ID: 1106316963

View in Genome Browser
Species Human (GRCh38)
Location 13:28602846-28602868
Sequence CCCATCAAGCTTAAAGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106316961_1106316963 -3 Left 1106316961 13:28602826-28602848 CCATGATATATTGTTCAGGTCCC 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1106316963 13:28602846-28602868 CCCATCAAGCTTAAAGTTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 95
1106316959_1106316963 8 Left 1106316959 13:28602815-28602837 CCAAGGATTTGCCATGATATATT 0: 1
1: 0
2: 2
3: 11
4: 180
Right 1106316963 13:28602846-28602868 CCCATCAAGCTTAAAGTTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 95
1106316956_1106316963 26 Left 1106316956 13:28602797-28602819 CCTTAGCATACTCAACACCCAAG No data
Right 1106316963 13:28602846-28602868 CCCATCAAGCTTAAAGTTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 95
1106316958_1106316963 9 Left 1106316958 13:28602814-28602836 CCCAAGGATTTGCCATGATATAT No data
Right 1106316963 13:28602846-28602868 CCCATCAAGCTTAAAGTTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106316963 Original CRISPR CCCATCAAGCTTAAAGTTTC AGG Intergenic
901747530 1:11384412-11384434 CGCACAAAGCTTAAAGTTTCAGG - Intergenic
907051524 1:51332556-51332578 CTCAAAAAGCTTCAAGTTTCAGG - Intronic
909347330 1:74606383-74606405 CCCAGAAAGGTTAAAGGTTCTGG - Intronic
911519032 1:98906787-98906809 CCCTTCCATCTTAAAGATTCAGG + Intronic
915322795 1:155065055-155065077 CCCCCCAATCTTAAGGTTTCTGG + Intronic
919347585 1:196404735-196404757 TTCATCAAGCTTATAGTTTAGGG - Intronic
921623403 1:217351397-217351419 CCCATAAATCTTAAACTTTAAGG + Intergenic
922817415 1:228459601-228459623 CCCATAAGGGTTAAAGTTACCGG - Exonic
923159517 1:231304574-231304596 CCCATCTAGCTTCAATTTGCTGG + Intergenic
1063241214 10:4171086-4171108 CCCATCACTCTTCTAGTTTCAGG - Intergenic
1065070313 10:22016897-22016919 ACCATGAAGCTTTAAGTTTCAGG - Intergenic
1072448317 10:95518671-95518693 ACCAGAAAGCTCAAAGTTTCCGG - Intronic
1076654150 10:132011061-132011083 CTCAACACGCTTAAAGTATCAGG - Intergenic
1086165139 11:83769385-83769407 CCCATGAAGCTCATAGTCTCTGG + Intronic
1088804429 11:113339088-113339110 CCCAACAAGGTTTAAGATTCTGG + Intronic
1091762958 12:3099598-3099620 CCCATCAACATTAAATTTACAGG - Intronic
1091832832 12:3562422-3562444 CTCATAAAGCTTACAGTCTCGGG + Intronic
1091849529 12:3684079-3684101 CCCATGTAGCTTAAAGTGTATGG + Intronic
1096547293 12:52348991-52349013 CACATCCAGCTTAAAGATTTGGG - Intergenic
1101288542 12:103342206-103342228 CCCATCAAGTTAAAAGGTTGAGG - Intronic
1105344154 13:19558826-19558848 CCCATCAAGCTTATATTTGCTGG - Intergenic
1105535879 13:21262757-21262779 CCCATCAAGCTTATATTTGCTGG + Intergenic
1106316963 13:28602846-28602868 CCCATCAAGCTTAAAGTTTCAGG + Intergenic
1108460841 13:50665911-50665933 CCCATACAGCCTAAAGTTGCAGG - Intronic
1109559457 13:64027780-64027802 CCCTTAAAGCTTAAAACTTCAGG + Intergenic
1113549418 13:111180775-111180797 CCCATAAAGATTAAATTTCCAGG - Intronic
1115740517 14:36382708-36382730 CTCATCAGGCTCAAAGTCTCTGG + Intergenic
1117780436 14:59226167-59226189 TCCATCAAGCTGAAAGTCCCAGG - Intronic
1118286162 14:64475617-64475639 CCCAGTAAGCTTAAGCTTTCAGG - Intronic
1120004495 14:79341538-79341560 CACAGGCAGCTTAAAGTTTCAGG + Intronic
1120047281 14:79821726-79821748 TTCATCAAGCTTATAGTTTGAGG - Intronic
1125079951 15:35660750-35660772 CCCATTAAACTTTAAGTTTCAGG - Intergenic
1125425556 15:39544845-39544867 TCCATCAACCTCAAAGTGTCAGG - Intergenic
1133907241 16:10033524-10033546 CCCATCAAGCTAAATGTGTTTGG + Intronic
1143142487 17:4749182-4749204 TCCATAAAGCTTACAGTTTAGGG + Intergenic
1146992447 17:37287179-37287201 CCCATCAAGTTTAAATTGTAGGG - Intronic
1149102789 17:52926704-52926726 CCCATCAAACTTAAAGAGTAAGG - Intergenic
1155236723 18:23827373-23827395 CCCATCAAGCAGGAAGTGTCTGG - Exonic
1156760195 18:40579986-40580008 CGCATCAAGCACAAAATTTCTGG + Intergenic
1158475058 18:57772687-57772709 CCTATGAAGCTTAAAGTCTAAGG + Intronic
926181525 2:10648538-10648560 AACATCATGCTTAAAGTTGCTGG + Intronic
926781311 2:16474850-16474872 CACCTGAAGCTTAAAATTTCAGG - Intergenic
929471195 2:42194807-42194829 ACCATCAAGATTAAAGATCCTGG - Intronic
935038073 2:99398334-99398356 GCCATCATTCTTAAAATTTCAGG + Intronic
935057595 2:99581063-99581085 CCCATGAAGCTTACAGTTCTAGG - Intronic
935693719 2:105752694-105752716 CCCATCACCCTTCAAGTCTCTGG + Intronic
939193225 2:138941315-138941337 CCCATCAGACTAACAGTTTCTGG - Intergenic
939534752 2:143414012-143414034 TCCATCAAGCAAAACGTTTCAGG - Intronic
940457504 2:153919504-153919526 CTGCTCAAGATTAAAGTTTCTGG - Intronic
940590493 2:155718731-155718753 CAAAACCAGCTTAAAGTTTCTGG + Intergenic
942690802 2:178582939-178582961 ACCATTAAGCTTAAAGTGTTAGG - Exonic
1168906668 20:1409509-1409531 GCAATCAAGATGAAAGTTTCAGG - Intergenic
1170744787 20:19089874-19089896 CCTGTCAACCTTGAAGTTTCTGG - Intergenic
1172258975 20:33545051-33545073 CTCATGAAGCTTACAGTTTGTGG + Intronic
1173585602 20:44180789-44180811 CACATCACGCCTGAAGTTTCAGG + Intronic
1174284693 20:49464429-49464451 CCCATGAAAATTAAAATTTCTGG + Intronic
1179802682 21:43818643-43818665 CCCACCAAGCATAAAGCCTCAGG - Intergenic
950075862 3:10186528-10186550 CCCATCCAACTTACTGTTTCAGG - Intronic
950830165 3:15866015-15866037 CCCATCAAGCTCCAAATATCAGG + Intergenic
959391013 3:105773632-105773654 AGCTTCATGCTTAAAGTTTCTGG + Intronic
959548307 3:107623724-107623746 CCAATGAAACTTTAAGTTTCAGG - Intronic
964219323 3:154325958-154325980 CCCATCAGGCTTTAAGATTCAGG - Intergenic
965333691 3:167408904-167408926 CTCATAAAGCTTAATGTTTCCGG - Intergenic
965462036 3:168977854-168977876 CACAGCAATCTGAAAGTTTCAGG - Intergenic
968824001 4:2879351-2879373 CTTACCAAGCTTTAAGTTTCTGG + Intronic
971957792 4:33444983-33445005 TTTATTAAGCTTAAAGTTTCAGG - Intergenic
976378749 4:84375486-84375508 CCCATCTAGCTCAAAGCTCCTGG - Intergenic
981007190 4:139888158-139888180 TCCATCAAGCTTGGGGTTTCGGG + Intronic
988392588 5:30655298-30655320 ACCATCATGCTTAAAGTTTGGGG - Intergenic
990752701 5:59035440-59035462 TCCATCAAACTTGAAGTGTCTGG + Intronic
990937341 5:61164376-61164398 CTCATCTAGCTTCAAGTTACAGG + Intergenic
992713798 5:79488780-79488802 CCCATCTAGCTTTAAGATTTAGG - Intronic
992750771 5:79858472-79858494 ACCTCCAAGCCTAAAGTTTCAGG - Intergenic
998956748 5:147446539-147446561 CCCATCTAGCTTAAAGTGCTGGG + Intronic
999589252 5:153125754-153125776 CCCAACAGTCTTAAAGTATCTGG + Intergenic
1003215601 6:4106816-4106838 ATCAACAGGCTTAAAGTTTCAGG - Intronic
1008888684 6:56459863-56459885 CCCTTCAAGCTGAAAGATTTTGG - Intronic
1010709368 6:79154584-79154606 CCTACAAAGCTTAAAGTTTACGG + Intergenic
1013053165 6:106557357-106557379 CCTATCCTGCTTAAAGTTTGTGG - Intronic
1022431409 7:30325982-30326004 TCCATAAATCTTAAAGCTTCTGG + Intronic
1023780899 7:43654153-43654175 CACACCCAGCTCAAAGTTTCTGG + Intronic
1026547028 7:71332036-71332058 CCCATCTAGGCTAAAGTCTCTGG - Intronic
1033850221 7:145486045-145486067 CTCAACACGCTTAAAGTGTCAGG + Intergenic
1035366665 7:158352785-158352807 CCCTTCAATCTAAATGTTTCAGG + Intronic
1035630415 8:1103275-1103297 CCCACCATGCTGAAACTTTCAGG + Intergenic
1037963720 8:23117703-23117725 CCCATGAGGCTTCCAGTTTCTGG - Intergenic
1038153098 8:24959775-24959797 CCCATCTATCTGAAACTTTCAGG - Intergenic
1038448889 8:27626186-27626208 CCCTTTAGGCTTAAATTTTCTGG - Intergenic
1042406614 8:68412914-68412936 CCTATCAAGCTTAAACTCTGTGG + Intronic
1043419831 8:80087148-80087170 CCCATCAACTTTTAAGTTCCAGG + Intronic
1044534330 8:93342197-93342219 CCAAACCAGCTTAATGTTTCTGG + Intergenic
1046837303 8:118816896-118816918 CCCATAGAGCTTAAAGTTGCTGG - Intergenic
1048435172 8:134409650-134409672 CCCCACAAGCTTGGAGTTTCTGG - Intergenic
1048938388 8:139375906-139375928 CCCATAGAGCCTAAATTTTCAGG + Intergenic
1049951242 9:646029-646051 CCCATGGAGCTGATAGTTTCAGG + Intronic
1051057191 9:13001492-13001514 CTTATCAATCTTAAACTTTCTGG + Intergenic
1051231522 9:14960269-14960291 CCCATGGAGCTACAAGTTTCAGG + Intergenic
1052198037 9:25742325-25742347 CCCTTCAAGCTAAAAGGTACAGG - Intergenic
1052447684 9:28585944-28585966 CCAGTGAAGCTTCAAGTTTCTGG + Intronic
1060592194 9:124824565-124824587 CCCATCAATGTTAAAGTTCTTGG - Intergenic
1188074263 X:25755849-25755871 CTCATCAAATTTAAAGTCTCTGG - Intergenic
1194572457 X:95569748-95569770 CCCATCAACTTTTAAGTTCCTGG + Intergenic
1197029089 X:121791941-121791963 CCAATCAACATTGAAGTTTCAGG + Intergenic
1197123105 X:122914420-122914442 CCCATCCAGCTTTAGGCTTCAGG - Intergenic
1200808300 Y:7455352-7455374 CCTGTCAAGATTAAACTTTCTGG - Intergenic