ID: 1106324206

View in Genome Browser
Species Human (GRCh38)
Location 13:28672370-28672392
Sequence ATCTTTCACTGGATGTTTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 1, 2: 4, 3: 20, 4: 272}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106324204_1106324206 -4 Left 1106324204 13:28672351-28672373 CCATTTCTTTCAAGCTCAAATCT 0: 1
1: 0
2: 2
3: 41
4: 478
Right 1106324206 13:28672370-28672392 ATCTTTCACTGGATGTTTTGAGG 0: 1
1: 1
2: 4
3: 20
4: 272
1106324202_1106324206 15 Left 1106324202 13:28672332-28672354 CCCAAAGGTTCAGCGTCTTCCAT 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1106324206 13:28672370-28672392 ATCTTTCACTGGATGTTTTGAGG 0: 1
1: 1
2: 4
3: 20
4: 272
1106324201_1106324206 16 Left 1106324201 13:28672331-28672353 CCCCAAAGGTTCAGCGTCTTCCA 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1106324206 13:28672370-28672392 ATCTTTCACTGGATGTTTTGAGG 0: 1
1: 1
2: 4
3: 20
4: 272
1106324198_1106324206 30 Left 1106324198 13:28672317-28672339 CCCTTCATACTTTTCCCCAAAGG 0: 1
1: 0
2: 3
3: 20
4: 258
Right 1106324206 13:28672370-28672392 ATCTTTCACTGGATGTTTTGAGG 0: 1
1: 1
2: 4
3: 20
4: 272
1106324200_1106324206 29 Left 1106324200 13:28672318-28672340 CCTTCATACTTTTCCCCAAAGGT 0: 1
1: 0
2: 2
3: 14
4: 229
Right 1106324206 13:28672370-28672392 ATCTTTCACTGGATGTTTTGAGG 0: 1
1: 1
2: 4
3: 20
4: 272
1106324203_1106324206 14 Left 1106324203 13:28672333-28672355 CCAAAGGTTCAGCGTCTTCCATT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1106324206 13:28672370-28672392 ATCTTTCACTGGATGTTTTGAGG 0: 1
1: 1
2: 4
3: 20
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106324206 Original CRISPR ATCTTTCACTGGATGTTTTG AGG Exonic
901361058 1:8701045-8701067 ATCTTACACTGAAGGTTTTATGG - Intronic
902051256 1:13565258-13565280 CTCTTTCACTGGATGGATAGAGG + Intergenic
906824630 1:48965724-48965746 ATCTTTCACTGTGGGTCTTGGGG + Intronic
907049552 1:51320849-51320871 ATCTATCAGTAGATGTTTTCTGG + Intronic
909110136 1:71465009-71465031 ATCCTTCACTGGATTTCTTCTGG + Intronic
909430932 1:75587085-75587107 TTCATTCACTAGATGTTTTTAGG - Intronic
910401215 1:86839932-86839954 ATCTTTGATTTGATGTCTTGTGG - Intergenic
912089620 1:106055119-106055141 TTCTTACACAAGATGTTTTGTGG - Intergenic
912144619 1:106777920-106777942 AGCTTTCATTGTGTGTTTTGAGG - Intergenic
912799850 1:112714064-112714086 AACTTTCGCTGGATGGTTTTAGG - Intronic
913058462 1:115183387-115183409 ATGTTTAACTGGTTTTTTTGAGG - Intergenic
913331132 1:117668822-117668844 TTCTTTCTCTGTAAGTTTTGGGG + Intergenic
914324530 1:146598816-146598838 CTTTTTCTCTGGATGTTTTGGGG + Intergenic
914760320 1:150593383-150593405 ATTTTTCGATGGATCTTTTGGGG + Intergenic
916851487 1:168708893-168708915 AGCTTTGACTGGGTGCTTTGGGG + Intronic
918664759 1:187136981-187137003 GTCTTTCACTGGAGGTTAAGTGG - Intergenic
922222021 1:223615921-223615943 ATTATACACTTGATGTTTTGGGG - Intronic
923849235 1:237775410-237775432 ATATTTCACTAGATGTAATGTGG - Intronic
923885977 1:238156225-238156247 TTCCTTCACTGGCTTTTTTGGGG - Intergenic
924025839 1:239832087-239832109 AGCTGTCACTGAATGTTTTACGG + Intronic
924390908 1:243555793-243555815 ATCTTTCACTGGATTTTTTCAGG - Intronic
924435317 1:244034822-244034844 ATCTTTCACTGGAAGGTCTTCGG - Intergenic
1064772619 10:18739219-18739241 ATCTTTCTCTCGATCTTTTTTGG + Intergenic
1066111826 10:32204236-32204258 ATCTTTCACTGTTTGGATTGAGG + Intergenic
1066441050 10:35439060-35439082 ATCTTTCTTTGGCTGCTTTGAGG + Intronic
1066819104 10:39461816-39461838 ATCTGTAAGTGGATATTTTGAGG - Intergenic
1068943219 10:62702013-62702035 ATCTTGTCCTGGATGTTTTTTGG - Intergenic
1069014240 10:63410191-63410213 ATATGTCACTGTATGTATTGTGG - Intronic
1069557575 10:69407971-69407993 ATCTTTCACAGGGTGGTTCGGGG - Intronic
1069653688 10:70070937-70070959 GTCATTCTCTGGCTGTTTTGAGG + Intronic
1070292783 10:75131054-75131076 ATCTTTGCCTAGTTGTTTTGAGG - Intronic
1071489581 10:86127247-86127269 CTCTTACACTGGGTGCTTTGGGG - Intronic
1073739401 10:106389556-106389578 ATGTTTCAGTGTATGATTTGGGG - Intergenic
1074164634 10:110864208-110864230 ATGTTTCACAGGATGGTCTGGGG + Intergenic
1074822214 10:117188893-117188915 AGCTTTCATTGGTTATTTTGGGG + Intergenic
1077257268 11:1592163-1592185 ATCTTTTAATGGTTTTTTTGTGG - Intergenic
1077609912 11:3637702-3637724 CTCTGTCTCTTGATGTTTTGAGG + Intergenic
1078099817 11:8323448-8323470 ATCTTTGAATGTGTGTTTTGTGG + Intergenic
1078260996 11:9708749-9708771 ATCTTCCACTTAGTGTTTTGTGG + Intronic
1078680257 11:13469208-13469230 ATTTTTCACTGGAGAATTTGTGG - Intergenic
1078988419 11:16618402-16618424 ATATTTCAATAGATATTTTGAGG - Intronic
1082769379 11:57194825-57194847 CTCATTAACTGGATGTTTTTAGG + Intergenic
1082774253 11:57233811-57233833 AGTGTTCACTGGATGCTTTGAGG + Exonic
1083085389 11:60137817-60137839 ATCTTTAATTGGATTATTTGTGG - Intergenic
1083565881 11:63715782-63715804 TTAGTTCACTGAATGTTTTGTGG + Intronic
1083804164 11:65063937-65063959 ATCCTTCACTGGCTGTCCTGAGG - Intergenic
1084131290 11:67137524-67137546 ACTTTTCATTGAATGTTTTGAGG + Intronic
1084467192 11:69331857-69331879 ATCATTCAATGCATGTTTTCTGG - Intronic
1086228609 11:84541945-84541967 ATCTGTCACTGGAGGTTCTCTGG + Intronic
1087110004 11:94455005-94455027 ATCTTTTACAGGTTGTTTTTTGG - Intronic
1088356280 11:108947360-108947382 ATCTCTACCTGGATGTTTAGTGG + Intergenic
1088638699 11:111850037-111850059 GTATTTTACTAGATGTTTTGAGG - Intronic
1090654133 11:128829741-128829763 TTCTTTCATTTGATGTTTTGAGG + Intergenic
1090866015 11:130701336-130701358 ATCTTTCTCTGGAAGCTTTCAGG + Intronic
1090876051 11:130789778-130789800 ATCTTTCACTGGAGGGATTGGGG + Intergenic
1092019937 12:5193125-5193147 ATTTTTGTCTGTATGTTTTGTGG + Intergenic
1093054176 12:14538113-14538135 ATCTTTCATTTAATGTTTTGGGG + Intronic
1093758362 12:22877683-22877705 ATTTTTCACTGTAAGTTTTCGGG + Intergenic
1094079629 12:26518593-26518615 TTATTTCTATGGATGTTTTGAGG - Intronic
1095057870 12:37638149-37638171 ATCTGTAACTGGATATTTGGAGG - Intergenic
1095058203 12:37644630-37644652 ATCTTCAACTGGATATTTGGAGG - Intergenic
1098838315 12:75447977-75447999 ATCTTTCTCTGCATTCTTTGAGG - Intergenic
1100075726 12:90780626-90780648 ATCTCTCAAAGGATGTTTTAGGG - Intergenic
1100567253 12:95809075-95809097 ATTTTTCACTGCTTGATTTGAGG - Intronic
1100660495 12:96692986-96693008 ATCTTTCTCTGGATGGATCGTGG + Intronic
1100744851 12:97634436-97634458 CTCTTTCTCTGAATCTTTTGAGG + Intergenic
1103361251 12:120355546-120355568 ATTTTTCACTGAATCATTTGAGG - Intronic
1105088948 13:16251203-16251225 ATCTGCAACTGGATATTTTGAGG + Intergenic
1105160076 13:17418144-17418166 ATCTGCAACTGGATATTTTGAGG + Intergenic
1106324206 13:28672370-28672392 ATCTTTCACTGGATGTTTTGAGG + Exonic
1106945956 13:34827965-34827987 ATCTTGCAGTGGAAGTTCTGAGG - Intergenic
1107329268 13:39281085-39281107 ATCTATCACTGTCTGTTTGGTGG - Intergenic
1107730818 13:43346464-43346486 GTCATTCACAGGGTGTTTTGTGG - Intronic
1108101212 13:46958365-46958387 AACTCTTACTGGCTGTTTTGGGG + Intergenic
1108940343 13:55945143-55945165 TTCTTTCACTGAAAGTTGTGTGG + Intergenic
1110658564 13:78030381-78030403 ATCTGTCAGTGGGTGGTTTGAGG + Intergenic
1111001191 13:82185197-82185219 ATCTTTAAATGGCTCTTTTGGGG - Intergenic
1111608166 13:90567467-90567489 CTCTATCAATTGATGTTTTGAGG + Intergenic
1111689160 13:91539575-91539597 AACTCTCACTGGCTGTTTTTGGG + Intronic
1112726936 13:102315433-102315455 ACATTTCACTGCATTTTTTGCGG + Intronic
1112754327 13:102614481-102614503 AGCTTTCACTGGATTTTTGAAGG + Intronic
1113747135 13:112753014-112753036 ATCTTTCACTCTAAGTCTTGGGG + Intronic
1115181074 14:30626455-30626477 ATGTTTCACTGGATGGGCTGGGG - Intronic
1117555432 14:56878579-56878601 ATCTTGACCTGGATGTCTTGTGG - Intergenic
1120285844 14:82499947-82499969 ATCTTTCAGTGGAGGTTTTTTGG - Intergenic
1120720978 14:87889355-87889377 ATGTGTCTCTGGATGTTTGGTGG - Intronic
1202855876 14_GL000225v1_random:52065-52087 ATCTTTCCCTGCATGTTTGCTGG - Intergenic
1126343925 15:47673519-47673541 ATCTTCCACTGAATGTTTTCTGG - Intronic
1126724589 15:51619160-51619182 ACCCTTCAGTGAATGTTTTGAGG - Intronic
1127710967 15:61597854-61597876 ATCTTTCATTGGAAAGTTTGTGG - Intergenic
1130198865 15:81806970-81806992 ATGCATCACTGGATGATTTGTGG - Intergenic
1130844284 15:87730035-87730057 ATCTTTCACTTGAAGTGTTTTGG + Intergenic
1131025381 15:89137079-89137101 ATCTTTGACTGGCTGTTTGCAGG + Intronic
1135249342 16:20887820-20887842 ATCTTTGACTGTATGCCTTGAGG - Intronic
1137836495 16:51597446-51597468 ATCTTTTACTGGATATTTCTTGG + Intergenic
1138086415 16:54137872-54137894 ATATTTCACAGCATGTTTTCAGG + Intergenic
1138785636 16:59842563-59842585 TTTTTTCACTGTATTTTTTGAGG + Intergenic
1140009033 16:71112031-71112053 CTTTTTCTCTGGATGTTTTGGGG - Intronic
1142508967 17:382724-382746 CTCTTGCACTGTATGCTTTGAGG - Intronic
1144355792 17:14444954-14444976 TTATGCCACTGGATGTTTTGTGG - Intergenic
1144991943 17:19238812-19238834 TTCTTTCACAGGATATTTTCTGG - Intronic
1145283467 17:21486084-21486106 ATCTTTCCATGGTTGTTGTGTGG - Intergenic
1146899058 17:36569549-36569571 ATCATTCACTTGATTTTTAGAGG - Intronic
1147643660 17:42020472-42020494 ATCTTTGTCTGGAGCTTTTGGGG + Intronic
1147856578 17:43484956-43484978 ACCAGTCACTAGATGTTTTGGGG + Intronic
1151090616 17:71436015-71436037 TTTTTTAACTGGATGTTTTGGGG + Intergenic
1154050529 18:10952146-10952168 CTGTTTCACTGTTTGTTTTGGGG - Intronic
1156077426 18:33297692-33297714 ATCTGGTACTGGATTTTTTGGGG - Intronic
1156799943 18:41098263-41098285 CTCTTTCACTGGAAATTTTTTGG - Intergenic
1156916210 18:42466454-42466476 CACTTTCACTGGATGTGTAGAGG + Intergenic
1156984603 18:43334557-43334579 AATTTTCTCTTGATGTTTTGGGG + Intergenic
1157594565 18:48856622-48856644 TTCTTTCACTTAATGTTTTCAGG - Intronic
1159148059 18:64480836-64480858 ATCTGGTACTGGATTTTTTGGGG - Intergenic
1159185835 18:64972684-64972706 ATTTTTCAGTGGATGATTTTGGG - Intergenic
1159725691 18:71955004-71955026 TTCACTCACTTGATGTTTTGGGG - Intergenic
1159775140 18:72596073-72596095 CTTTTTTACTGGTTGTTTTGTGG + Intronic
1161071863 19:2266496-2266518 ATCTTTCTCTGGAGGTGGTGAGG - Intronic
1164181237 19:22820585-22820607 ATCTCTTATTGGATGGTTTGAGG - Intergenic
1165178088 19:33944774-33944796 CTCTTTCAATGGAAGTTTTGGGG - Intergenic
1166610251 19:44185581-44185603 TTCTTTCATTGGATTATTTGGGG + Intergenic
1167869436 19:52355507-52355529 ATTTTTCACTGGATCTTTACTGG + Intronic
928791402 2:34959818-34959840 ATATTTCACTGGATTATTTGTGG - Intergenic
930973776 2:57429644-57429666 ATCTTTCACTGGATGTTTGGAGG - Intergenic
931023787 2:58084095-58084117 ATCTTTCTCTGGTTTATTTGTGG - Exonic
933062176 2:77751815-77751837 TTATTTCAGTGCATGTTTTGTGG + Intergenic
933193086 2:79358933-79358955 CTGTTGCACTGGATGTTCTGTGG - Intronic
933814950 2:86059184-86059206 TTCATTCACTGGATGTACTGGGG - Intronic
935320904 2:101888183-101888205 ATATTCCTCTGGATGTTTTAAGG - Intronic
935325454 2:101931866-101931888 ATCTTTCCCTGGAAGCTTTGAGG + Intergenic
935596214 2:104880072-104880094 ATATTTCAGTGGAAGTTTTTGGG + Intergenic
937459760 2:122075652-122075674 ATCTTTCAATTCATGTTTTTTGG - Intergenic
937952611 2:127400543-127400565 ATCTTTTATTGGCTGTATTGAGG - Intergenic
938591794 2:132746423-132746445 ATTTTCTTCTGGATGTTTTGTGG - Intronic
939477854 2:142709638-142709660 AACATTCAGTGGATGTCTTGGGG + Intergenic
941697880 2:168572881-168572903 CTCATTCACTGGACATTTTGGGG - Intronic
948649361 2:239430562-239430584 ATCATACGTTGGATGTTTTGAGG - Intergenic
1169582395 20:7038266-7038288 GTCATTTTCTGGATGTTTTGTGG - Intergenic
1170426197 20:16237587-16237609 GTCTTATACTGGCTGTTTTGGGG + Intergenic
1170854939 20:20043769-20043791 ATCTTACTCTGGATATTATGAGG - Intronic
1175321367 20:58090575-58090597 AGATTTCGATGGATGTTTTGGGG - Intergenic
1175699989 20:61130064-61130086 ATCTTACAGTGAATGTTCTGTGG + Intergenic
1179051104 21:37889232-37889254 TTCTACCTCTGGATGTTTTGAGG + Intronic
1180325369 22:11370085-11370107 ATCTGCAACTGGATATTTTGAGG + Intergenic
1180675387 22:17582679-17582701 ATCCTTCACTGTGTGTTTTTTGG + Intronic
1182195034 22:28506886-28506908 ACCTTTGAATGGATTTTTTGTGG - Intronic
949601862 3:5608362-5608384 ATCTTTCTCTGATTGCTTTGAGG - Intergenic
949745556 3:7288195-7288217 TTGTTTCACTGGATGAGTTGGGG + Intronic
950353684 3:12383410-12383432 ATTTTTTATTGAATGTTTTGTGG + Intronic
950695288 3:14696017-14696039 TTGTTTCTCTGGTTGTTTTGTGG + Intronic
952613240 3:35236844-35236866 ATTTTTCAGTGTATGATTTGGGG + Intergenic
953727978 3:45417357-45417379 ATCTTTTGCTGGATGTTTTCAGG - Intronic
954349150 3:50028072-50028094 TTTTTTAACTAGATGTTTTGAGG + Intronic
955481486 3:59394664-59394686 ATGATTCATTGGATGTTTGGAGG - Intergenic
955579793 3:60406550-60406572 TGCTTTCACTGTATGTTTTGTGG + Intronic
955767064 3:62355967-62355989 CTCTCTCTCTGCATGTTTTGTGG - Intergenic
955774547 3:62419325-62419347 ATTTTTCTCTGGATATGTTGGGG + Intronic
956120528 3:65961506-65961528 ATTTTTCAGTGGATTTTTGGGGG - Intronic
956233138 3:67039655-67039677 AACTTTCACTGGATGGGTAGAGG - Intergenic
956987095 3:74713515-74713537 ATCTTCCAATAGAGGTTTTGGGG + Intergenic
957753836 3:84460785-84460807 ATCTTTCAATGTATTTTTGGAGG + Intergenic
958751412 3:98196188-98196210 AACTTTCACTGGATGGGTAGAGG + Intronic
959237008 3:103737255-103737277 ATCTTTGACTGGTTGTTTTGGGG + Intergenic
960396149 3:117139770-117139792 ATCTATCACTGGAAATTGTGTGG - Intergenic
962286246 3:134087615-134087637 ATGTTTCACTCTATGTTTGGGGG - Intronic
964717747 3:159740553-159740575 AGATTTCATTGGATTTTTTGGGG - Intronic
965473763 3:169129050-169129072 TTCATTGACTGAATGTTTTGGGG + Intronic
965640923 3:170828179-170828201 AACTTTTACTGAATGTTTGGAGG + Intronic
965987003 3:174766363-174766385 ATCTCTCACTGGATCTTTGAGGG + Intronic
968447515 4:659320-659342 AGTTTTCACCGGATGTTTAGTGG + Intronic
968535003 4:1119636-1119658 ATCATACACTGTATGTTTTCAGG + Intergenic
968829882 4:2927723-2927745 ATTTTCTACTGGCTGTTTTGGGG + Intronic
970138839 4:12957708-12957730 ATCTTTCAGTGGATGTAATTTGG + Intergenic
970879294 4:20909506-20909528 AGCATTCACTGGGTGCTTTGGGG - Intronic
971666325 4:29490491-29490513 ATCATACACTGAATGTTTTACGG - Intergenic
971879260 4:32348358-32348380 AGCTTTAATTGGATTTTTTGAGG - Intergenic
975955201 4:79828482-79828504 TTCTTTCCCTGGATGGTATGTGG - Intergenic
978207751 4:106099631-106099653 ATTTTTGACTGGTTGATTTGGGG - Intronic
979818162 4:125136146-125136168 ATCTTTCAATGGCTATTTTTAGG + Intergenic
980153490 4:129077955-129077977 GCTTTTCACTGCATGTTTTGAGG - Intronic
982269398 4:153571069-153571091 ATCTTTCTCTAGATTTTTTTCGG + Intronic
982705685 4:158706320-158706342 ATCTTTTACTGGATATTGAGAGG + Exonic
983159604 4:164395509-164395531 ATCTTTCACAAAATATTTTGTGG - Intergenic
984556777 4:181223669-181223691 ATCTTTCTCTGGTTCTATTGAGG - Intergenic
985577267 5:679234-679256 ATTTTTTTCTGGCTGTTTTGGGG - Intronic
986333016 5:6731766-6731788 AGATTTCACTGGATGTTTAAGGG - Intronic
986524693 5:8661391-8661413 ATCTTTCCCTGGATAATTTCTGG - Intergenic
986563890 5:9091242-9091264 ATCTTTTACTTCATGTTTTGTGG - Intronic
987198936 5:15555227-15555249 TCCTTTAACTGGATGTTCTGTGG - Intronic
988342387 5:29989860-29989882 ATATTTCTCTGGATTTTTGGTGG + Intergenic
988710596 5:33770487-33770509 AGCTTTATCTGGAGGTTTTGTGG + Intronic
989104619 5:37849885-37849907 ATCTTTTAAGGCATGTTTTGGGG + Intergenic
989952289 5:50313809-50313831 ATTTCTCAGTGGTTGTTTTGGGG - Intergenic
990975025 5:61552384-61552406 CTCTTTCACAGAATGTTTTTTGG - Intergenic
991133813 5:63157167-63157189 CTCCTCCACTGGATGTTTTCCGG - Intergenic
991902954 5:71478636-71478658 ATATTTCTCTGGCTGTTTTCAGG + Intronic
992670794 5:79058929-79058951 ATCAGTCACTGGACTTTTTGAGG - Intronic
992845376 5:80741712-80741734 ATATTTCTCTGGGTTTTTTGGGG + Intronic
993882972 5:93384428-93384450 AAATTTCACTGGATTTTTGGAGG - Intergenic
994023043 5:95050216-95050238 AAATTTCACTGGATATTCTGTGG - Intronic
995569046 5:113459986-113460008 AGCTTTCACTGAATGTCATGTGG - Intronic
996918032 5:128734166-128734188 CACTTTCACTGGATGGTTAGAGG + Intronic
998261291 5:140633634-140633656 ATATTTAACTGCATGTTTTGTGG + Exonic
998748046 5:145284373-145284395 ATCTTTCCCAGTCTGTTTTGAGG - Intergenic
998984599 5:147742177-147742199 ATCTTTCAGTGGATTTTTTGTGG + Intronic
1000042612 5:157496183-157496205 ATTTTTCACTTAATTTTTTGTGG + Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1000825933 5:166043515-166043537 ATCTTTCAATGGATCTTAAGAGG + Intergenic
1001897815 5:175396697-175396719 GTCTTTCTCTGGAGGTTTAGGGG - Intergenic
1004204368 6:13578035-13578057 ATGTTTTACTGCATCTTTTGAGG + Intronic
1004307029 6:14510309-14510331 ATCTTACAGTGCATATTTTGAGG - Intergenic
1005073287 6:21882463-21882485 ATCTTCCACTGTAGGTTTTGGGG - Intergenic
1005878755 6:30037538-30037560 GTCTTTTAGTGGATGTTTTTGGG - Intergenic
1007513296 6:42391303-42391325 ATCTTCCAGAAGATGTTTTGGGG + Intronic
1008420266 6:51291104-51291126 ATCAGTCCCTGAATGTTTTGGGG + Intergenic
1008478250 6:51956940-51956962 AGATTCCACTGGAGGTTTTGAGG + Intronic
1009270172 6:61604789-61604811 CACTTTCACTGGATGTGTAGAGG + Intergenic
1009905309 6:69863655-69863677 ATATTCCACTGGTTGTTTTTAGG - Intergenic
1010076173 6:71801658-71801680 ATCTTTTACTGTATCTTTTTTGG + Intergenic
1010086141 6:71920484-71920506 ATTTGTCACTGGATTTTTTTTGG - Intronic
1010295159 6:74186880-74186902 TTTTTTCACTGGAGATTTTGGGG + Intergenic
1010705678 6:79106600-79106622 ATCTGTCACTGGTAGTCTTGTGG - Intergenic
1011125593 6:84003794-84003816 ATATTTCACTGGAGGCTTGGTGG + Intergenic
1011828992 6:91347426-91347448 ATCTTTCAGTGGTTGCTTTGTGG + Intergenic
1012430644 6:99160502-99160524 ATTTTGCATTTGATGTTTTGAGG + Intergenic
1013228427 6:108138570-108138592 TTCTTCCACTGGATATTTTCAGG + Intronic
1013899444 6:115136315-115136337 AACTTTCTCTGCATGTTTTCTGG + Intergenic
1014016952 6:116542884-116542906 ATCTTTCAATAGATGGTCTGTGG + Intronic
1016605883 6:145925510-145925532 TTTTTGCACTGGTTGTTTTGGGG - Intronic
1016852108 6:148630895-148630917 TTCTTTCACTGGTGTTTTTGAGG + Intergenic
1018032852 6:159856758-159856780 ATTTTTCATTGGATTATTTGTGG + Intergenic
1019182142 6:170194517-170194539 ATTTTTCTCTGGCTGTTTTCAGG - Intergenic
1020434352 7:8146690-8146712 GACTTTCACTGGAAGCTTTGGGG - Intronic
1020500683 7:8916086-8916108 AGCTTTCTGTGGATTTTTTGGGG - Intergenic
1021515664 7:21482048-21482070 ATATGCAACTGGATGTTTTGTGG + Exonic
1021883712 7:25118105-25118127 ATCATTCAGTGAATCTTTTGAGG + Intergenic
1022946665 7:35292144-35292166 ATATTTCATTGGATGTATTGAGG + Intergenic
1023413018 7:39906490-39906512 ATTTTTCACTGCCTGTTTCGAGG + Intergenic
1023685217 7:42726870-42726892 ATTTTACAATGGAGGTTTTGAGG - Intergenic
1024432668 7:49308052-49308074 TTCTTTCAGTGGTTGCTTTGGGG + Intergenic
1025310911 7:57940204-57940226 ATCTACCAGTGGATATTTTGAGG - Intergenic
1028039094 7:86025151-86025173 ATCTGTCAATGATTGTTTTGGGG - Intergenic
1028901926 7:96111255-96111277 ATCTTTCTCTGGAGGTTTATAGG + Intergenic
1030445492 7:109643505-109643527 CGCTTTCACTGGATGATTAGAGG - Intergenic
1030455433 7:109766944-109766966 ATCTTTGAATGGGTTTTTTGTGG - Intergenic
1030485352 7:110159253-110159275 ATCCTTCACTAGATGTTTGCAGG + Intergenic
1030708595 7:112722003-112722025 CTATTTCACTGGATATTCTGTGG - Intergenic
1032534695 7:132652988-132653010 ATCTTTCCCATGATGTTTTTGGG + Intronic
1033414194 7:141147791-141147813 ATCTTTAACTGGATGTCCTGTGG - Intronic
1035090001 7:156302066-156302088 TTTTTTCTCTGCATGTTTTGTGG - Intergenic
1035779685 8:2217553-2217575 ATCTTTAAATGTATGTTTTCAGG - Intergenic
1037026897 8:14050050-14050072 ATCTGTCATTGGAGGTTGTGGGG - Intergenic
1038231419 8:25704106-25704128 ATCTTTCACTGGAAGTTACTGGG + Intergenic
1038722501 8:30049539-30049561 ACCTTTCACTTGATGATTTCTGG - Intergenic
1039914185 8:41847578-41847600 ATCTTTCACGAGCTGTCTTGGGG - Intronic
1041195427 8:55397193-55397215 ATCTTTGAGAGGAAGTTTTGTGG + Intronic
1041428805 8:57754623-57754645 TTCTTTCACTGGATATATTTGGG - Intergenic
1041975337 8:63793343-63793365 AACTTTCACTGGGAGTGTTGAGG - Intergenic
1042518108 8:69681170-69681192 ACCATCCACTGAATGTTTTGGGG - Intronic
1047483623 8:125308298-125308320 TATTTTCTCTGGATGTTTTGGGG + Intronic
1047996567 8:130342356-130342378 CTCTGTTACTGGATGTTCTGAGG - Intronic
1048023320 8:130560773-130560795 ATTTTTCACTAGCTGTTTTCAGG + Intergenic
1048505961 8:135021903-135021925 TTCTCTCACTGGATCTTCTGAGG - Intergenic
1050765439 9:9127356-9127378 ATCTCTCACTGTTTGTTATGAGG - Intronic
1051087792 9:13370888-13370910 ATATTTCAGTGGATGTCCTGGGG - Intergenic
1052562449 9:30103583-30103605 TTCTTTTACTTGATGTTTGGGGG + Intergenic
1052569011 9:30197805-30197827 ATCTTGCAATGAATATTTTGGGG - Intergenic
1053316718 9:37058441-37058463 ATTTTTTACTGGATTTTTTAAGG - Intergenic
1056696313 9:88857003-88857025 ATTTTTGTCTTGATGTTTTGGGG - Intergenic
1056978847 9:91288179-91288201 CTCTTCTACTGGAGGTTTTGGGG - Intronic
1057316820 9:93974577-93974599 CTGTTTCACTGTTTGTTTTGGGG - Intergenic
1058331054 9:103760915-103760937 ATGTTTTAATGGATGCTTTGGGG + Intergenic
1059999916 9:119948993-119949015 ATTTTTAACTGTATGTTCTGTGG - Intergenic
1060332320 9:122684096-122684118 ATCTTTTACTTGACATTTTGAGG - Intergenic
1062679320 9:137769145-137769167 TTCTTACACTGTATGTTATGTGG - Intronic
1186235525 X:7504494-7504516 ATCCATCACTGGATGTCTTCAGG - Intergenic
1187066295 X:15842023-15842045 ACCTTTCACAGGGTGTCTTGAGG + Intronic
1187614394 X:20977313-20977335 AACTTTCCCTGGTTATTTTGGGG - Intergenic
1187824472 X:23320889-23320911 ACTTTTGATTGGATGTTTTGGGG - Intergenic
1188814285 X:34692101-34692123 ATCATTTTCTGGTTGTTTTGTGG + Intergenic
1188831610 X:34905185-34905207 ATTTTTCATTGGATTATTTGGGG - Intergenic
1188971161 X:36617086-36617108 ATCTTTCACTGGCTACTATGGGG + Intergenic
1191271246 X:58473893-58473915 ATCTGCAAATGGATGTTTTGAGG + Intergenic
1191565909 X:62529971-62529993 ATCTGTAAATGGATATTTTGAGG + Intergenic
1192356348 X:70407766-70407788 GCCCTTCACTGGATTTTTTGTGG - Intronic
1193185808 X:78510998-78511020 ATCTTGCCCTGGAAATTTTGTGG - Intergenic
1193605296 X:83559994-83560016 ACCTTTCACTGGATATTTTGAGG - Intergenic
1194083368 X:89496420-89496442 ATTTGTTTCTGGATGTTTTGTGG + Intergenic
1194692642 X:97006812-97006834 ATATTTTTCTGGTTGTTTTGTGG + Intronic
1194895517 X:99434802-99434824 ATCCTTCCCTCTATGTTTTGAGG - Intergenic
1195175299 X:102309231-102309253 TTTTTTAACTGGATCTTTTGTGG - Intronic
1195183566 X:102377862-102377884 TTTTTTAACTGGATCTTTTGTGG + Intronic
1195950703 X:110269654-110269676 ATTTTTAGCTGGATGTTATGAGG - Intronic
1196057014 X:111366810-111366832 ATATTTCTCTGGAAGTTATGTGG - Intronic
1197524269 X:127543024-127543046 ATTTTTTTCTGGCTGTTTTGTGG + Intergenic
1198950923 X:142071241-142071263 ATTTTTCACTGATTATTTTGAGG - Intergenic
1199035768 X:143049718-143049740 ATTTTTTACTGGTTGTTTTGTGG + Intergenic
1200436020 Y:3152295-3152317 ATTTGTTTCTGGATGTTTTGTGG + Intergenic
1201064528 Y:10082515-10082537 ATCTGTTACTGGATATTTGGAGG - Intergenic