ID: 1106314416

View in Genome Browser
Species Human (GRCh38)
Location 13:28580459-28580481
Sequence ATGAATTGGTTTGGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 378}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106314407_1106314416 -1 Left 1106314407 13:28580437-28580459 CCCAGGGACTCCTAGGGAATCCA 0: 1
1: 0
2: 0
3: 14
4: 144
Right 1106314416 13:28580459-28580481 ATGAATTGGTTTGGGGTGGAAGG 0: 1
1: 0
2: 3
3: 32
4: 378
1106314403_1106314416 8 Left 1106314403 13:28580428-28580450 CCGGAGTTCCCCAGGGACTCCTA 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1106314416 13:28580459-28580481 ATGAATTGGTTTGGGGTGGAAGG 0: 1
1: 0
2: 3
3: 32
4: 378
1106314406_1106314416 0 Left 1106314406 13:28580436-28580458 CCCCAGGGACTCCTAGGGAATCC 0: 1
1: 0
2: 0
3: 16
4: 159
Right 1106314416 13:28580459-28580481 ATGAATTGGTTTGGGGTGGAAGG 0: 1
1: 0
2: 3
3: 32
4: 378
1106314408_1106314416 -2 Left 1106314408 13:28580438-28580460 CCAGGGACTCCTAGGGAATCCAT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1106314416 13:28580459-28580481 ATGAATTGGTTTGGGGTGGAAGG 0: 1
1: 0
2: 3
3: 32
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106314416 Original CRISPR ATGAATTGGTTTGGGGTGGA AGG Intergenic
900009420 1:92226-92248 CTGCATTGGTTTGGTCTGGAAGG + Intergenic
900025530 1:268802-268824 CTGCATTGGTTTGGTCTGGAAGG + Intergenic
900029134 1:358169-358191 GTGCATTGGTTTGGTCTGGAAGG + Intergenic
900049739 1:586941-586963 GTGCATTGGTTTGGTCTGGAAGG + Intergenic
904203162 1:28835015-28835037 ATGAGTGGGTGTGGGGTAGAGGG + Intronic
904618509 1:31762599-31762621 ATGGGTTGGGGTGGGGTGGAGGG - Intronic
906275242 1:44510379-44510401 AGGAACAGGTTTGGGGAGGAAGG - Intronic
908308376 1:62849266-62849288 ATGAATTGTTTGGGAGGGGAAGG + Intronic
908897734 1:68919317-68919339 ATAAATTGGCTTGGGAAGGAAGG - Intergenic
909372657 1:74902044-74902066 ATGAACTGTTGTGGGGTGGGGGG + Intergenic
910048166 1:82943077-82943099 ACGATTTTGTTTGGGCTGGACGG + Intergenic
910173636 1:84404401-84404423 ATGTATTGTTTTGGGCTTGATGG + Intronic
911062824 1:93762617-93762639 ATGATTGGGTTCGGGGTGAAGGG - Intronic
912655947 1:111486543-111486565 ATGAATGGGCTTGGGGCGGTGGG - Intronic
913248565 1:116892133-116892155 GTGAATTTGTGTGGGGGGGAGGG - Intergenic
914422258 1:147540291-147540313 AGGAATTTGATTGGTGTGGAGGG - Intergenic
914447970 1:147766243-147766265 ACTAAGGGGTTTGGGGTGGAGGG - Intronic
916884603 1:169054809-169054831 ATAAATTGGTTTGGTGGGGGTGG + Intergenic
917633996 1:176917573-176917595 ATGCATTGCTTTGGGAGGGAAGG + Intronic
918000266 1:180487409-180487431 ATGCAGTGGGTTGGAGTGGAGGG - Intronic
918193210 1:182196442-182196464 ATTAATTGGTTTTTGGTTGATGG - Intergenic
918609941 1:186477790-186477812 ATGAATTGGTTGAGGGCAGAAGG + Intergenic
919331199 1:196174341-196174363 ATGTATTGTTTTGGGCTTGATGG - Intergenic
919897928 1:202020984-202021006 ATGAAGTGGGTTGGGGGGGATGG + Intergenic
921023957 1:211260206-211260228 TGGGCTTGGTTTGGGGTGGACGG + Intronic
921705079 1:218313300-218313322 GTAAATTGGGTTGGGGTGAAGGG + Intronic
922358911 1:224803117-224803139 ATGGATTGGTTTGGGATGGAAGG - Intergenic
923418985 1:233793827-233793849 ATTAATTGCTTTGGGCTGTATGG - Intergenic
923811080 1:237316889-237316911 GTGAATTGGTTTGTGGTTGTTGG - Intronic
924654479 1:245961003-245961025 CTGAATTGATTTGGGGGAGAAGG - Intronic
1066340567 10:34528935-34528957 AGGACTTGGTATGTGGTGGATGG + Intronic
1066680155 10:37930317-37930339 ATGAATTACTGTAGGGTGGAAGG + Intergenic
1066742575 10:38574229-38574251 ATGCAATGGTATGGGCTGGAAGG + Intergenic
1068183043 10:53546723-53546745 ATGCATTGGTTTGGCCTGGAAGG - Intergenic
1069095106 10:64249731-64249753 ATGATTTGATTTAGGGTGTATGG - Intergenic
1069919551 10:71808126-71808148 ATGAATAGGATTGGTGTGGCTGG - Intronic
1070326216 10:75390960-75390982 ATGCATTGGTTGGGGGTGGGAGG + Intergenic
1070423129 10:76257827-76257849 CTGACTTGGTTGGGGCTGGATGG + Intronic
1071040448 10:81302674-81302696 ATGAATTGATTTGGGCAGTATGG - Intergenic
1072378955 10:94847229-94847251 AGGGACTGTTTTGGGGTGGAGGG - Intronic
1072466204 10:95664744-95664766 ATGAATTGGTGGGTGGTGGAAGG - Intronic
1072683043 10:97520567-97520589 ATGAATTATTTTGGAATGGAGGG + Intronic
1073129333 10:101176838-101176860 AAGCACTGGTTGGGGGTGGAGGG - Intergenic
1074940866 10:118235001-118235023 ATGGAGTTGTTTGGGCTGGAAGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076083649 10:127606131-127606153 AAGAATTGTGTTGGGGTGGAGGG + Intergenic
1077150268 11:1070032-1070054 ATGAATGGGTCAGGGATGGATGG - Intergenic
1078411357 11:11122470-11122492 GTGAATGGGTTTGGAGTGGTGGG - Intergenic
1078591184 11:12641513-12641535 ATGAATAGGGTTGGGGTGGGTGG - Intergenic
1079048965 11:17136205-17136227 ATGAGTTGGTTTGGGGTTTAAGG - Intronic
1079667852 11:23130430-23130452 ATGAATTGCTTTGGGGAGTATGG + Intergenic
1079720150 11:23800913-23800935 ATGAAGTGGTTAGGGTTGGAAGG + Intergenic
1080205987 11:29729910-29729932 GTAAATTGCTTTGGGGAGGATGG - Intergenic
1080321614 11:31016540-31016562 ATGACTTGGGTTGCGGTGGGTGG + Intronic
1080329902 11:31124348-31124370 ATAAATTGCTTTGGGGAGTATGG - Intronic
1080887327 11:36378139-36378161 GTAAATTGCTCTGGGGTGGAAGG + Intronic
1084570275 11:69955544-69955566 AAGCTTTGGTATGGGGTGGAAGG + Intergenic
1084647927 11:70471441-70471463 AGGTATTGTTATGGGGTGGAGGG + Intronic
1085857485 11:80191899-80191921 ATCAAATGCTTTGGGATGGAGGG - Intergenic
1086022675 11:82250740-82250762 GTGAATTGCTTTGGCATGGATGG - Intergenic
1087337988 11:96867836-96867858 ATGAATTGGTGGGGCCTGGATGG + Intergenic
1088213324 11:107480630-107480652 ATAGAATGATTTGGGGTGGAAGG - Intergenic
1088671048 11:112140951-112140973 ATGCATTATTTTGGGGTTGAGGG - Intronic
1088946777 11:114521838-114521860 AAGAATCTGTTTGGGGAGGAAGG - Exonic
1089793540 11:120961985-120962007 ATCAATTGGTTTAGGGTGGATGG + Intronic
1090056481 11:123429237-123429259 ATGCATTGGGCTGGGGTTGAAGG + Intergenic
1090171967 11:124613208-124613230 ATAAATGGGTTAGGGGTGGTGGG - Intronic
1090405900 11:126475685-126475707 ATGAAAGGGTGTGGGGTGGGCGG - Intronic
1092058286 12:5524745-5524767 AGGAATTGGGGTGGGGGGGATGG + Intergenic
1092679062 12:10956978-10957000 ATAAATTGGTTTGGGCAGTATGG - Intronic
1092938113 12:13382851-13382873 ATGTATTGCCTTGGGGTGGGTGG + Intronic
1093485029 12:19642922-19642944 ATGGATTGGGATGGGGTGAAGGG - Intronic
1094066019 12:26361421-26361443 ATGCAATGGGGTGGGGTGGAGGG - Intronic
1094245537 12:28287777-28287799 ATGAATTGCTTTGGGCAGTATGG + Intronic
1094469044 12:30785792-30785814 ATGCATTTGTTTGGGGTGGGTGG + Intergenic
1094769628 12:33639163-33639185 ATGACTTGCTTTGGGGGAGAGGG - Intergenic
1095251686 12:39986250-39986272 ATGAATTGGGGTGGGGAGTAGGG + Intronic
1096193540 12:49634716-49634738 ATAGATTGGGTTGGGGTGCAAGG + Intronic
1096600634 12:52726162-52726184 ATGAGTTGGCTTAGGGTGGAAGG - Intergenic
1097020315 12:56016151-56016173 AAGAATTGGGTGGGGGTGGGGGG + Intronic
1097956306 12:65489124-65489146 CAGAATTTGTTTGGGGTGGCAGG - Intergenic
1098073861 12:66705471-66705493 ATGAATTGCTTTGGGCAGTATGG - Intronic
1098694898 12:73539909-73539931 ATTCTTTGATTTGGGGTGGAGGG - Intergenic
1098920148 12:76295328-76295350 ATGAAAAGGTTTGGGATGCAGGG - Intergenic
1099563988 12:84216884-84216906 ATGAATGGGTTTGGGGGTTATGG + Intergenic
1099713676 12:86264014-86264036 ATTACTTGTTTTGGGGTGGGGGG + Intronic
1100920678 12:99482604-99482626 ATGAATTGCTTTGGGCAGTATGG + Intronic
1101704299 12:107207078-107207100 AGGATTTGATTTGGGGTTGAGGG - Intergenic
1103168743 12:118794690-118794712 ATGAATTGTTTTGGGCAGTATGG + Intergenic
1103580131 12:121908725-121908747 CTGATTTGGTTTGGGATTGAAGG + Intronic
1103681810 12:122700166-122700188 ATGAGGTGGTTTGGGGTGTTTGG - Intergenic
1103683559 12:122713630-122713652 ATGAGGTGGTTTGGGGTGTTTGG - Intergenic
1106041224 13:26095878-26095900 ATGAAATGCTTTTGTGTGGAAGG + Intergenic
1106314416 13:28580459-28580481 ATGAATTGGTTTGGGGTGGAAGG + Intergenic
1107288582 13:38824963-38824985 AAGAAAAGGTTGGGGGTGGAGGG + Intronic
1107876759 13:44797597-44797619 ATGAATTTTTTTGGTGGGGAGGG - Intergenic
1108582363 13:51838279-51838301 ATGAATTGGTAAGGAATGGAAGG + Intergenic
1109051997 13:57494933-57494955 ATGAATTTTTTTGGGGGGGCGGG - Intergenic
1109462013 13:62673198-62673220 ATAAATTGCTTTGGGGAGTATGG + Intergenic
1109593131 13:64513502-64513524 ATAAATTGCTTTGGGGAGTATGG + Intergenic
1109761993 13:66842800-66842822 ATGAATTGGATGAGGGTGAAGGG + Intronic
1110980968 13:81897806-81897828 ATAAATTGCTTTGGGGAGTAGGG - Intergenic
1111525243 13:89459865-89459887 ATAAATTGCTTTGGGGAGTATGG + Intergenic
1111798884 13:92958362-92958384 ATGAAACTGTTAGGGGTGGAAGG - Intergenic
1111832901 13:93352630-93352652 ATCAATTTGGTTGGGTTGGAGGG + Intronic
1111868636 13:93801844-93801866 ATGAATTGGTTAAGCATGGAAGG - Intronic
1113158584 13:107353327-107353349 ATGCAATGGTTTAGGGTTGAAGG - Intronic
1115689470 14:35827856-35827878 AGAATTTGGTTTGGGGTGGTGGG + Intronic
1117553110 14:56856181-56856203 ATTGATTGGGTTGGGCTGGAGGG - Intergenic
1117851183 14:59971505-59971527 ATAAATTGGTTTGGGCAGTATGG + Intronic
1117918770 14:60705835-60705857 GTAAATTGCTCTGGGGTGGAGGG + Intergenic
1117959544 14:61149154-61149176 CTGAACCTGTTTGGGGTGGAGGG - Intergenic
1118093189 14:62505876-62505898 ATAAATTGCTTTGGGGTGTATGG - Intergenic
1118911260 14:70063917-70063939 GTGAATTGTTTTGCTGTGGATGG + Intronic
1121162432 14:91756639-91756661 TTGAAGTGGTTGGGGGTGGTGGG + Intronic
1121930972 14:97971895-97971917 TTCAATGGGTTTGTGGTGGAGGG + Intronic
1122967866 14:105139612-105139634 ATGACTGAGTATGGGGTGGAGGG + Intergenic
1125709839 15:41775528-41775550 ATGATTTGGTTTTAGGTTGAAGG + Intronic
1126506825 15:49414421-49414443 CTCACTTGGTTTGGGGTGTAGGG - Intronic
1127102884 15:55585803-55585825 ATAAATTGTTTTGGGGTTAAAGG - Intronic
1128223979 15:65989065-65989087 ATGAATTGGTCTAGGGTGGTAGG + Intronic
1130967903 15:88710669-88710691 CTAAATTGGCTTGGGGAGGAGGG + Intergenic
1131467822 15:92669590-92669612 GTGAATTTGTATGGGGTGGTGGG - Intronic
1131501326 15:92969723-92969745 ATGAATTAGCTTGGTGTGGTTGG - Intronic
1131537679 15:93251471-93251493 ATGAATTGGGGTGGGGAGGGAGG - Intergenic
1133096941 16:3453862-3453884 ATGGATGGGGTTGGGGTGGGAGG - Intronic
1133906420 16:10026786-10026808 CTGCATTGTTTTGGGGTGGGAGG - Intronic
1133981100 16:10633861-10633883 ATGTGTTGGGGTGGGGTGGAGGG - Intronic
1134750861 16:16623963-16623985 ATTAATGGGTTTGGGGGGGTGGG - Intergenic
1134994593 16:18729628-18729650 ATTAATGGGTTTGGGGGGGTGGG + Intergenic
1137398641 16:48135078-48135100 ATGTATTGGTTTGGCCTGAAAGG - Intronic
1140093659 16:71857005-71857027 AAGAAATGGTATTGGGTGGAGGG - Exonic
1140637341 16:76930624-76930646 ATGAATTGTTTGGGGCTGGGAGG - Intergenic
1140827328 16:78718876-78718898 AAGAATTGGGGAGGGGTGGATGG + Intronic
1141392934 16:83679917-83679939 ATGCAATGGGTAGGGGTGGATGG + Intronic
1141487517 16:84350779-84350801 ATGAATGGGTGCGGGATGGAGGG - Intergenic
1142454910 16:90214674-90214696 CTGCATTGGTTTGGTCTGGAAGG - Intergenic
1143009243 17:3856897-3856919 CTGAATGGGGCTGGGGTGGAGGG + Intergenic
1145232744 17:21186471-21186493 ATGAGTTGGCTGTGGGTGGATGG - Intronic
1145335982 17:21912923-21912945 ATGAAATGGTTTGGAATGGAAGG + Intergenic
1146506409 17:33409582-33409604 ATGAATTAATTGGTGGTGGAGGG - Intronic
1147052047 17:37802641-37802663 TTGATTGGGTTTGGTGTGGAGGG - Intergenic
1147225029 17:38969773-38969795 ATGGATTGGATATGGGTGGAAGG + Intergenic
1148763443 17:50021727-50021749 ATGAAGAGGATGGGGGTGGAGGG - Intergenic
1149448861 17:56733905-56733927 ATGAATGAGTTGGGGCTGGATGG - Intergenic
1149551699 17:57545326-57545348 ATGAATTGGAACTGGGTGGATGG + Intronic
1149660930 17:58333513-58333535 AGGAATGGGTTTGGGGAGGTAGG + Intergenic
1150485732 17:65542175-65542197 ATTCATTGGTTGGGGGTGGTAGG - Intronic
1150616625 17:66777427-66777449 ATGCTTTGATTTGGGGTGGGGGG - Intronic
1151581097 17:74979485-74979507 ATGAATTGGTTGGGGTTGGTGGG - Intergenic
1151932989 17:77244553-77244575 ATGGATTGTTTTGGGGTGAGGGG - Intergenic
1152002660 17:77656094-77656116 ATGAACAGGCTCGGGGTGGATGG + Intergenic
1152292745 17:79449458-79449480 ATGAATTGGATTAGGGTGTCTGG - Intronic
1152950624 17:83228387-83228409 GTGCATTGGTTTGGTCTGGAAGG - Intergenic
1153112445 18:1608337-1608359 ATGAATTGCTTTGGGAAGTATGG + Intergenic
1153409584 18:4778731-4778753 ATGACCTGCTTTGGGGTAGAGGG + Intergenic
1153452475 18:5244985-5245007 TTGAATTGTTTTGGGGTGGGGGG + Intergenic
1153466951 18:5398563-5398585 ACGGAAAGGTTTGGGGTGGAAGG + Intronic
1153659263 18:7312142-7312164 ATTAATTGTTTTGGGCTTGATGG + Intergenic
1154180355 18:12132769-12132791 ATTAATTGATTTGGGGGAGAAGG + Intergenic
1155386536 18:25283923-25283945 ATGAATTTTTTTGGGGGGGGGGG - Intronic
1157332391 18:46713357-46713379 ATGAACAGGTTTGGGGTGTTGGG + Intronic
1158928215 18:62293066-62293088 ATGAATTAGTTTGGCATGGCTGG - Intronic
1159540447 18:69767595-69767617 AAGAACTGATTTGGGGTGGGAGG - Intronic
1160074806 18:75663738-75663760 ATGAATTGGGTGGGAGTGAAAGG + Intergenic
1161853558 19:6751336-6751358 AGGACTGGGTTGGGGGTGGAGGG - Exonic
1162261556 19:9538537-9538559 ATGAACTGGTTTTGGGGTGAAGG - Intronic
1162306950 19:9880788-9880810 ATGAAGTGCTTTGGGCTGGGTGG - Intronic
1164893520 19:31846773-31846795 ATGTATTGCTTTGGGCTGGATGG + Intergenic
1166804294 19:45475959-45475981 ATGAGATGGGTTGGGGTGGGGGG - Intronic
1168206663 19:54855480-54855502 ATGAAGAGAGTTGGGGTGGAGGG + Intronic
1168503813 19:56916056-56916078 AGGAATTGGCATGGGCTGGACGG + Intergenic
925364933 2:3305082-3305104 CTGAACTGGTTGGGAGTGGAGGG - Intronic
925811322 2:7703644-7703666 GTGATCTGGTTTTGGGTGGATGG + Intergenic
926103012 2:10132632-10132654 CTGAAGTATTTTGGGGTGGATGG + Intergenic
926452221 2:13019098-13019120 ATGTATTGTTTTGGGCTTGATGG - Intergenic
926848376 2:17167360-17167382 ATAAATTGCTTTGGGCTGTATGG - Intergenic
927885021 2:26713022-26713044 ATGAATGGGTTGGGTGTGGTGGG - Intronic
928069231 2:28198100-28198122 TTGACTTGGTTTGGGGTAGAAGG + Intronic
929235252 2:39598220-39598242 ATGTGTTGGTTTGGGGTTGGTGG + Intergenic
930237625 2:48903057-48903079 ATGAATTGGTGTGAGAGGGAGGG + Intergenic
930478334 2:51913962-51913984 ATTTGTTGATTTGGGGTGGAGGG - Intergenic
930843528 2:55875617-55875639 ATGAATTGGCTTGTGGTTGACGG + Intronic
930874680 2:56201619-56201641 ATGAATTGCTTTTGGGGGCATGG + Intronic
931113463 2:59138735-59138757 ATGGGTGGGTTTGGGGTGGTTGG - Intergenic
932023945 2:68115080-68115102 AAGACTTGGCCTGGGGTGGAGGG - Intergenic
932988905 2:76762468-76762490 TTGAAGTAGTTTGGGGTGAAGGG - Intronic
935322423 2:101902106-101902128 ATGAATTGGGTCGGGGGAGAGGG - Intergenic
935591712 2:104851375-104851397 GTGACTGGGTTGGGGGTGGAGGG + Intergenic
936170470 2:110167533-110167555 AGGTATTGGTTGGGGGTGGCTGG - Intronic
936712196 2:115144163-115144185 AGGAATTGGTTGGGGGAGCATGG - Intronic
936862674 2:117036465-117036487 ATGAATTGCTTTGGGAAGTATGG - Intergenic
938549600 2:132367987-132368009 ATGAAGTGGTTTGGTGAGGGTGG + Intergenic
939988689 2:148856918-148856940 ATAAATTGCTTTGGGGAGTATGG - Intergenic
940686272 2:156855172-156855194 ATGAATTGGTAAGGGGAGCAAGG + Intergenic
943256728 2:185602988-185603010 ACGGATGGGGTTGGGGTGGAGGG - Intergenic
945389405 2:209245897-209245919 ATGAATTACTTTGGGCTGTATGG - Intergenic
945996952 2:216445555-216445577 AAGAATAGGTTTGGGGTGATGGG + Intronic
946348032 2:219126968-219126990 ATGGATGGGGTTGGGGAGGAGGG + Intronic
946517067 2:220424081-220424103 AAGAATTAGTTTGGATTGGATGG + Intergenic
947571513 2:231239137-231239159 AGGGATTGGTTTGTGGGGGAAGG + Intronic
949086375 2:242159341-242159363 CTGCATTGGTTTGGTCTGGAAGG - Intergenic
1168942125 20:1721635-1721657 AGGAATTTGTTCGGGGTGGGAGG - Intergenic
1169087597 20:2837059-2837081 GAGAGTTGATTTGGGGTGGAAGG - Intronic
1170259700 20:14390309-14390331 ATAAATTGGTTTGGGCAGTATGG - Intronic
1170398879 20:15958680-15958702 ATGAATTTGTTGGGGGTGGAGGG - Intronic
1171108979 20:22463249-22463271 TTGAATTGGTGTGGGCTGGGTGG - Intergenic
1171395634 20:24831172-24831194 ATGAACTTGGTGGGGGTGGAGGG - Intergenic
1171944167 20:31361306-31361328 ATAAATTGGATTGGGGGGGGGGG + Intergenic
1173592920 20:44239490-44239512 TTGAAGTGTTTTGGGGCGGAAGG + Intergenic
1173825038 20:46042825-46042847 AGGAGCTGGTTTGGGGTGGGTGG + Intronic
1174860225 20:54084437-54084459 ATGAATGGATGTAGGGTGGATGG - Intergenic
1174939481 20:54909095-54909117 GGGAGTTGGTTTGGGGTGGAAGG + Intergenic
1175591754 20:60198866-60198888 TTCTATTGTTTTGGGGTGGAGGG + Intergenic
1177131247 21:17258647-17258669 ATGAGTTGTTTTGTGGAGGAAGG + Intergenic
1177182532 21:17758552-17758574 ATGATTTGATTTGGGGTAGAGGG - Intergenic
1177211790 21:18080911-18080933 ATGAATTGCTTTGGGCAGTATGG + Intronic
1178502487 21:33137308-33137330 AATGATAGGTTTGGGGTGGAAGG + Intergenic
1180566279 22:16668760-16668782 ATTAATTGATTTGGGGGAGAAGG - Intergenic
1180741263 22:18054733-18054755 ATAAATGGGTTTGGAGTGGTAGG - Intergenic
1181496537 22:23290416-23290438 AAGTACTGGTTTGGGGAGGAGGG + Intronic
1181930467 22:26396587-26396609 AGAAATTGGCTTGGGGTAGAGGG + Intergenic
1182073327 22:27478312-27478334 TTGGATTGGTTTGGTTTGGATGG + Intergenic
1182745216 22:32600531-32600553 ATGAGTAGGTTGTGGGTGGATGG + Intronic
1182748863 22:32626083-32626105 AGGAAATGGTTGGGGGTAGAGGG + Intronic
1183002078 22:34869005-34869027 ATGAATTGTTTTGGGATGACAGG + Intergenic
1183023255 22:35044188-35044210 ATGAATTTGCTGGGGTTGGAGGG - Intergenic
1183203019 22:36399221-36399243 ATGAGTTGGATTGGGGAGGGAGG - Intergenic
1184342299 22:43892529-43892551 ATGGATTGATTAGGGGAGGAGGG - Intergenic
1185043703 22:48518384-48518406 CTGCCTTGGTTTGGGGAGGACGG - Intronic
1185189118 22:49422901-49422923 AGGAGTTGGTTAGGGGTGGAAGG - Intronic
1185301683 22:50084253-50084275 AGGAACAGGTCTGGGGTGGACGG - Intronic
1203301849 22_KI270736v1_random:82599-82621 ATGGAATGCATTGGGGTGGAAGG + Intergenic
949293039 3:2487452-2487474 AATAATTGTTGTGGGGTGGATGG - Intronic
949585008 3:5428656-5428678 GTGCAATGGTTTAGGGTGGAGGG + Intergenic
951099243 3:18667600-18667622 AAGAATTTTTTTGGGGGGGATGG - Intergenic
951859372 3:27234679-27234701 ATGAATTGCTTTGGGCAGTATGG - Intronic
953095635 3:39772488-39772510 ATGAATGGGAATGGGGTAGAAGG + Intergenic
953249286 3:41229281-41229303 GTGAATTGCTTTGGGCTGTATGG + Intronic
954110653 3:48431006-48431028 ATGAATGGATTTGGGGAGGGAGG - Intergenic
954516584 3:51183409-51183431 TTGAAATGGTTGGGGGTGGGGGG + Intronic
955262685 3:57409867-57409889 ATAAATTGGTGTGGGGAGAATGG + Intronic
956470490 3:69561472-69561494 ATGAAGGGGTTTTGGGTGTAAGG - Intergenic
956953856 3:74314018-74314040 ATGAATGGGGTTGGAGTTGAAGG - Intronic
957658256 3:83111046-83111068 ATGAATTGCTTTGGGCAGTATGG - Intergenic
958901619 3:99893842-99893864 ACGTCTTGGGTTGGGGTGGAGGG - Intronic
963388474 3:144627200-144627222 CTGAATTGCTTTGGAGTGGAGGG + Intergenic
964070835 3:152631157-152631179 ATGAATTGCTTTGGGTAGTATGG + Intergenic
964614263 3:158645131-158645153 ATGAATTGTTTTTGTTTGGAGGG + Intronic
965081228 3:164035149-164035171 ATGAAATGGAGTGGGGTGTAGGG + Intergenic
967973027 3:195013127-195013149 ATGAAACCGTGTGGGGTGGAGGG - Intergenic
967982556 3:195074473-195074495 ATGAGCTCGTTTGGCGTGGAAGG + Intronic
968653775 4:1770122-1770144 ATGAAGTGTCTTGGGGTGGTGGG - Intergenic
968938795 4:3627296-3627318 GTGGTTTGGGTTGGGGTGGATGG + Intergenic
970186667 4:13462180-13462202 ATCAATTGGCTTGGGGTTCAGGG + Intronic
970390949 4:15613253-15613275 TTGAATTAGTCTGTGGTGGATGG + Intronic
971218856 4:24686724-24686746 AAGAATTGGCTGGGGGTGGTGGG + Intergenic
971823100 4:31585105-31585127 AGGAATTTGGGTGGGGTGGAGGG + Intergenic
972674469 4:41246122-41246144 ATGACTTGATTTGGAGTGAAGGG + Intergenic
973824514 4:54691734-54691756 ATGAGTTGGGGTGGGGTGGGTGG + Intronic
974281497 4:59800832-59800854 ATAAATTGTTTTGGGCTGTATGG + Intergenic
974717555 4:65689056-65689078 ATAATTTGGTTTGCAGTGGAAGG + Intergenic
974800096 4:66805780-66805802 ATTGATAGGCTTGGGGTGGATGG + Intergenic
976015946 4:80554574-80554596 ATGAATTGCTTTGGGCAGTATGG + Intronic
976589784 4:86837587-86837609 AAGAATAGATTTGGGATGGAAGG - Intronic
977517119 4:98034514-98034536 ATGAATTACTTTGGGCAGGATGG - Intronic
977796046 4:101166232-101166254 AACAATTGGTTTGAGGTGAAAGG - Intronic
977804599 4:101282021-101282043 AGGAAAAGGTATGGGGTGGAGGG - Intronic
979168565 4:117569648-117569670 ATGAATTGGTTTGGGGATTTAGG - Intergenic
980224232 4:129960340-129960362 ATGAATTGTTTTGGGCAGTATGG + Intergenic
980934629 4:139214443-139214465 ATGAATTTGTGAGGGGTGGTAGG + Intergenic
983928474 4:173428065-173428087 ATGCATATGTTTGGGGTGGAGGG + Intergenic
985773541 5:1827798-1827820 ATGAAGTGGTATGAGGAGGAGGG + Intergenic
986016202 5:3759457-3759479 ATCAATGGGGTTGGGGTGAAGGG + Intergenic
986328649 5:6701397-6701419 CTGAAGGGGTTTGGGGTGGCCGG + Intergenic
987209312 5:15663075-15663097 GTAAATTGGTTTGGGCTGCATGG + Intronic
987258724 5:16182343-16182365 TTGAATTGGGTTGGTGGGGATGG - Intergenic
989225320 5:39021250-39021272 ATTAACAGATTTGGGGTGGAGGG - Intronic
992581911 5:78187649-78187671 ATAAATTGCTTTGGGCAGGATGG - Intronic
993065730 5:83095369-83095391 GTTAAGTGGATTGGGGTGGATGG + Intronic
993225122 5:85159920-85159942 ATGAAATGGTTTTGGATGGGAGG + Intergenic
993365167 5:87026274-87026296 ATAAATTGTTTTGGGGAGTATGG + Intergenic
993740096 5:91528246-91528268 ATGGATTGGTCTGGTGTGGTGGG + Intergenic
993885060 5:93406438-93406460 ATTAATTGGTTTGGGGTCACTGG + Intergenic
995058917 5:107793024-107793046 ATGGATGGGATTGGGTTGGAAGG + Intergenic
995310128 5:110701035-110701057 ATCAAATGTTTTGGTGTGGAAGG - Intronic
995399689 5:111726918-111726940 ATCATCTGGTTTGGGGAGGACGG - Intronic
997571196 5:134928895-134928917 AGGAATGGGTTTGGGATGCAGGG + Intronic
998582603 5:143394922-143394944 ATGAATTAATTGGGGGTGGAGGG - Intronic
999678786 5:154035349-154035371 AGTAATTGCTTTGGGTTGGAAGG - Intronic
1000138139 5:158373791-158373813 AGGAACTAGTTTGGGGAGGAAGG + Intergenic
1000346218 5:160316236-160316258 TTGTCTTGGTTGGGGGTGGATGG - Intronic
1000351012 5:160352808-160352830 AGGAATTAGTTTGGTGTGGTAGG + Intronic
1001210634 5:169807153-169807175 CTGAATTGGTCTGGGGTGGGTGG + Intronic
1001881132 5:175245078-175245100 ATAAAATGGTGTGGGGAGGAGGG + Intergenic
1002326778 5:178414960-178414982 ATGAAGTGGAGTGGGGTGAAAGG + Intronic
1002744856 5:181462202-181462224 GTGCATTGGTTTGGTCTGGAAGG - Intergenic
1002816617 6:686881-686903 ATTTATTTGTTGGGGGTGGATGG - Intronic
1003100819 6:3175262-3175284 ATACATTGGTTTGGTCTGGAAGG + Intergenic
1004980346 6:21016555-21016577 ATGAATTGATTTAAGGAGGAGGG - Intronic
1005824921 6:29627120-29627142 TGGAATGGGTTGGGGGTGGAGGG - Intronic
1005860238 6:29895220-29895242 ATGATTTGGTTTGATGTGGTAGG - Intergenic
1005972942 6:30775664-30775686 ATAAATTGGTTTTGTCTGGAAGG + Intergenic
1006340695 6:33444959-33444981 ATAAATTGGATGGGGATGGAGGG + Intronic
1006920099 6:37622133-37622155 AGGTATTGGTTGGGGGAGGAGGG - Intergenic
1008335758 6:50302766-50302788 ATGAATTGCTTTGGGCGGTATGG + Intergenic
1008552221 6:52644261-52644283 AGGAATGGGCTTGGGGAGGAAGG - Intergenic
1008663228 6:53691035-53691057 ATGATTGGGATTGGGGTGGGTGG + Intergenic
1010107347 6:72185319-72185341 ATGAATTGTTTTGGGTCTGATGG - Intronic
1010412144 6:75572843-75572865 ATGAAATGATTTAGGGAGGAGGG - Intergenic
1010906303 6:81494319-81494341 ATTGATTGGTTTGGTGTGGGTGG + Intronic
1011852841 6:91652050-91652072 TAGAATGGGTTAGGGGTGGAAGG + Intergenic
1012399788 6:98834188-98834210 AAGACTTGGATTGGGGTGGGGGG - Intergenic
1012596861 6:101051629-101051651 TTCCATTGATTTGGGGTGGAGGG + Intergenic
1014293488 6:119588724-119588746 ATAAATTTGATTTGGGTGGAAGG - Intergenic
1014545445 6:122730020-122730042 ATGAGCTGGTTTGGGGAAGAGGG - Intergenic
1014928026 6:127297985-127298007 TTGAAATGGTCTGGGGTGAATGG - Intronic
1015025340 6:128525618-128525640 GTGAATTGGATTGAGGTGGAGGG + Intergenic
1015821590 6:137266953-137266975 ATGGATTGGTTTTGAGGGGATGG - Intergenic
1016286397 6:142478124-142478146 ATGAATTTGGTTGGGGCGGCAGG - Intergenic
1016420815 6:143881077-143881099 ATGAGTGGGAGTGGGGTGGAAGG - Intronic
1016568674 6:145488391-145488413 ATGAATTGCTTTGGGCTGTATGG + Intergenic
1016640181 6:146339272-146339294 GTGAATTGAGTTTGGGTGGAAGG - Intronic
1017401278 6:154066515-154066537 ATGATTTTTTTTGGGGGGGATGG - Intronic
1017560214 6:155619366-155619388 ATAATTTGGTTTGATGTGGAAGG + Intergenic
1018773708 6:166995095-166995117 AGGAATTTGTTTGGGCTTGATGG + Intergenic
1018871875 6:167790108-167790130 ATGACGGGGTATGGGGTGGACGG - Intronic
1019069145 6:169327221-169327243 ATGAATTAGTAGGGGGTGGCTGG - Intergenic
1019249767 6:170735743-170735765 GTGCATTGGTTTGGTCTGGAAGG - Intergenic
1020949287 7:14654453-14654475 ATAAATTGCTTTGGGTTGTATGG - Intronic
1021471790 7:21011387-21011409 ATGAATTGCTTTAGGCTGAATGG + Intergenic
1022774336 7:33509521-33509543 ATGGTTTGGTTGAGGGTGGATGG + Intronic
1023094358 7:36645123-36645145 AAGAATTTGGTTGGGGTGGGGGG - Intronic
1025708843 7:63890047-63890069 ATGATGGGGTTTGGGGAGGAAGG + Intergenic
1027298825 7:76808242-76808264 ATGAAATGATTTGGGGTAGTGGG - Intergenic
1027381158 7:77611354-77611376 ATTACTTGGGTGGGGGTGGAAGG - Intronic
1028118308 7:87027323-87027345 TTGAAATGATTTGGGGTGGGAGG - Intronic
1028561355 7:92179386-92179408 TTGAATTGGTCTGGGGGGGTCGG + Intronic
1029036449 7:97527385-97527407 ATGAATTTGTTGGGGGAGGGAGG - Intergenic
1030177423 7:106669269-106669291 GTGACTTGGTTTAAGGTGGAAGG - Intergenic
1030311087 7:108069858-108069880 ATGAATTGATTTGGGGAATAAGG + Exonic
1032342497 7:131088279-131088301 ATCAATTCATTTAGGGTGGATGG - Intergenic
1032526500 7:132581813-132581835 ATGAAAGGGTCTGGGGAGGAAGG - Intronic
1034700081 7:153088076-153088098 AGGAAATGGGGTGGGGTGGAGGG + Intergenic
1034717145 7:153254080-153254102 CTGAAGTGTTTTGGTGTGGAGGG + Intergenic
1035324243 7:158054713-158054735 AGGACTTGGTTTGGGGTAGGTGG - Intronic
1035334366 7:158116275-158116297 ATGAATTAGTTTTGGGAAGATGG + Intronic
1035498329 8:71913-71935 GTGCATTGGTTTGGTCTGGAAGG + Intergenic
1037601562 8:20400564-20400586 CTCCAGTGGTTTGGGGTGGAGGG + Intergenic
1038161558 8:25044260-25044282 AGGAATTGTTTAGAGGTGGAAGG + Intergenic
1038772259 8:30493984-30494006 ATTAATTGGGCTGGGGTGGATGG + Intronic
1040043029 8:42935966-42935988 ATAAATTGCTTTGGGCAGGATGG + Intronic
1041895967 8:62924996-62925018 ATGAATTGGTGGGGGTGGGAGGG + Intronic
1044682133 8:94792126-94792148 ATTTATGGGTTTTGGGTGGAAGG + Exonic
1044798701 8:95931357-95931379 TTCAGTTGATTTGGGGTGGAGGG + Intergenic
1046134877 8:110012549-110012571 ATAAATTGCTTTGGGCTGTATGG + Intergenic
1046619125 8:116509194-116509216 AGGAATTGGATTGGGAGGGAAGG + Intergenic
1046977880 8:120302815-120302837 GTAAATTGCTTTGGGGAGGATGG + Intronic
1048714783 8:137256282-137256304 ATGAATTAGGTGGAGGTGGATGG + Intergenic
1050609934 9:7341514-7341536 ATATATTGGTTGGGGGGGGAGGG - Intergenic
1051438749 9:17059837-17059859 ATGAGTTGGTTTGGTTTGGAAGG + Intergenic
1051835865 9:21336786-21336808 TTGAATGAGTTAGGGGTGGAAGG + Intergenic
1052014049 9:23444339-23444361 ATGAAGTGAGTTGGGGTGGGGGG - Intergenic
1052480861 9:29024022-29024044 GTGTATTGGTTGTGGGTGGAAGG - Intergenic
1052489339 9:29144336-29144358 ATAAATTGCTTTGGGCAGGATGG + Intergenic
1052842766 9:33307380-33307402 ATGTAATGGTTTGGGATGAAGGG + Intronic
1052978466 9:34429645-34429667 ATGACTAGGGTTGGGGTGGCAGG + Intronic
1053418797 9:37963728-37963750 ATGCATTGGTTTGGGAGGTAGGG + Intronic
1053593617 9:39536400-39536422 ATGACTTGCTTTGGGGAAGAGGG + Intergenic
1053851401 9:42291447-42291469 ATGACTTGCTTTGGGGAAGAGGG + Intergenic
1054572688 9:66828881-66828903 ATGACTTGCTTTGGGGAAGAGGG - Intergenic
1054959253 9:70949175-70949197 ATGAAATGGTATAGGGTGGGTGG + Intronic
1055460405 9:76514196-76514218 ATGAATTGCTTTGGGTAGTATGG + Intergenic
1055728354 9:79256023-79256045 ATCAATTGGTTTAGGGGGAAAGG + Intergenic
1055928749 9:81538185-81538207 TTGGCTTGGTTTGGGGTGAAGGG + Intergenic
1055947388 9:81703818-81703840 ATGAATGGGTAGGGGGTGGGAGG - Intergenic
1058167221 9:101633737-101633759 ATGGATGGGTTGGGGGTGGGTGG - Intronic
1058800591 9:108541208-108541230 TTGGATTGGTTTGCAGTGGAAGG - Intergenic
1059750110 9:117239588-117239610 ATGAATGGGGATGGGATGGAGGG - Intronic
1060069424 9:120533420-120533442 AGGAAATGTTTTTGGGTGGAGGG - Intronic
1203347495 Un_KI270442v1:45420-45442 ATGGATTGGAATGGAGTGGAGGG + Intergenic
1203610667 Un_KI270748v1:92681-92703 GTGCATTGGTTTGGTCTGGAAGG - Intergenic
1187294200 X:17983536-17983558 ATAAAATGGAATGGGGTGGAAGG - Intergenic
1188111759 X:26202410-26202432 GTGAATTGGTTTGGGCAGTATGG - Intergenic
1188793973 X:34440104-34440126 ATGAATTGCTTTGGGCAGTATGG - Intergenic
1189308355 X:40004112-40004134 ATGAGATGGCTTGGGATGGATGG - Intergenic
1189438627 X:41014738-41014760 TTGAATTGATTGGGGATGGATGG + Intergenic
1189693723 X:43642436-43642458 ATGTATTGTGGTGGGGTGGAAGG - Intergenic
1189855401 X:45219272-45219294 ATAAATTGCTTTGGGCTGTATGG - Intergenic
1191055625 X:56237132-56237154 ATGAATTTTTTTGGGGGGGATGG - Intronic
1191232943 X:58110762-58110784 TTCTGTTGGTTTGGGGTGGAGGG - Intergenic
1191925661 X:66307089-66307111 ATAAATTAGTTTGGGGAGTATGG + Intergenic
1191948149 X:66558427-66558449 ATGAATTACTTTGGGGAGTATGG - Intergenic
1193063276 X:77229712-77229734 ATGAATTATTTTGGGCTGTATGG - Intergenic
1194027897 X:88776760-88776782 ATGAATTGCTTTGGGCAGTATGG + Intergenic
1194220260 X:91181615-91181637 ATGAATTGCTTTGGGCAGAATGG + Intergenic
1194875276 X:99179385-99179407 ATGATTTGGCTTAGTGTGGAAGG - Intergenic
1195649892 X:107273363-107273385 ATGGATGGGTTTGGGCTGGCAGG - Intergenic
1196186704 X:112751778-112751800 ATAAATGGGTTGGGGGTGGGTGG + Intergenic
1198486380 X:137091720-137091742 AGGAATAGGGTTGGGGTGGAAGG - Intergenic
1198588169 X:138145947-138145969 AAGAGTTGGGTTGGGGCGGAGGG + Intergenic
1198646421 X:138811868-138811890 ATGGATTGGATTGGGGATGAGGG - Intronic
1200556775 Y:4645367-4645389 ATGAATTGCTTTGGGCAGAATGG + Intergenic
1200640242 Y:5709120-5709142 ATGAATTGGGTGGGGTTGGTTGG - Intronic
1201071740 Y:10153119-10153141 AGGGATTGTTGTGGGGTGGAGGG - Intergenic
1201121736 Y:10878559-10878581 ATGGAATGGATTGGAGTGGAAGG - Intergenic
1201122128 Y:10881238-10881260 ATGGAGTGGTGTGGAGTGGAAGG - Intergenic
1201130824 Y:10950721-10950743 ATGAAATGGAATGGAGTGGAGGG - Intergenic
1201131679 Y:10956479-10956501 ATGAAATGGAATGGAGTGGAGGG - Intergenic
1201136310 Y:10992737-10992759 GTGGAGTGGATTGGGGTGGAGGG - Intergenic
1201136373 Y:10993128-10993150 ATGAAATGGTGTGGAATGGATGG - Intergenic
1201136484 Y:10993953-10993975 ATGAAATGGAGTGGGTTGGAGGG - Intergenic
1201626955 Y:16025109-16025131 ATGGACTGGGCTGGGGTGGATGG - Intergenic
1202623562 Y:56835491-56835513 ATGGAATGGATTGGAGTGGAGGG - Intergenic