ID: 1106320614

View in Genome Browser
Species Human (GRCh38)
Location 13:28634442-28634464
Sequence TAGTGGAAAAGGAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106320608_1106320614 -6 Left 1106320608 13:28634425-28634447 CCCTGGTGTGTAACAATTAGTGG No data
Right 1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG No data
1106320604_1106320614 15 Left 1106320604 13:28634404-28634426 CCTTACCCTCAGCTCTCAATACC No data
Right 1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG No data
1106320607_1106320614 9 Left 1106320607 13:28634410-28634432 CCTCAGCTCTCAATACCCTGGTG No data
Right 1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG No data
1106320606_1106320614 10 Left 1106320606 13:28634409-28634431 CCCTCAGCTCTCAATACCCTGGT No data
Right 1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG No data
1106320610_1106320614 -7 Left 1106320610 13:28634426-28634448 CCTGGTGTGTAACAATTAGTGGA No data
Right 1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106320614 Original CRISPR TAGTGGAAAAGGAGGAAGGA AGG Intergenic
No off target data available for this crispr