ID: 1106311654

View in Genome Browser
Species Human (GRCh38)
Location 13:28560016-28560038
Sequence GGATGAACACAATATGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106311654_1106311662 10 Left 1106311654 13:28560016-28560038 CCCAGCCCATATTGTGTTCATCC 0: 1
1: 0
2: 0
3: 16
4: 123
Right 1106311662 13:28560049-28560071 TGTGAAGTGGCACCTTATTGTGG 0: 1
1: 6
2: 100
3: 650
4: 3041
1106311654_1106311658 -3 Left 1106311654 13:28560016-28560038 CCCAGCCCATATTGTGTTCATCC 0: 1
1: 0
2: 0
3: 16
4: 123
Right 1106311658 13:28560036-28560058 TCCACCCATCTGTTGTGAAGTGG 0: 1
1: 0
2: 0
3: 4
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106311654 Original CRISPR GGATGAACACAATATGGGCT GGG (reversed) Intergenic
901830522 1:11889169-11889191 GGAAGAACACATTAGGGGCTTGG + Intergenic
907323499 1:53620359-53620381 GGGTGAACAGAAAATGGGCGGGG + Intronic
907477024 1:54712640-54712662 GGATGAGTTCAATATGGGCATGG + Intronic
907655872 1:56341441-56341463 GGATAAAGAAAATGTGGGCTGGG + Intergenic
908694077 1:66817275-66817297 AGATGTACAGAATCTGGGCTAGG + Intronic
910585136 1:88871195-88871217 ATAAGAAGACAATATGGGCTGGG - Intronic
916811496 1:168309401-168309423 GGATAAAGACATTATGGCCTGGG + Intronic
918971831 1:191430037-191430059 TGACGAAGACAAAATGGGCTTGG - Intergenic
920147156 1:203872003-203872025 GGATTAAGGCATTATGGGCTGGG + Intergenic
922974213 1:229770120-229770142 AGATGAAAACAATAGGCGCTGGG - Intergenic
1064341786 10:14492478-14492500 AGATTAACACAATATTGGCCGGG + Intergenic
1064513801 10:16124383-16124405 GGAGGAACACAAGTTGAGCTTGG - Intergenic
1065770069 10:29069839-29069861 GGATGGACACAATTTAGGCTGGG + Intergenic
1067916896 10:50409464-50409486 GTATGAAAACCATATGGTCTTGG - Intronic
1068479934 10:57577856-57577878 GGATGAAAACAAAATGGTGTTGG - Intergenic
1070665140 10:78337355-78337377 GGGTCAAGACAATATGGGCTTGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072959626 10:99917668-99917690 GGATGAAGAAAATAGGGGCTGGG + Intronic
1075203747 10:120428601-120428623 GGATGAAGACAATCTGGTCATGG - Intergenic
1077347818 11:2072402-2072424 GGATGAGCACAAGGTGCGCTGGG + Intergenic
1077380792 11:2236389-2236411 AGATGACCACAGGATGGGCTGGG - Intergenic
1077400997 11:2357363-2357385 AGATGACCACAGGATGGGCTGGG - Intergenic
1078882076 11:15461819-15461841 GGATGAAAAATATATTGGCTGGG - Intergenic
1080941100 11:36919264-36919286 GGGAGGAAACAATATGGGCTTGG + Intergenic
1081299865 11:41437740-41437762 AGATAATTACAATATGGGCTGGG + Intronic
1083811708 11:65110114-65110136 GGATGAAGACCAAACGGGCTGGG + Intronic
1087709750 11:101534865-101534887 AAATGAACACAAACTGGGCTGGG + Intronic
1088272577 11:108049635-108049657 GGATAAACAATATATGGGCCAGG - Intronic
1092631551 12:10383534-10383556 AGATGAATACAATAAGGGCAGGG + Intronic
1093036775 12:14339327-14339349 GGAAGAAAAAAAAATGGGCTTGG + Intergenic
1095486019 12:42685473-42685495 AGATGAAAACAATTTGGGGTCGG + Intergenic
1102593276 12:113973547-113973569 AAATGAATACAATATGGGCTTGG - Intergenic
1106311654 13:28560016-28560038 GGATGAACACAATATGGGCTGGG - Intergenic
1112233627 13:97614287-97614309 GGATGATACCACTATGGGCTTGG + Intergenic
1112254261 13:97815084-97815106 AGATCAAGAAAATATGGGCTTGG + Intergenic
1116264228 14:42665829-42665851 AAATGAACAAAATATTGGCTGGG - Intergenic
1117673476 14:58131860-58131882 GGATTAATACAATATGGGAAAGG - Intronic
1118310870 14:64692142-64692164 GGATAAAGAAAATATGGGCCAGG - Intergenic
1119552948 14:75529336-75529358 GTATAAATACAAAATGGGCTGGG + Intronic
1126061759 15:44789648-44789670 GGATTAACACTTTATGTGCTAGG + Intergenic
1126247576 15:46527338-46527360 AGATTAACACATTCTGGGCTGGG + Intergenic
1128028435 15:64459668-64459690 GGAAGGACATAATAGGGGCTAGG + Intergenic
1131000394 15:88935284-88935306 GAATGAACACAGTAGGGGTTAGG - Intergenic
1132484925 16:185890-185912 CCATGAACACAACGTGGGCTTGG + Intergenic
1133356711 16:5142156-5142178 GGAAGAACACAGTCTTGGCTAGG + Intergenic
1134562387 16:15221783-15221805 GGATGAACAAAATGTGGTCTAGG + Intergenic
1134922928 16:18133410-18133432 GGATGAACAAAATGTGGTCTAGG + Intergenic
1137760918 16:50939582-50939604 GGATCAACACACTAAGAGCTTGG - Intergenic
1137889961 16:52149108-52149130 TGATGAAGACAAAATGGGTTGGG - Intergenic
1142660794 17:1427926-1427948 GAATAAAGACAATATAGGCTGGG - Intronic
1143267218 17:5648090-5648112 AGAAAAACACAAAATGGGCTGGG - Intergenic
1147365787 17:39958292-39958314 GGATGAAGACAGGCTGGGCTGGG - Intergenic
1147549314 17:41427893-41427915 GGATAAAGACACTGTGGGCTGGG - Intergenic
1148859754 17:50598322-50598344 GGATAAAGAAAATATGGGCCAGG - Intronic
1151872474 17:76845681-76845703 GTATGCAAACAATATGGGTTAGG - Intergenic
1152255308 17:79235545-79235567 GGATGAGCCCAAAATGTGCTGGG - Intronic
1152317083 17:79587447-79587469 GGATGAAAACAGCAGGGGCTGGG - Intergenic
1154219528 18:12440160-12440182 AGATGCACAGAATATCGGCTTGG - Intergenic
1156765580 18:40650929-40650951 GAATGAATAAAATATGTGCTTGG - Intergenic
1157719080 18:49909673-49909695 GGATGAACACAATAAAGGAAGGG + Intronic
1160196569 18:76759975-76759997 GGAGGAAAACAAAATGGGTTTGG + Intergenic
1166145230 19:40829763-40829785 GGATAAAGAAAATGTGGGCTGGG - Intronic
1166209310 19:41295907-41295929 GATTGTACACAATATGAGCTGGG - Intronic
1166589818 19:43986742-43986764 GGATGATAACAATGGGGGCTGGG - Intronic
928043765 2:27906335-27906357 GGTAGAAAAGAATATGGGCTGGG - Intronic
929187429 2:39109770-39109792 GCATGTACACAATATTGCCTAGG + Intronic
930301429 2:49620686-49620708 TGATGAGAACAATATGGCCTAGG + Intergenic
930949722 2:57125981-57126003 GCTTAAACACAATATTGGCTAGG - Intergenic
935190964 2:100778602-100778624 CTATGAAAACAATATGGTCTAGG + Intergenic
935946644 2:108292881-108292903 GGGTAAACAAAATATAGGCTGGG + Intronic
937364165 2:121248917-121248939 GGAAGAACCCAATGTGGCCTGGG + Intronic
938116496 2:128606157-128606179 GGATGAAGAGAATGTGTGCTGGG + Intergenic
938867849 2:135442819-135442841 GGATAAAGAAAATGTGGGCTGGG + Intronic
938997497 2:136696082-136696104 TGATGTACACAGTTTGGGCTTGG + Intergenic
941126931 2:161595415-161595437 GGATGAACTCATTTTGGGCTTGG + Intronic
946276187 2:218633609-218633631 GGCTGGACACAAGATGGGCTTGG - Exonic
946877698 2:224146510-224146532 TGATGAACACACAATGGCCTCGG + Intergenic
947625805 2:231617797-231617819 GGAGGAAAACAATAGGTGCTGGG + Intergenic
948396018 2:237645572-237645594 GGATGAAAACAAGATATGCTTGG + Intronic
1169087515 20:2836479-2836501 GAAGGAACACACTTTGGGCTTGG - Intronic
1170156768 20:13276054-13276076 GAAAGAACACAAAATGGACTAGG - Intronic
1172884878 20:38224211-38224233 TGATAAACACAGTATGGGCTGGG - Intronic
1174209214 20:48863876-48863898 GAAATAAGACAATATGGGCTGGG - Intergenic
1178750147 21:35295016-35295038 GGATGAAAACAGTTTGGGTTTGG - Intronic
1181573590 22:23780705-23780727 GGATGACCAGGGTATGGGCTGGG + Exonic
952672263 3:35984176-35984198 GGAAAAATACAATATGGGCTTGG + Intergenic
954652893 3:52176082-52176104 GGACGAGCACAAAATGGACTCGG + Intergenic
954814110 3:53266973-53266995 GGATAAAGAAAATTTGGGCTGGG + Intergenic
955114628 3:55985205-55985227 GGAAGAAGAAATTATGGGCTTGG + Intronic
957147417 3:76442241-76442263 AGATGAACACAATATATCCTCGG - Intronic
958946653 3:100369966-100369988 GGGTTAACTGAATATGGGCTAGG - Intronic
963253929 3:143125830-143125852 GCATGAACACCATAAGGGCGGGG + Intergenic
964350558 3:155799391-155799413 GGATAAAGAAAATGTGGGCTGGG + Intronic
966149070 3:176846538-176846560 GGATAAACTCAGTATGTGCTTGG - Intergenic
969875503 4:10133073-10133095 GGATGGACACAAGGTGGCCTTGG + Intergenic
976944682 4:90749659-90749681 GGATTAACAAAATGTGGGGTAGG - Intronic
976978703 4:91196553-91196575 GGATTAACAGAGTATGGGCAGGG - Intronic
977854454 4:101872608-101872630 GGAGAAACACAGTGTGGGCTAGG - Intronic
981131906 4:141166436-141166458 GGATGAACATAAAATGAGTTAGG - Intronic
981221724 4:142244596-142244618 GGATGAAGAAAATGTGGGCTGGG - Intronic
984219202 4:176952801-176952823 GGATGAAGACAATCTAGGTTTGG - Intergenic
987091965 5:14516231-14516253 GGATAAAGAAAATCTGGGCTGGG + Intronic
987792741 5:22589084-22589106 GGCTGTTCCCAATATGGGCTTGG + Intronic
988488306 5:31685814-31685836 GTTTGAAAATAATATGGGCTGGG - Intronic
991124524 5:63054315-63054337 GGATGAAGCCAATATGGGAATGG - Intergenic
999983659 5:156982593-156982615 GGATAAAGAAAATGTGGGCTGGG + Intergenic
1000346542 5:160319274-160319296 GGTTAAAAACAACATGGGCTGGG - Intronic
1007794661 6:44337772-44337794 GGTTTAACCCAATATGGACTAGG - Intronic
1010945214 6:81966072-81966094 GGAAGAACACAACATGGGGATGG + Intergenic
1011466671 6:87665084-87665106 GCATGAACACAGAATTGGCTTGG - Intronic
1017565072 6:155675034-155675056 GGATGCACAGAGCATGGGCTAGG + Intergenic
1019923383 7:4177051-4177073 GCCTGAACACAACATAGGCTCGG - Intronic
1020865633 7:13557630-13557652 GGATGTTCAAAATAGGGGCTGGG + Intergenic
1021745695 7:23738844-23738866 GGATAAAGAAAATGTGGGCTGGG - Intronic
1022301475 7:29106324-29106346 GTATGAACACAATATACCCTAGG - Intronic
1024599064 7:50963544-50963566 GGATGGAAAGAATATGGGCTTGG + Intergenic
1030952443 7:115808149-115808171 GGATGCACAGAATATGGGATGGG - Intergenic
1031512562 7:122668111-122668133 GGTGGAAAACAATAAGGGCTAGG + Intronic
1032396562 7:131594151-131594173 GGATAAATAAAATGTGGGCTGGG - Intergenic
1037592044 8:20321131-20321153 GGTTGAACATAATTTGGGATGGG - Intergenic
1037751982 8:21688551-21688573 GTATTAACACAGTATGGGCCAGG + Intergenic
1039676314 8:39671936-39671958 AGAGGAACACAACATGGGATGGG + Intronic
1039821459 8:41138920-41138942 GGATCAGCACACTATGGTCTTGG - Intergenic
1041993751 8:64027824-64027846 GGATGGACACAATTTGGGATAGG - Intergenic
1046645983 8:116786125-116786147 GGTTGAAAACAGAATGGGCTAGG + Intronic
1048754167 8:137716900-137716922 GGTTGAACACAATACAGGCGTGG - Intergenic
1055041785 9:71882358-71882380 GGATAAACAAAATGTAGGCTGGG + Intronic
1055123613 9:72692388-72692410 AGATGAACACAAAATCAGCTAGG - Intronic
1057483135 9:95461428-95461450 GGATGAGCAGAATTTGGGGTAGG - Intronic
1057532328 9:95861253-95861275 GGAAGAACACAAGATGAACTAGG - Intergenic
1057865628 9:98678233-98678255 GGATGAAAACAATATGATCAAGG - Intronic
1060585623 9:124783505-124783527 AGATGCACTCAATATGTGCTAGG + Intronic
1186238044 X:7534961-7534983 GGGTAGACACAACATGGGCTGGG - Intergenic
1186291844 X:8108809-8108831 GGTGGAACACAATATGAGCTAGG - Intergenic
1188532397 X:31156655-31156677 TATTGAACACAGTATGGGCTGGG - Intronic
1188984350 X:36756059-36756081 GGATGAAGATAATGGGGGCTGGG - Intergenic
1191218047 X:57953236-57953258 GGATGAATACCATATGGTCATGG + Intergenic
1192076838 X:68007591-68007613 GGATAAACACTATAGGGGCCAGG - Intergenic
1192726692 X:73761313-73761335 GGATAAAGAAAATGTGGGCTGGG - Intergenic
1197839908 X:130735137-130735159 GGCTGAACACAAAATGTACTTGG - Intronic