ID: 1106316961

View in Genome Browser
Species Human (GRCh38)
Location 13:28602826-28602848
Sequence GGGACCTGAACAATATATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106316961_1106316963 -3 Left 1106316961 13:28602826-28602848 CCATGATATATTGTTCAGGTCCC 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1106316963 13:28602846-28602868 CCCATCAAGCTTAAAGTTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 95
1106316961_1106316965 18 Left 1106316961 13:28602826-28602848 CCATGATATATTGTTCAGGTCCC 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1106316965 13:28602867-28602889 GGAAACCAGCTCCCTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106316961 Original CRISPR GGGACCTGAACAATATATCA TGG (reversed) Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
908257134 1:62312240-62312262 GGGACATAAATAATATTTCAAGG + Intronic
909729843 1:78877375-78877397 GGGGCCTGAACAATCCATGAGGG - Intergenic
914699186 1:150115180-150115202 GAGACCTGAAGAATAGATGAAGG - Intronic
919305962 1:195838253-195838275 GAGACCTGAACACTATACCTTGG - Intergenic
921532980 1:216307775-216307797 GAGAGCTGAACAAAATATAAGGG - Intronic
1065071419 10:22028224-22028246 GGGACCTGGACAATAGTTCAAGG - Intergenic
1071168160 10:82831251-82831273 GGGAACTCAACAATATTTTAGGG + Intronic
1077210611 11:1369479-1369501 GGGAACTCAGCAATAGATCAGGG + Intergenic
1082652358 11:55808941-55808963 GGGATATCAACAAAATATCAAGG - Intergenic
1088417347 11:109604363-109604385 GAGACCTGAATAACATAGCACGG + Intergenic
1089001168 11:115053654-115053676 GGGACCTGAGCAATGCAGCAGGG - Intergenic
1092985321 12:13839453-13839475 GGGAGCTGAAAAACATCTCAGGG - Intronic
1093227787 12:16506319-16506341 GGGACCTGAATATTTTATAATGG + Intronic
1094148461 12:27255800-27255822 GGGACCTGAGCAAGATATACCGG - Intronic
1097592715 12:61591564-61591586 GGGGCCTGAACAATACCTGAGGG - Intergenic
1099291810 12:80784648-80784670 GGGACCTGAACAATCCCTGAGGG + Intergenic
1100040505 12:90311746-90311768 GGGAACTGATTAATATTTCATGG + Intergenic
1100936277 12:99670897-99670919 GGTACATGAAAAATAAATCAGGG + Intronic
1105843272 13:24273771-24273793 GGGAACTGAAAAATAAGTCATGG + Intronic
1106316961 13:28602826-28602848 GGGACCTGAACAATATATCATGG - Intergenic
1106905877 13:34408371-34408393 GGGACCTAACCCATATTTCAGGG + Intergenic
1108156985 13:47595305-47595327 GGGATTTGAACAATATTGCATGG - Intergenic
1110792076 13:79597600-79597622 GGGAAATGAGCAATTTATCATGG - Intergenic
1110957310 13:81571264-81571286 GGGAAATGAAGAATATATAATGG - Intergenic
1112786751 13:102959862-102959884 GTGACCTGAATAATCTCTCAGGG + Intergenic
1120074638 14:80141635-80141657 TGCACCTGAAAAATATATCCAGG + Intergenic
1202833055 14_GL000009v2_random:57680-57702 GGGGCATACACAATATATCACGG + Intergenic
1125212538 15:37234098-37234120 GGGACCTCCACACTATCTCAAGG - Intergenic
1132246795 15:100303265-100303287 AGGACTTGAACAGTGTATCAGGG - Intronic
1132985814 16:2766992-2767014 GGGACCTGGACCATCCATCATGG - Exonic
1137997522 16:53234853-53234875 TGGAACTTAACAATATATAAGGG - Intronic
1138888711 16:61114527-61114549 GGGATCTGGGTAATATATCACGG + Intergenic
1139933635 16:70550733-70550755 GGGACCTGCACAAAATATTGAGG + Intronic
1153325337 18:3812961-3812983 TGGACCTGAAAAATATATTACGG - Intronic
1154221640 18:12459924-12459946 GGAACCTGAACAACAGATAAGGG + Intronic
1155683461 18:28518356-28518378 GGGAGCTGAACAATAACACATGG + Intergenic
1158394362 18:57068194-57068216 GGGACCTGAACAATCCCTGAGGG + Intergenic
1158491154 18:57910857-57910879 GTCCCCTGAACAATATATCAAGG + Intergenic
926313075 2:11688481-11688503 GGGGCCTGAAAAATACAGCAGGG - Intronic
929684133 2:44019842-44019864 GGGTCCTGAACAATACCTGAGGG + Intergenic
933028273 2:77290887-77290909 GAGGCATGAACAACATATCAGGG - Intronic
938574806 2:132593964-132593986 GTGACCTGGACAAAATATCAGGG - Intronic
939736877 2:145858078-145858100 GAGATCTGAACAATGTATTAGGG - Intergenic
941066400 2:160907648-160907670 GGGACTTGAACGAGATGTCAGGG + Intergenic
945048789 2:205804465-205804487 GGGACCTTACCAAAATTTCAGGG + Intergenic
1168794079 20:599523-599545 GGGATATGAACAATAGATTAAGG - Intergenic
1176647946 21:9367629-9367651 GGGGCATACACAATATATCACGG - Intergenic
1178559345 21:33623790-33623812 TGGACCTGCTCAATTTATCATGG + Intronic
1183761877 22:39828073-39828095 TTGAACTGAACAATATATCATGG - Intronic
952070426 3:29627865-29627887 GGGACCTGAAAGATACATAATGG - Intronic
953336366 3:42097757-42097779 CGTACCTGAACTTTATATCAAGG + Intronic
954342615 3:49967692-49967714 GGGACCTGGACATGATTTCAGGG + Exonic
956484539 3:69708391-69708413 GGTACCTCAATAATATATCTTGG + Intergenic
957404813 3:79763825-79763847 TGGACATGAAAAAGATATCAAGG + Intronic
959208176 3:103340407-103340429 GGGACATTAACAATCTCTCAAGG + Intergenic
959235747 3:103719314-103719336 GTGATATGAACAATATATCCAGG - Intergenic
961102957 3:124217394-124217416 GATACCTGAACATTGTATCAGGG + Intronic
966397938 3:179521005-179521027 GGGGCCTGAACAATCTCTGAGGG - Intergenic
966644336 3:182226572-182226594 GGGCCCAGAGCTATATATCAGGG - Intergenic
1202738939 3_GL000221v1_random:37358-37380 GGGGCATACACAATATATCATGG + Intergenic
971284747 4:25277711-25277733 GGGACCAGAAAATTATATCTTGG + Exonic
971578516 4:28305828-28305850 GGGCCCTGAACAATATCTGGAGG + Intergenic
982701166 4:158660801-158660823 GGGCCCTGAACAAAATTTGAAGG + Intergenic
983391090 4:167131121-167131143 GAGACATGAACAAGATCTCATGG + Intronic
983944932 4:173575597-173575619 GGGACCAGAATAATCTATCCTGG - Intergenic
1202766976 4_GL000008v2_random:155885-155907 GGGGCATACACAATATATCACGG - Intergenic
986426836 5:7640687-7640709 GGGAAATGAACAATATAAGAGGG + Intronic
986439518 5:7767658-7767680 AGGACCAGAGCAAAATATCAAGG - Intronic
987079889 5:14417185-14417207 GAGACCTGAAAAATTTAACATGG + Intronic
990116772 5:52400117-52400139 GGGACCTGAACAAAATCTGGAGG + Intergenic
994471050 5:100208218-100208240 GGAAAATGAACAATATATAATGG - Intergenic
994778600 5:104065207-104065229 GGGGCCTGAACAATCCATGAGGG + Intergenic
995706471 5:114993206-114993228 GGGCCCTGAACAAAATATGGAGG + Intergenic
998037030 5:138926144-138926166 GCAACCTGAACAATAGATCTAGG - Intronic
1000115429 5:158149196-158149218 GGGACCTGGACATTTGATCATGG + Intergenic
1000552775 5:162687196-162687218 GGGGCATGACCAAAATATCAGGG + Intergenic
1000614334 5:163411011-163411033 GTGATCTGAATAACATATCACGG + Intergenic
1003491349 6:6624763-6624785 GGGAGCTGATGAAAATATCATGG + Intronic
1004768289 6:18755636-18755658 GGGACCTGAACAATCCCTGAGGG + Intergenic
1004851298 6:19702520-19702542 GGGAATTGAACAATATCACATGG + Intergenic
1007633786 6:43286276-43286298 GGGTCCTGAGCACTAGATCAGGG - Exonic
1007948395 6:45847000-45847022 AAGACTTGAACAAGATATCATGG - Intergenic
1009646018 6:66402810-66402832 GGAAACTGAACAATATATTAGGG - Intergenic
1010354439 6:74915025-74915047 GGGAGCTGGAAAATAAATCAGGG - Intergenic
1012531802 6:100246839-100246861 GGGACTTGAATAGTATACCATGG - Intergenic
1013215494 6:108023755-108023777 GGGAGCTGAACAATAACACATGG + Intergenic
1013907819 6:115238324-115238346 GGGCCCTGAACAAAATATTGAGG - Intergenic
1016707006 6:147120801-147120823 GGGCTCTGAAAAATATATCTGGG - Intergenic
1019050062 6:169176011-169176033 GGGACCTGGACTATAAATAAAGG - Intergenic
1021356555 7:19658219-19658241 GGGCCCTGAACAAAATCTGAAGG - Intergenic
1022620225 7:31976164-31976186 GGTAACTGAATAATATATAACGG + Intronic
1023238105 7:38112390-38112412 GGGAGCTACACAATATATCCTGG - Intergenic
1029974451 7:104819816-104819838 GGCACATGGACAATTTATCAAGG + Intronic
1032313195 7:130807892-130807914 GGGACCTAATAATTATATCAAGG - Intergenic
1034029189 7:147741226-147741248 TGGACCTGAAGAATAGCTCAAGG - Intronic
1034287149 7:149893539-149893561 GGAAGCTTAACAATCTATCAAGG + Intergenic
1034663975 7:152799377-152799399 GGAAGCTTAACAATCTATCAAGG - Intronic
1038787122 8:30628516-30628538 GAGACCTGAAAATTATTTCAAGG + Intronic
1044949340 8:97419920-97419942 AGGACCCTAACAATATATCCTGG + Intergenic
1056062231 9:82895656-82895678 TGGACCTGAACAATCTATATAGG - Intergenic
1061144022 9:128786849-128786871 GGGGCCTGAACAGTTTAGCAGGG + Intergenic
1203707667 Un_KI270742v1:67802-67824 GGGGCATACACAATATATCACGG + Intergenic
1189019014 X:37315473-37315495 GGGATCTGAACACTATCTCTAGG - Intergenic
1192962561 X:76145558-76145580 GGGACCTGAACAAGATAAACGGG - Intergenic
1192962972 X:76149529-76149551 GGGACCTGAACAAGATAAACGGG + Intergenic
1195221669 X:102749725-102749747 GAGGCCAGAACAATATATGAAGG - Exonic
1195854305 X:109313732-109313754 GGGAACTGAACAATAACACATGG - Intergenic
1195976318 X:110531579-110531601 GGAATCTGACCAATAGATCATGG - Intergenic
1197513429 X:127397835-127397857 GGGCCCTGAACAAAATATGGAGG + Intergenic
1198090400 X:133323021-133323043 GGGATCTGAGCAAGATTTCAAGG - Intronic
1199167201 X:144690890-144690912 GGGAGCTGAACAATAACACATGG - Intergenic
1201648868 Y:16264079-16264101 GGGACCTGAACAAAATCTGGAGG - Intergenic
1201653941 Y:16321221-16321243 GGGACCTGAACAAAATCTGGAGG + Intergenic