ID: 1106315310

View in Genome Browser
Species Human (GRCh38)
Location 13:28588136-28588158
Sequence TAGCTTCCAGAACATGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106315309_1106315310 -9 Left 1106315309 13:28588122-28588144 CCTTCTGGCTGGCTTAGCTTCCA 0: 1
1: 0
2: 0
3: 18
4: 222
Right 1106315310 13:28588136-28588158 TAGCTTCCAGAACATGAGCCTGG 0: 1
1: 0
2: 1
3: 4
4: 127
1106315305_1106315310 6 Left 1106315305 13:28588107-28588129 CCGAGAGGAACTTTCCCTTCTGG 0: 1
1: 0
2: 0
3: 30
4: 260
Right 1106315310 13:28588136-28588158 TAGCTTCCAGAACATGAGCCTGG 0: 1
1: 0
2: 1
3: 4
4: 127
1106315308_1106315310 -8 Left 1106315308 13:28588121-28588143 CCCTTCTGGCTGGCTTAGCTTCC 0: 1
1: 0
2: 0
3: 19
4: 217
Right 1106315310 13:28588136-28588158 TAGCTTCCAGAACATGAGCCTGG 0: 1
1: 0
2: 1
3: 4
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106315310 Original CRISPR TAGCTTCCAGAACATGAGCC TGG Intergenic
900962682 1:5935284-5935306 TAAATTCCAGATCATGGGCCAGG + Intronic
901712283 1:11125063-11125085 TAGCTTCTAGAACTGGGGCCAGG - Intronic
903006517 1:20302491-20302513 TAGCCCCCAGAACTTGAGGCAGG - Intronic
903295136 1:22338968-22338990 GAGCTTACAGAATATGAGCTGGG - Intergenic
904378332 1:30095498-30095520 TGGCTTCCAGAACAGAAGCAGGG + Intergenic
905717602 1:40166069-40166091 TAGCTTCCAGTACATAAACGTGG + Intronic
907298413 1:53470244-53470266 TGCCTTCCAGAACATTATCCCGG - Intergenic
908925354 1:69248080-69248102 TAACTTCAAGAACAGGAGCTTGG - Intergenic
910120306 1:83781396-83781418 TAGCTGTCAGAAGATGATCCTGG + Intergenic
915582451 1:156822904-156822926 TAGCTGCCACACCATGAGTCAGG - Intronic
916002805 1:160633128-160633150 TAGCTTACAGAATGTGACCCCGG - Intronic
916594683 1:166232974-166232996 GAGCTTCCAGAGCAAGAGACAGG - Intergenic
920056545 1:203196995-203197017 AAGGTTCCAGAAGATGAGTCTGG - Intergenic
920057821 1:203205689-203205711 TTGGCTCCATAACATGAGCCAGG - Intergenic
1064597334 10:16959147-16959169 AAGCTTCCAGCACATGAACTTGG + Intronic
1065379346 10:25073965-25073987 TTTCTTTCAGAGCATGAGCCAGG + Intergenic
1067178041 10:43963969-43963991 GAGCTTCCAGCAGCTGAGCCTGG + Intergenic
1067571990 10:47378365-47378387 TAGTTTCCAGAACTTGAGGGTGG - Intronic
1069825903 10:71254782-71254804 CTGCTTCCAGAACAGCAGCCTGG + Intronic
1069945938 10:71985631-71985653 TAGCTCCCACAACAGGAGGCAGG - Intronic
1070265958 10:74903484-74903506 TAGCTTCTAGAAACTGAGCATGG + Intronic
1070469545 10:76765416-76765438 ATGCTTCCAGAAGAGGAGCCAGG - Intergenic
1071468683 10:85963122-85963144 TGGATTCCAGAACATGTTCCTGG + Intronic
1073679063 10:105682117-105682139 AAGCTTACAGAACACCAGCCAGG - Intergenic
1079049547 11:17141663-17141685 TATCTTCCAGAATATAATCCAGG + Intronic
1079797834 11:24828699-24828721 CAGCTTACAGAACATAAGACTGG - Intronic
1082125026 11:48422238-48422260 TAGCTTCCAGCACATGTGTTTGG - Intergenic
1082558692 11:54593502-54593524 TAGCTTCCAGCACATGTGTTTGG - Intergenic
1083308010 11:61770791-61770813 TCCCGTCCAGATCATGAGCCAGG + Intronic
1085519808 11:77131214-77131236 TGGCCTCCAGAGCAGGAGCCAGG + Intronic
1086953822 11:92915945-92915967 TACCTTCCAGCACTTGAACCAGG - Intergenic
1089805469 11:121084164-121084186 AAGTTTCCAGCACATGAGCTTGG + Intronic
1090703520 11:129316442-129316464 TGGCTTCCAGAACCTGTGCTGGG - Intergenic
1094696909 12:32828827-32828849 TAGTTTCCAGGACATGAGAATGG + Intronic
1100916848 12:99433673-99433695 TAGCCTGCTGGACATGAGCCTGG + Intronic
1104349350 12:128031258-128031280 TACCTCCCAGAACAAGAGCTTGG - Intergenic
1105900908 13:24752454-24752476 TAGGTCCAAGAAAATGAGCCTGG + Intergenic
1106315310 13:28588136-28588158 TAGCTTCCAGAACATGAGCCTGG + Intergenic
1107470989 13:40690845-40690867 AAGCTTAAAGAACATGAGGCCGG - Intergenic
1109620277 13:64895575-64895597 TAGCTTCCAGTATATGATACTGG + Intergenic
1117248955 14:53916158-53916180 GAGCTTCCAGAATGTGAGACTGG + Intergenic
1119617375 14:76107713-76107735 GAGCTTCCAGATCAAAAGCCAGG - Intergenic
1121355013 14:93207048-93207070 AAGCTTCCAGAACACGACACCGG + Exonic
1122630991 14:103107726-103107748 TGGCTCCCAGAAGATGAGCCTGG + Exonic
1124142474 15:27089081-27089103 TATCTTCCAGAGGATGTGCCTGG - Intronic
1124345570 15:28919441-28919463 TAGCTTCAGGAACATGTGGCAGG + Intronic
1124652843 15:31485748-31485770 TGGCTTCCAGGGGATGAGCCTGG + Intronic
1126101980 15:45123615-45123637 CAGTTACCAGAACAAGAGCCAGG - Intronic
1129700766 15:77767421-77767443 TAGCTTCCAGAAAAGTTGCCTGG - Intronic
1135142754 16:19935809-19935831 TAGCTTACAAGAAATGAGCCAGG + Intergenic
1140096775 16:71882954-71882976 TAGCTGCCTGAACATGGGCTGGG + Intronic
1141188269 16:81804461-81804483 TAGCTTGCAGCACATGGGCATGG + Intronic
1141483170 16:84320410-84320432 TAACTTCCAGAACTTCTGCCAGG + Intronic
1144688030 17:17239064-17239086 TAGTTTCAAGAACTTGAACCCGG - Intergenic
1146379729 17:32319738-32319760 TAGCTACCAGTTAATGAGCCAGG - Intronic
1155499119 18:26469494-26469516 TATGTTCCAGAAACTGAGCCAGG - Intronic
1157292000 18:46416319-46416341 TGGCTTCCTTATCATGAGCCAGG - Intronic
1159648758 18:70952529-70952551 CTGGTTCCAGAACCTGAGCCAGG - Intergenic
1160342192 18:78099003-78099025 CAGATTACAGAACATGAGGCAGG - Intergenic
1161483307 19:4521610-4521632 GAGATTCCAGAACAGGAGCAGGG + Intergenic
1161709036 19:5837332-5837354 TAGTTTCCATAAAATGAGGCTGG - Intronic
1162411078 19:10505672-10505694 TTCCTTCCAGACCCTGAGCCAGG - Intergenic
1163027594 19:14521602-14521624 AAACTTCCTGAACATGACCCAGG - Intronic
1165321415 19:35087612-35087634 TAACTTCCAGCACATGACCCAGG - Intergenic
1166671148 19:44710334-44710356 TACCTTCCTGAACCTGAACCTGG + Intronic
926116171 2:10214742-10214764 CAGCTTCCAAGACAGGAGCCAGG - Intergenic
930531335 2:52592130-52592152 TAGCTTCCAGAAGATTTTCCTGG + Intergenic
931424562 2:62159030-62159052 GAACTTCCAGAACATGAAGCTGG - Intergenic
936033727 2:109092621-109092643 TAGATTCCAGAACAACAGACTGG - Intergenic
937218883 2:120330061-120330083 TTTCTTCCAGAACAAGAGGCTGG - Intergenic
937568903 2:123333244-123333266 AAGCTTCCAGGACAAGGGCCAGG + Intergenic
937905517 2:127051037-127051059 CAGCTTCCTCAACAGGAGCCAGG + Intronic
942095630 2:172534456-172534478 GAGCTTCCAGAAAATGATGCAGG - Intergenic
942988457 2:182170120-182170142 TAACTTCTAGAACATGATACAGG + Intronic
947899280 2:233706907-233706929 TAGCTGCCAGAGTATGAGTCTGG + Intronic
1168895166 20:1319303-1319325 TAGCTTCCCTAACTTGAGCTGGG + Intronic
1174681250 20:52410921-52410943 TTGCTTCCAGAACGTGCACCGGG + Intergenic
1182041292 22:27240728-27240750 TGGCTGCCAGAACATTAGGCTGG + Intergenic
1183495984 22:38144233-38144255 CAGCTTCCAGAAGAGCAGCCTGG + Intronic
952166221 3:30752052-30752074 TAGGTTTCAGCACATGGGCCTGG - Intronic
952509485 3:34038913-34038935 TAGCTTCCAGAAGGTGTGCAGGG + Intergenic
952898663 3:38095692-38095714 TTGCTGCCAGAACATGAGCCAGG - Intronic
953269029 3:41421763-41421785 TAGCTTCATGAAAATGAACCAGG + Intronic
960317218 3:116192836-116192858 TAGCTCCCTGATCATTAGCCAGG - Intronic
962309443 3:134314772-134314794 TAGCATGCAGGACATGAGACTGG + Intergenic
963538574 3:146559217-146559239 TACCTTCCTGAATATGAGCATGG + Intergenic
966206041 3:177407547-177407569 TTGCTTCCACAACCTGAGTCAGG + Intergenic
968549107 4:1213372-1213394 GAGCTGGCAGAACATGGGCCTGG + Intronic
969299806 4:6291275-6291297 GAGCTTCCAGTACATGACCAGGG - Exonic
972257618 4:37375042-37375064 TTGCTTCCAAAACATGGGCAAGG + Intronic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
975376679 4:73654130-73654152 TAGCCTGCAGAACAGGAGGCTGG + Intergenic
975384551 4:73740597-73740619 AAGCTTCTAGGACAAGAGCCAGG + Exonic
976173972 4:82334005-82334027 AAGCTTCCAGAGCATGGGACGGG + Intergenic
976326234 4:83775032-83775054 TATCTTCCAGAGAATAAGCCTGG - Intergenic
978298997 4:107243610-107243632 TACCCTTCAGAACCTGAGCCAGG + Intronic
978886218 4:113769246-113769268 AACATTCCAGAACATGAACCAGG - Intergenic
989091040 5:37731929-37731951 TAGATTCCAGACCAGGAGCCTGG + Intronic
996919672 5:128753113-128753135 GAGCTCCCAGAACATGATCTAGG - Intronic
997264237 5:132485876-132485898 GAGATTCCAGAACAGGACCCTGG + Intronic
998509038 5:142696071-142696093 TAGCTCCCAGACCATGCACCAGG - Intronic
998939758 5:147268653-147268675 AGGCTTCCAGAACATGAGAATGG - Intronic
999907745 5:156162274-156162296 TAGCTTCCCCAACAGTAGCCTGG - Intronic
1002891832 6:1340085-1340107 TGGCCTCCAGAACATGAGGGAGG - Intergenic
1005685021 6:28245909-28245931 AAGCTTCCAGAAAAGGAGCATGG - Exonic
1005697577 6:28365470-28365492 GAGCTTCCAGAAAAGGAGCATGG + Exonic
1006453891 6:34121329-34121351 CAGCTTCCAGAGCCTGAGCTGGG + Intronic
1009734796 6:67662868-67662890 AAGCTGCAAGAACATTAGCCGGG - Intergenic
1012123213 6:95392857-95392879 TAGCTTCCATTACTTGAGCTGGG - Intergenic
1020006006 7:4784090-4784112 AAGCTGCCTGAACATGAGCCCGG - Intronic
1020353842 7:7255337-7255359 TAGCTGACAAACCATGAGCCTGG - Intergenic
1020652640 7:10894007-10894029 CTGCTTCCAGAACATGTCCCCGG + Intergenic
1022910697 7:34897558-34897580 TAGCGTCAAGAAGATGAGCGTGG + Intergenic
1026853233 7:73737660-73737682 GAGCTACGAGATCATGAGCCAGG - Exonic
1030166500 7:106560902-106560924 CAGATTCTGGAACATGAGCCTGG - Intergenic
1033480031 7:141730451-141730473 CAGCTTACAGAAAATGTGCCTGG + Exonic
1034664237 7:152802257-152802279 TAGGGTCCAGAACATCAGACAGG - Intronic
1044058336 8:87600455-87600477 TATCTTCCACAACATGAACTGGG + Intronic
1046014710 8:108590856-108590878 AAGCTTCCAGAGCAAGAGGCAGG + Intergenic
1046371875 8:113320011-113320033 CAGCTCCCAGAAGATGAGCTTGG - Intronic
1049278478 8:141731876-141731898 TAGCTTCCTGAGCTTGGGCCTGG + Intergenic
1049817739 8:144615743-144615765 GAGCTTTCAGAGCATGAGACTGG - Intergenic
1052939751 9:34123506-34123528 TAGCTTCCAGAACCAAAGCAGGG - Intronic
1053422727 9:37990075-37990097 CAACTTCCAGAACACGAGACTGG + Intronic
1055990906 9:82104726-82104748 TAGCTTCAAGAAGAGGAGCTTGG + Intergenic
1059989179 9:119848521-119848543 CAGCTTCAGAAACATGAGCCTGG + Intergenic
1060283450 9:122228726-122228748 ATGCTTCCAGTACATGGGCCGGG + Exonic
1186806934 X:13149410-13149432 ATGCTTCTGGAACATGAGCCTGG - Intergenic
1189236768 X:39492995-39493017 TGGCTTCCAGAACTGCAGCCTGG + Intergenic
1192830359 X:74744842-74744864 GAGCTTCCAGAACATGGATCTGG - Intronic
1195614863 X:106904048-106904070 TAGCTTCCAGTTCAGAAGCCAGG + Intronic
1196830547 X:119772359-119772381 AAGCTTCCAGAACTTCATCCTGG - Intergenic
1198009041 X:132531526-132531548 GAGCTTCCATAACATGAAGCTGG + Intergenic