ID: 1106320606

View in Genome Browser
Species Human (GRCh38)
Location 13:28634409-28634431
Sequence ACCAGGGTATTGAGAGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106320606_1106320614 10 Left 1106320606 13:28634409-28634431 CCCTCAGCTCTCAATACCCTGGT No data
Right 1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG No data
1106320606_1106320613 6 Left 1106320606 13:28634409-28634431 CCCTCAGCTCTCAATACCCTGGT No data
Right 1106320613 13:28634438-28634460 CAATTAGTGGAAAAGGAGGAAGG No data
1106320606_1106320612 2 Left 1106320606 13:28634409-28634431 CCCTCAGCTCTCAATACCCTGGT No data
Right 1106320612 13:28634434-28634456 GTAACAATTAGTGGAAAAGGAGG No data
1106320606_1106320609 -7 Left 1106320606 13:28634409-28634431 CCCTCAGCTCTCAATACCCTGGT No data
Right 1106320609 13:28634425-28634447 CCCTGGTGTGTAACAATTAGTGG No data
1106320606_1106320611 -1 Left 1106320606 13:28634409-28634431 CCCTCAGCTCTCAATACCCTGGT No data
Right 1106320611 13:28634431-28634453 TGTGTAACAATTAGTGGAAAAGG No data
1106320606_1106320615 11 Left 1106320606 13:28634409-28634431 CCCTCAGCTCTCAATACCCTGGT No data
Right 1106320615 13:28634443-28634465 AGTGGAAAAGGAGGAAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106320606 Original CRISPR ACCAGGGTATTGAGAGCTGA GGG (reversed) Intergenic
No off target data available for this crispr