-73703802 CTGGAGGACATGCTGGAGAGTGG - Exonic
1027041498 7:74964752-74964774 CCGGCGGAGCAGCAGCCGAGGGG - Intergenic
1027082144 7:75237617-75237639 CCGGCGGAGCAGCAGCCGAGGGG + Intergenic
1027250443 7:76395452-76395474 CTGGTGGCCCAGCCGCAGCGGGG + Intronic
1027558193 7:79692661-79692683 CTGGAGTTCCAGCACCGGAGTGG - Intergenic
1027778111 7:82491981-82492003 CTGGCGGATCTGCAGCAGAGGGG - Intergenic
1027779814 7:82507467-82507489 CAAGATGACCAGCAACAGAGAGG - Intergenic
1027910611 7:84245607-84245629 CTAGCAGACCTGCAGCAGAGGGG - Intronic
1028233351 7:88330755-88330777 CAGGATGACCAGGTGCAGAGAGG + Intergenic
1028500806 7:91517170-91517192 CTAGTAGACCAACAGCAGAGAGG - Intergenic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1028660499 7:93267234-93267256 CTAGAGTAACAGAAGCAGAGAGG - Intronic
1028902663 7:96118687-96118709 GTGGTGGACCAGGAGCAGAGTGG + Intergenic
1029327644 7:99823585-99823607 TTAGACAACCAGCAGCAGAGAGG + Intergenic
1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG + Intergenic
1031053790 7:116972131-116972153 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
1031248651 7:119350739-119350761 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1031743685 7:125467950-125467972 TGGGAGGACCAGTAGCGGAGAGG - Intergenic
1032322009 7:130894329-130894351 CTGGAGGACCACCTGCTGCGTGG + Intergenic
1032635507 7:133703449-133703471 CTGGAGGATGAGCAGAACAGTGG + Intronic
1032658296 7:133955353-133955375 CGGGACAACCAGCTGCAGAGAGG - Intronic
1033425845 7:141243517-141243539 CTGGAGGAAGGGGAGCAGAGGGG + Intronic
1034406393 7:150905702-150905724 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1034410006 7:150935622-150935644 ACGAAGGACCAGCAGCAGAGTGG - Intergenic
1034481238 7:151321511-151321533 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1034481262 7:151321651-151321673 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1034520303 7:151614311-151614333 ATGGGGGAGCAGCAGCAGGGTGG + Intronic
1034935410 7:155196941-155196963 CACCAGGACCAGCAGCATAGTGG + Exonic
1035016151 7:155768044-155768066 CAGGAGGACCAGCAGGACACTGG - Intronic
1035068994 7:156127281-156127303 CAGGAAGAACAGGAGCAGAGAGG + Intergenic
1035252366 7:157605727-157605749 GGGGATGACCAGCTGCAGAGAGG - Intronic
1035434513 7:158849646-158849668 CAGGACGACCAGCTGCAGAGCGG - Intergenic
1035451018 7:158976754-158976776 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1036228826 8:6982583-6982605 ATGGAGGGCCAGCTGCAAAGTGG + Intergenic
1036231278 8:7001693-7001715 ATGGAGGGCCAGCTGCAAAGTGG + Intronic
1037777863 8:21847650-21847672 CTGGAGGACCAGCTGCAGAGAGG - Intergenic
1037817908 8:22121379-22121401 CTGCAGGAAAAGCAGTAGAGCGG - Intronic
1038050481 8:23805861-23805883 GTTGAGGAGCAGCAGGAGAGGGG - Intergenic
1038156536 8:24996687-24996709 CAGGAGCACCAGCATCAGACTGG - Intergenic
1039256927 8:35729528-35729550 CTGAAAGAGCGGCAGCAGAGAGG + Intronic
1039559376 8:38500354-38500376 TTGGAGACCCAGAAGCAGAGAGG - Intergenic
1040355099 8:46609311-46609333 CCAGCAGACCAGCAGCAGAGGGG + Intergenic
1040661886 8:49583484-49583506 TGGGAGGACCAGCTACAGAGAGG + Intergenic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1041197595 8:55416623-55416645 CTGGAGGATCACAAGCAGGGGGG + Intronic
1042004949 8:64169589-64169611 CAAGACGACCAGCTGCAGAGAGG + Intergenic
1042196795 8:66238008-66238030 CAGGATGACCAGCTGCAGAAAGG - Intergenic
1042196806 8:66238118-66238140 CCAGATGACCAGTAGCAGAGGGG - Intergenic
1043568073 8:81570591-81570613 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1043750298 8:83926263-83926285 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
1043808272 8:84701636-84701658 CTGGAGGATCAGGAAGAGAGGGG + Intronic
1044008660 8:86965953-86965975 CAGGAGGACCAGCTGCAGAGAGG - Intronic
1044927899 8:97224691-97224713 CTGCAGAAGCAGCGGCAGAGGGG - Intergenic
1044962379 8:97543151-97543173 CAGGTGGACCAGCTGCAGAGAGG + Intergenic
1045320681 8:101079787-101079809 CTGGAAGAGCAGCAGGGGAGGGG + Intergenic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1046395238 8:113632579-113632601 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1047052299 8:121126335-121126357 CTGGAAATCCAGTAGCAGAGTGG + Intergenic
1047215609 8:122873497-122873519 CTGGTTGAGCAGCATCAGAGCGG + Intronic
1047604216 8:126458145-126458167 CCAGCAGACCAGCAGCAGAGGGG + Intergenic
1047751593 8:127885085-127885107 CTGGAGTACCGTCAGCTGAGAGG - Intergenic
1048229151 8:132620207-132620229 CAGGAGGACCAGCCCAAGAGTGG + Intronic
1048422686 8:134292868-134292890 CAGGAGGACATGCAGCTGAGAGG + Intergenic
1048465176 8:134659594-134659616 CTGGAGAACAATCATCAGAGAGG - Intronic
1048770188 8:137886728-137886750 CTGGGGGACAAGCAGGAAAGAGG + Intergenic
1049360757 8:142211595-142211617 CTGGGTGGCAAGCAGCAGAGAGG + Intergenic
1049681565 8:143920912-143920934 GTGGAGGAGCAGGAGCAGAAGGG - Exonic
1049695746 8:143983606-143983628 GTGGAGGGCCAGCTGCAGAGCGG + Exonic
1049769556 8:144373591-144373613 CTGGAAGACAACCAGGAGAGTGG - Intronic
1050130518 9:2407002-2407024 CAAGATGACCAACAGCAGAGAGG + Intergenic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1050201238 9:3148264-3148286 CTAGCAGACCTGCAGCAGAGGGG - Intergenic
1050574355 9:6977659-6977681 CTGGAGGCCCAGCAGATGACAGG - Intronic
1050725522 9:8644141-8644163 TGGGATGACCAGCTGCAGAGAGG + Intronic
1051222870 9:14868924-14868946 CAGGAGGAGCAGCAGCAGCACGG + Exonic
1051575520 9:18611122-18611144 CTGTATGCCCAGCAGCAGAAGGG + Intronic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1052707600 9:32011336-32011358 CGGGATGACCAGCTGCAGACAGG + Intergenic
1053150390 9:35739473-35739495 CTAGAGGACAAGCTACAGAGGGG - Intronic
1053440201 9:38109719-38109741 CTGGAGGACAGGCTGAAGAGAGG + Intergenic
1053480149 9:38410595-38410617 CTGGAGGAACAGCTCCAGTGTGG - Intronic
1053739423 9:41124382-41124404 CTGGCAGACCAGGAGCAGGGGGG + Intergenic
1054688928 9:68306940-68306962 CTGGCAGACCAGGAGCAGGGGGG - Intergenic
1055923658 9:81488543-81488565 CTCCAGGACCAGCAGCACGGAGG + Intergenic
1055956175 9:81775721-81775743 ATGGAGGATCAGCAGCAGTTTGG - Intergenic
1056658449 9:88527582-88527604 GTGGCGGACCAGCAGCAGATGGG - Intergenic
1056731061 9:89167104-89167126 CTGGGGGTCCAGCAGGAGGGAGG + Intronic
1056774394 9:89500186-89500208 GGAGGGGACCAGCAGCAGAGGGG + Intergenic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1057510794 9:95678289-95678311 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1057531222 9:95847928-95847950 CCGGAAGACCAGTTGCAGAGAGG + Intergenic
1058091957 9:100814630-100814652 CAGGACTACCAGCTGCAGAGAGG + Intergenic
1058374463 9:104306439-104306461 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1058510819 9:105714052-105714074 GGGGATGACCAGCTGCAGAGAGG + Intronic
1058707342 9:107648292-107648314 CTGGAGGAGCAGCAGTTAAGAGG - Intergenic
1058899603 9:109430802-109430824 CATGAGGAGCAGCAGGAGAGGGG - Intronic
1061045632 9:128163565-128163587 CTGGAGTTCCAGCAGCAGCTCGG + Exonic
1061267387 9:129514644-129514666 CAGGAAGGCCAGCTGCAGAGAGG + Intergenic
1061974470 9:134061403-134061425 CTGGAGGAGCAGTGGCAGGGAGG + Intronic
1062184745 9:135211903-135211925 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1062184765 9:135212037-135212059 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1062390989 9:136333791-136333813 GTGGGGGACCAGGAGGAGAGGGG + Intronic
1062449428 9:136609321-136609343 CTGGAGGGGCAGCTGCAGGGAGG - Intergenic
1062586241 9:137251204-137251226 CAGGAGTCCCAGCAACAGAGGGG + Intergenic
1185643586 X:1601324-1601346 CAGGCGGGCCAGCAGCAGGGAGG + Exonic
1186019320 X:5236199-5236221 CTGAAGTTCCAGCGGCAGAGAGG + Intergenic
1186805870 X:13139600-13139622 CAGGATGACCAGCTGCATAGAGG + Intergenic
1188063590 X:25630499-25630521 CAGAAGGAACAGCAGAAGAGAGG - Intergenic
1188859849 X:35243966-35243988 CAGGACAACCAGCTGCAGAGAGG - Intergenic
1189210707 X:39279957-39279979 CTAGCAGACCTGCAGCAGAGGGG - Intergenic
1189243446 X:39543051-39543073 CCAGAAGACCTGCAGCAGAGGGG + Intergenic
1189360220 X:40344123-40344145 CAGGAGGATCAGCTGCAGAGAGG + Intergenic
1189590743 X:42507902-42507924 TTGGCAGACCTGCAGCAGAGGGG + Intergenic
1190278508 X:48914295-48914317 CTGTAGGCCAAGAAGCAGAGAGG + Intronic
1190369533 X:49727496-49727518 CAGGATGACCAGCTGCAAAGAGG + Intergenic
1190428465 X:50354729-50354751 CTGGAGGAACAGTAGCCAAGAGG + Intergenic
1190620659 X:52284422-52284444 CAGGACGACCAGTTGCAGAGGGG - Intergenic
1190681771 X:52831837-52831859 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1191984937 X:66969360-66969382 CTAGCAGACCTGCAGCAGAGGGG + Intergenic
1192265301 X:69533585-69533607 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1192265307 X:69533651-69533673 CAGGATGACCAGCTGCAGTGAGG - Intergenic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193075282 X:77348375-77348397 CCAGCAGACCAGCAGCAGAGAGG + Intergenic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1193467612 X:81867960-81867982 TAGGATGATCAGCAGCAGAGAGG - Intergenic
1193467632 X:81868141-81868163 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1193468717 X:81875277-81875299 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1193646878 X:84080259-84080281 CAGGCAGACCTGCAGCAGAGGGG + Intronic
1193919338 X:87406721-87406743 TGAGAGGACCAGCTGCAGAGAGG - Intergenic
1193952217 X:87813730-87813752 GTGATGGACCAGCAGCAGAAAGG + Intergenic
1195126531 X:101814008-101814030 CAGGATGACGAGCTGCAGAGAGG + Intergenic
1195178502 X:102333936-102333958 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1195180362 X:102353147-102353169 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1195454240 X:105050906-105050928 CTGGATGACCAGCTGCACAAAGG - Intronic
1196312485 X:114184369-114184391 CTAGCAGACCTGCAGCAGAGGGG + Intergenic
1196460101 X:115920742-115920764 CTGGAGGATCAGCTGCTTAGTGG - Intergenic
1196679239 X:118453963-118453985 CTGGAGAAGCAGCAGCAGCTGGG + Intergenic
1196744953 X:119063288-119063310 GTGTAGGAACAGCAGCAGACAGG + Intergenic
1196838395 X:119834926-119834948 CTGGAGATTCAGCAGCAGAAAGG - Exonic
1197609520 X:128623091-128623113 CTGGGTGGCCAGCTGCAGAGAGG - Intergenic
1197906359 X:131429152-131429174 CCAGCAGACCAGCAGCAGAGGGG + Intergenic
1197952100 X:131908425-131908447 CAGGACGACCAGCTACAGAGGGG + Intergenic
1198511678 X:137358266-137358288 GTAGAGGACCTTCAGCAGAGGGG - Intergenic
1199129999 X:144174011-144174033 CTGGGGGACCAGAAAGAGAGTGG + Intergenic
1199359992 X:146906947-146906969 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1199861081 X:151801074-151801096 GAGGATGACCAGCTGCAGAGAGG - Intergenic
1201688703 Y:16737337-16737359 CTAGCAGACCTGCAGCAGAGGGG - Intergenic
1202124604 Y:21557021-21557043 CAGGAAGACCAGGAGAAGAGGGG - Intergenic
1202152564 Y:21856629-21856651 CTGTGGGAGCAGCAGCATAGTGG - Intergenic
1202154404 Y:21872359-21872381 CAGGAAGACCAGGAGAAGAGGGG + Intergenic