ID: 1106317778

View in Genome Browser
Species Human (GRCh38)
Location 13:28610087-28610109
Sequence CCTCCCTAATCCCAGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106317771_1106317778 0 Left 1106317771 13:28610064-28610086 CCATTAAACAGCTCCTCACTTCC No data
Right 1106317778 13:28610087-28610109 CCTCCCTAATCCCAGGCCCTGGG No data
1106317770_1106317778 26 Left 1106317770 13:28610038-28610060 CCTCTTGTAAAACTGAAACTCTG No data
Right 1106317778 13:28610087-28610109 CCTCCCTAATCCCAGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106317778 Original CRISPR CCTCCCTAATCCCAGGCCCT GGG Intergenic
No off target data available for this crispr