ID: 1106316965

View in Genome Browser
Species Human (GRCh38)
Location 13:28602867-28602889
Sequence GGAAACCAGCTCCCTCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106316959_1106316965 29 Left 1106316959 13:28602815-28602837 CCAAGGATTTGCCATGATATATT 0: 1
1: 0
2: 2
3: 11
4: 180
Right 1106316965 13:28602867-28602889 GGAAACCAGCTCCCTCCTCCTGG No data
1106316961_1106316965 18 Left 1106316961 13:28602826-28602848 CCATGATATATTGTTCAGGTCCC 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1106316965 13:28602867-28602889 GGAAACCAGCTCCCTCCTCCTGG No data
1106316962_1106316965 -2 Left 1106316962 13:28602846-28602868 CCCATCAAGCTTAAAGTTTCAGG No data
Right 1106316965 13:28602867-28602889 GGAAACCAGCTCCCTCCTCCTGG No data
1106316964_1106316965 -3 Left 1106316964 13:28602847-28602869 CCATCAAGCTTAAAGTTTCAGGA No data
Right 1106316965 13:28602867-28602889 GGAAACCAGCTCCCTCCTCCTGG No data
1106316958_1106316965 30 Left 1106316958 13:28602814-28602836 CCCAAGGATTTGCCATGATATAT No data
Right 1106316965 13:28602867-28602889 GGAAACCAGCTCCCTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106316965 Original CRISPR GGAAACCAGCTCCCTCCTCC TGG Intergenic
No off target data available for this crispr